What do you think?
Rate this book
Schismatrix Plus
Schismatrix Plus, is Bruce Sterling's new trade paperback. For the first time in one volume: every word Bruce Sterling has ever written on the Shapers-Mechanists Universe.
In the last decade, Sterling has emerged a pioneer of crucial, cutting-edge science fiction. Now Ace Books is proud to offer Sterling's stunning world of the Schismatrix--where Shaper revolutionaries struggle against aristocratic Mechanists for ultimate control of man's destiny. This volume includes the classic full-length novel, Schismatrix, plus thousands of words of mind-bending short fiction.
In the last decade, Sterling has emerged a pioneer of crucial, cutting-edge science fiction. Now Ace Books is proud to offer Sterling's stunning world of the Schismatrix--where Shaper revolutionaries struggle against aristocratic Mechanists for ultimate control of man's destiny. This volume includes the classic full-length novel, Schismatrix, plus thousands of words of mind-bending short fiction.
319 pages, Paperback
First published December 1, 1996
About the author
Bruce Sterling
346 books1,133 followersBruce Sterling is an author, journalist, critic and a contributing editor of Wired magazine. Best known for his ten science fiction novels, he also writes short stories, book reviews, design criticism, opinion columns and introductions to books by authors ranging from Ernst Jünger to Jules Verne. His non-fiction works include The Hacker Crackdown: Law and Disorder on the Electronic Frontier (1992), Tomorrow Now: Envisioning the Next Fifty Years (2003) and Shaping Things (2005).
Ratings & Reviews
Friends & Following
Create a free account to discover what your friends think of this book!
Community Reviews
Displaying 1 - 30 of 248 reviews
May 8, 2013
What a great read this was. I've never been much of a fan of cyberpunk and I'm not particularly a fan of the authors generally noted to be founders of the genre (William Gibson, Neal Stephenson, etc.), but I really loved this book and it has put Bruce Sterling near the top of my list for sci-fi writers. Sterling does an excellent job of melding his cyberpunk ethos with a space opera-ish background that is combined with the 'Grand Tour' of the solar system structure (cp. The Ophiuchi Hotline by John Varley or Vacuum Flowers by Michael Swanwick) to create a really delectable sci-fi romp. (Though perhaps "romp" isn't quite the right word.)
_Schismatrix Plus_ is composed of the novel _Schismatrix_ along with all of the published short stories in the same Shaper/Mechanist universe (I wish there were more). The Shapers and Mechanists are the two major offshoots of humanity who have colonised the solar system in a slower-than-light-speed cosmos. The Shapers are a faction devoted to the improvement of the human form and mind through genetic engineering and are known for their somewhat aristocratic and elitist bearing, while the Mechanists are those who instead chose the path of merging the human form with machine technology in the quest for immortality and transcendance. The Earth kicked both factions out at some point in the past and is now considered interdicted by both.
In _Schismatrix_ itself we follow Abelard Lindsay, an aristocrat from one of the earliest space habitats orbiting the moon, who was sent to be trained as a Shaper 'diplomat' in his youth and who is ultimately betrayed by his childhood friend and colleague Philip Constantine as they try to overthrow the gerontocracy of their republic (not really a spoiler as this happens early in the book and is the main impetus for the plot). Lindsay is sent into exile and thus begins his great tour of the solar system where he comes across many of the human factions and organizations vying for power.
The solar system that Sterling creates is a colourful one and is filled with interesting characters and groups, some aligned with one or the other of the Shapers and Mechanists, and some looking out only for themselves. These include a prostitute/banker who becomes an ecosystem in herself, a playwright-Mechanist, a group of space pirates who are also their own nation-state, and a clan of Shaper terraformers. Throughout his adventures Lindsay is both shaped by, and shapes, the human ecumene around him, at first simply trying to survive and later working towards fulfilling his great dreams for a post-human future for humanity. Added into this heady mix is a first contact with aliens that throws off the detente of the Shaper-Mechanist war. The story really is a tour de force as we follow Lindsay's rising and falling fortunes and get a glimpse of wide swathes of the fascinating human solar system created by Sterling.
Sterling's world is further fleshed out by the short stories included here: "Swarm" - a chilling tale of Shaper meddling in things best left alone, "Spider Rose" - the tale of a Mechanist loner who gets more than she bargains for when she trades with aliens, "Cicada Queen" - the story of an innovative Shaper that ties in with some of the events of _Schismatrix_, "Sunken Gardens" - a tale of competition and terraforming to achieve a new post-human dream, and "Twenty Evocations" - a somewhat experimental story detailing snapshots of the life of the Shaper Nikolai Leng.
Alastair Reynolds has acknowledged his debt to Sterling in the creation of his own "Revelation Space" universe and I'm a little surprised that there aren't more sci-fi writers mining the myriad of ideas that Sterling throws off with seeming effortlessness in these stories. This really is a great ride and is highly recommended for lovers of sci-fi.
Also posted at Shelf Inflicted
_Schismatrix Plus_ is composed of the novel _Schismatrix_ along with all of the published short stories in the same Shaper/Mechanist universe (I wish there were more). The Shapers and Mechanists are the two major offshoots of humanity who have colonised the solar system in a slower-than-light-speed cosmos. The Shapers are a faction devoted to the improvement of the human form and mind through genetic engineering and are known for their somewhat aristocratic and elitist bearing, while the Mechanists are those who instead chose the path of merging the human form with machine technology in the quest for immortality and transcendance. The Earth kicked both factions out at some point in the past and is now considered interdicted by both.
In _Schismatrix_ itself we follow Abelard Lindsay, an aristocrat from one of the earliest space habitats orbiting the moon, who was sent to be trained as a Shaper 'diplomat' in his youth and who is ultimately betrayed by his childhood friend and colleague Philip Constantine as they try to overthrow the gerontocracy of their republic (not really a spoiler as this happens early in the book and is the main impetus for the plot). Lindsay is sent into exile and thus begins his great tour of the solar system where he comes across many of the human factions and organizations vying for power.
The solar system that Sterling creates is a colourful one and is filled with interesting characters and groups, some aligned with one or the other of the Shapers and Mechanists, and some looking out only for themselves. These include a prostitute/banker who becomes an ecosystem in herself, a playwright-Mechanist, a group of space pirates who are also their own nation-state, and a clan of Shaper terraformers. Throughout his adventures Lindsay is both shaped by, and shapes, the human ecumene around him, at first simply trying to survive and later working towards fulfilling his great dreams for a post-human future for humanity. Added into this heady mix is a first contact with aliens that throws off the detente of the Shaper-Mechanist war. The story really is a tour de force as we follow Lindsay's rising and falling fortunes and get a glimpse of wide swathes of the fascinating human solar system created by Sterling.
Sterling's world is further fleshed out by the short stories included here: "Swarm" - a chilling tale of Shaper meddling in things best left alone, "Spider Rose" - the tale of a Mechanist loner who gets more than she bargains for when she trades with aliens, "Cicada Queen" - the story of an innovative Shaper that ties in with some of the events of _Schismatrix_, "Sunken Gardens" - a tale of competition and terraforming to achieve a new post-human dream, and "Twenty Evocations" - a somewhat experimental story detailing snapshots of the life of the Shaper Nikolai Leng.
Alastair Reynolds has acknowledged his debt to Sterling in the creation of his own "Revelation Space" universe and I'm a little surprised that there aren't more sci-fi writers mining the myriad of ideas that Sterling throws off with seeming effortlessness in these stories. This really is a great ride and is highly recommended for lovers of sci-fi.
Also posted at Shelf Inflicted
July 25, 2016
The moment I read in Galactic North that Alastair Reynolds acknowledged Schismatrix as a huge influence in developing his Revelation Space series, I knew I had to eventually track it down. Four years later, eventually finally happened.
So let me first of all clarify the difference between Schismatrix and Schismatrix Plus. The Plus edition has five short stories set in the Schismatrix universe along with the novel length title story. These short stories were enjoyable- especially Swarm which brought to mind Peter Watt's excellent Blindsight in its treatment of a bizarre alien hive intelligence perhaps even more chilling than the Scramblers.
Overall, I enjoyed Schismatrix Plus, but I had some issues which dropped it from the four or five star book I initially thought I was reading. First the positive: this is such an ambitious and imaginative work that only manages to occasionally feel dated for its thirty year age. The ideas in this book come flying at a furious pace as it chronicles the life of an ambitious aristocrat navigating his way through a solar system where post humanity has split into various factions vying for power. There is no singular post humanity in Sterling's universe, there are several clades of humanity. Imaginative, unforgettable, and even absurdly comical scenes are in abundance on this odyssey.
The problem is that Schismatrix reads like a loose collection of short stories. The nebulous plot consists of the protagonist trying to outsmart and play the factions against each other through a diverse setting of locations and times in the Solar System. But here is the problem. Schismatrix is like a trying to eat a dozen colorful donuts on your own - at first a delightful enterprise but after a couple, your taste buds are worn out and it starts becoming a tad tiresome. Schismatrix lacks substance and instead is only propelled by Sterling's vertiginous ideas. There was simply no reason to care and no one to really care for in this long journey, which is why I have to give it no more than three stars. I still believe it's worth a look if you are not dissuaded by what it lacks, and are interested in a challenging and wild reading experience.
So let me first of all clarify the difference between Schismatrix and Schismatrix Plus. The Plus edition has five short stories set in the Schismatrix universe along with the novel length title story. These short stories were enjoyable- especially Swarm which brought to mind Peter Watt's excellent Blindsight in its treatment of a bizarre alien hive intelligence perhaps even more chilling than the Scramblers.
Overall, I enjoyed Schismatrix Plus, but I had some issues which dropped it from the four or five star book I initially thought I was reading. First the positive: this is such an ambitious and imaginative work that only manages to occasionally feel dated for its thirty year age. The ideas in this book come flying at a furious pace as it chronicles the life of an ambitious aristocrat navigating his way through a solar system where post humanity has split into various factions vying for power. There is no singular post humanity in Sterling's universe, there are several clades of humanity. Imaginative, unforgettable, and even absurdly comical scenes are in abundance on this odyssey.
The problem is that Schismatrix reads like a loose collection of short stories. The nebulous plot consists of the protagonist trying to outsmart and play the factions against each other through a diverse setting of locations and times in the Solar System. But here is the problem. Schismatrix is like a trying to eat a dozen colorful donuts on your own - at first a delightful enterprise but after a couple, your taste buds are worn out and it starts becoming a tad tiresome. Schismatrix lacks substance and instead is only propelled by Sterling's vertiginous ideas. There was simply no reason to care and no one to really care for in this long journey, which is why I have to give it no more than three stars. I still believe it's worth a look if you are not dissuaded by what it lacks, and are interested in a challenging and wild reading experience.
June 14, 2016
Alastair Reynolds said, in one of his Revelation Space books, that Bruce Sterling’ Schismatrix had a huge influence on his works and recommends it as one of the best cyberpunk stories. Of course it piqued my interest and now, after I read it, I have to say he was right - at least about the influence part.
It is obvious that Shaper/Mechanist universe stands at the base of Conjoiners/Demarchists one and that the somber atmosphere is the one encountered mostly in Chasm City. But the similarities between the two end here. World building is almost nonexistent in Schismatrix but present to some degree in his short stories which are set in the same universe. Also, the action starts too sudden, without preparing the reader for such a turn of events and the strange inhabitants of an even stranger world; I missed the gradual immersion of Reynolds’ style. I guess being AR’s fan didn’t help much.
In fact, the whole time I got the feeling that Bester’s Deceivers got lost in Chasm City, lol.
As for the short stories, Swarm and Spider Rose deserve 5 awesome stars.
And even if Sterling’ style doesn’t exactly match my taste, I really enjoyed his sharp irony and subtle humor and I have to give him credit for the imagination. Had I have read it before Revelation Space I would have been stunned by it. After all, he’s not being considered one of the cyberpunk's founders for nothing.
It is obvious that Shaper/Mechanist universe stands at the base of Conjoiners/Demarchists one and that the somber atmosphere is the one encountered mostly in Chasm City. But the similarities between the two end here. World building is almost nonexistent in Schismatrix but present to some degree in his short stories which are set in the same universe. Also, the action starts too sudden, without preparing the reader for such a turn of events and the strange inhabitants of an even stranger world; I missed the gradual immersion of Reynolds’ style. I guess being AR’s fan didn’t help much.
In fact, the whole time I got the feeling that Bester’s Deceivers got lost in Chasm City, lol.
They took my womb out, and they put in brain tissue. Grafts from the pleasure center, darling. I’m wired to the ass and the spine and the throat, and it’s better than being God. When I’m hot, I sweat perfume. I’m cleaner than a fresh needle, and nothing leaves my body that you can’t drink like wine or eat like candy.”
The Zaibatsu recognizes one civil right: the right to death. You may claim your right at any time, under any circumstances. All you need do is request it. […]
“Do you wish to claim your civil right?”
“No, thank you”, Lindsay said politely. “But it’s a great solace to know that the Zaibatsu government grants me this courtesy. I will remember your kindness.”
As for the short stories, Swarm and Spider Rose deserve 5 awesome stars.
And even if Sterling’ style doesn’t exactly match my taste, I really enjoyed his sharp irony and subtle humor and I have to give him credit for the imagination. Had I have read it before Revelation Space I would have been stunned by it. After all, he’s not being considered one of the cyberpunk's founders for nothing.
May 27, 2013
A bizarre absurdist bourgeois epic set in the space kindgom of the posthuman con artists. Features hyperbole and sharp dark humor.
As scientific and technological advances shatter the limitations which define modern thought and sustain the existence of a single human community, rugged individualists and pretentious youths boldy reach for transcendance.
But as it turns out, it's bourgeois property relations which end up transcending the material conditions that sustained them. Commodity fetichism doesn't even begin to describe this. Freed from all material and social limitations to imprint their mystical freedom on a boundless cosmic blackboard, people file patents and trade stocks. Nobody is in a position to actually enforce these property claims but people organize their lives around them anyway. And so genetically-engineered super-Ponzis enjoy unfettered power over people's lives and homes.
Do not fear: this book has a high irony content. This Austrian economic cult seems to be a product of cosmic evolution. Indeed, in Schismatrix's universe the only thing that seems to allow advanced cultures to exist for long is this sort of capitalist nonsense. Cultures which are not obssessed by it find something better to do than existence, you see. Therefore pointless interstellar markets exist. Because "futility is freedom".
Or something.
Sterling is so deadpan with this stuff I don't know what he was thinking. I do hope it's some kind of satire.
Nonsense and cool existential musings aside, this book is crammed with nice SF concepts and fun and/or dirty details. If you don't mind all those quaint data tapes, that is.
But it's disjointed, uneven, aimless and (as you might have guessed by now) fundamentally implausible.
Parts of the book are simply nuts. It's also a difficult read at times and a couple of scenes are borderline incomprehensible.
All that said, Schismatrix is not 100% silly. Serious issues are alluded to and stimulating ideas are shared with the reader.
This book is also noteworthy for beign influential among hardcore genre practictioners.
Alastair Reynolds' much more reasonable new series (as far as the first installment is concerned anyway) owes much to it for instance.
As scientific and technological advances shatter the limitations which define modern thought and sustain the existence of a single human community, rugged individualists and pretentious youths boldy reach for transcendance.
But as it turns out, it's bourgeois property relations which end up transcending the material conditions that sustained them. Commodity fetichism doesn't even begin to describe this. Freed from all material and social limitations to imprint their mystical freedom on a boundless cosmic blackboard, people file patents and trade stocks. Nobody is in a position to actually enforce these property claims but people organize their lives around them anyway. And so genetically-engineered super-Ponzis enjoy unfettered power over people's lives and homes.
Do not fear: this book has a high irony content. This Austrian economic cult seems to be a product of cosmic evolution. Indeed, in Schismatrix's universe the only thing that seems to allow advanced cultures to exist for long is this sort of capitalist nonsense. Cultures which are not obssessed by it find something better to do than existence, you see. Therefore pointless interstellar markets exist. Because "futility is freedom".
Or something.
Sterling is so deadpan with this stuff I don't know what he was thinking. I do hope it's some kind of satire.
Nonsense and cool existential musings aside, this book is crammed with nice SF concepts and fun and/or dirty details. If you don't mind all those quaint data tapes, that is.
But it's disjointed, uneven, aimless and (as you might have guessed by now) fundamentally implausible.
Parts of the book are simply nuts. It's also a difficult read at times and a couple of scenes are borderline incomprehensible.
All that said, Schismatrix is not 100% silly. Serious issues are alluded to and stimulating ideas are shared with the reader.
This book is also noteworthy for beign influential among hardcore genre practictioners.
Alastair Reynolds' much more reasonable new series (as far as the first installment is concerned anyway) owes much to it for instance.
March 2, 2010
I had written Bruce Sterling off as a relic of the cyberpunk era, big mistake. The wow factor is pretty big on this. Mind mutating, WTF, idea per sentence science fiction with shades at time of Bester, Triptree jr. Delaney, Barrington J. Bailey(who blurbs it) William S. Burroughs, and Ballard. Dense, filled with absurd humor and grotesque surreal visions, as human future and form breaks and cascades into increasing odd shapes. I feel a little buzzed after finishing this. This and a couple of short stories have put Sterling on my favorites list. This book also had a profound influence on the books of Charles Stross and Alastair Reynolds, the former taking the zany idea flinging and economic speculation and the latter the grim, fractured weirdness.
May 17, 2022
Neutron Star-Dense Cyberpunk, Hugely Influential, Hard to Digest
Back in the 1980s, it was William Gibson's Neuromancer (1984), Bruce Stirling's Schismatrix (1985), Walter Jon Williams' Hardwired (1985), and Neal Stephenson's Snow Crash (1992) that gave birth to the concept of cyberpunk, shaking things up by mixing dystopian themes with the latest technology extrapolation, early iterations of the internet, cybernetic enhancements, hackers, AIs, and so forth. And of course the excellent later cyberpunk novel Altered Carbon (2002) by Richard Morgan owes a huge debt. But of that group, Sterling's Schismatrix is actually a lot more, it really goes galactic and post-human and explores themes that of human genetic and technological advances that bring mankind closer to the singularity, again before that terms was bandied about so frequently. It apparently was a major influence of the SF creations of Alastair Reynolds and Charles Stross as well.
So it's a bit sad that this was the only full-length outing that Sterling wrote about his Shaper-Mechanist universe, along with a series of excellent short-stories written previously that are included in Schismatrix Plus, namely "Swarm", "Spider Rose", "Cicada Queen", "Sunken Gardens", and "Twenty Evocations". There was enormous potential to expand on any of the seething mass of ideas that are jam-packed into this small but ultra-dense novel that still feels like a serious of vignettes, brief glimpses of a cold and scary post-human universe, ala Alastair Reynolds.
While it gets full marks for its brilliant ideas, free-wheeling extrapolation, and diamond-hard prose, it is also almost unreadable at times, given how much is packed into such tight passages and episodes. There is also a lot of implausible far-future developments, and of course a severe lack of relatable characters just like William Gibson, but then again that is a defining characteristic of cyberpunk in my view, as it's fundamentally dystopian and often a warning of what might happen if we surrender ourselves to AIs, technology, and hyper-capitalism at the expense of our humanity.
Back in the 1980s, it was William Gibson's Neuromancer (1984), Bruce Stirling's Schismatrix (1985), Walter Jon Williams' Hardwired (1985), and Neal Stephenson's Snow Crash (1992) that gave birth to the concept of cyberpunk, shaking things up by mixing dystopian themes with the latest technology extrapolation, early iterations of the internet, cybernetic enhancements, hackers, AIs, and so forth. And of course the excellent later cyberpunk novel Altered Carbon (2002) by Richard Morgan owes a huge debt. But of that group, Sterling's Schismatrix is actually a lot more, it really goes galactic and post-human and explores themes that of human genetic and technological advances that bring mankind closer to the singularity, again before that terms was bandied about so frequently. It apparently was a major influence of the SF creations of Alastair Reynolds and Charles Stross as well.
So it's a bit sad that this was the only full-length outing that Sterling wrote about his Shaper-Mechanist universe, along with a series of excellent short-stories written previously that are included in Schismatrix Plus, namely "Swarm", "Spider Rose", "Cicada Queen", "Sunken Gardens", and "Twenty Evocations". There was enormous potential to expand on any of the seething mass of ideas that are jam-packed into this small but ultra-dense novel that still feels like a serious of vignettes, brief glimpses of a cold and scary post-human universe, ala Alastair Reynolds.
While it gets full marks for its brilliant ideas, free-wheeling extrapolation, and diamond-hard prose, it is also almost unreadable at times, given how much is packed into such tight passages and episodes. There is also a lot of implausible far-future developments, and of course a severe lack of relatable characters just like William Gibson, but then again that is a defining characteristic of cyberpunk in my view, as it's fundamentally dystopian and often a warning of what might happen if we surrender ourselves to AIs, technology, and hyper-capitalism at the expense of our humanity.
July 21, 2008
Another goodreads reviewer wrote: "It is creative, but one of the characteristics of this book is that the author writes as if the story is happening in our present world, so he does not define words and key elements just as an author writing in the present wouldn't define terms they assume are collective knowledge." They gave this book one star. One star!
It's times like these I realize how crazy some people are. The above technique is one of the marks of good science fiction, as opposed to the forced and schlocky shit people think of when they think of "science fiction".
Anyway, in protest of this confusing and misguided review, I'm upping my rating to five. I have only fond memories of Schismatrix Plus. Cockroaches! Space pirates! Zero-G martial arts! Terrible bacterial infections! Genetically-engineered hookers!
I guess "it was amazing".
It's times like these I realize how crazy some people are. The above technique is one of the marks of good science fiction, as opposed to the forced and schlocky shit people think of when they think of "science fiction".
Anyway, in protest of this confusing and misguided review, I'm upping my rating to five. I have only fond memories of Schismatrix Plus. Cockroaches! Space pirates! Zero-G martial arts! Terrible bacterial infections! Genetically-engineered hookers!
I guess "it was amazing".
June 7, 2023
Slow moving but interesting. This is definitely a different stream of cyberpunk that I am used to.
The long saga time-span of the story gave it a hint of Foundation era Asimov that is unusual for this genre. The ending gave the whole thing a touch of sentimentality that I associate with Bradbury. (also unusual for this genre)
These add some unusual spice to what would normally be a sleek and fast-moving projectile of a story.
The long saga time-span of the story gave it a hint of Foundation era Asimov that is unusual for this genre. The ending gave the whole thing a touch of sentimentality that I associate with Bradbury. (also unusual for this genre)
These add some unusual spice to what would normally be a sleek and fast-moving projectile of a story.
September 5, 2020
The only reason I finished this book is because it was my job and I was being paid to do it. I run a SFF book club for my library, and I try to come up with cogent questions to start the discussion and keep it moving if there are ever any lulls (which happens rarely, in a group of smart and opinionated SFF fans), but these were literally the first two questions I came up with to share with the group:
1. WHAT HAPPENED
2. LITERALLY WHAT IS ANYONE’S DRIVING PHILOSOPHY OR MOTIVATION
I agree wholeheartedly with another review that called this book under-theorized, but with sharp descriptions. The problem is, the descriptions go nowhere. None of the factions and why they are fighting are ever explained in any coherent way, and the main character is a bit of a feckless Gary Stu. It also suffers from that common yet unpleasant trope of its time, wherein the most amazing thing is that the hero manages to accomplish anything at all, what with all the Space Babes throwing themselves at him and demanding he make the sex with them IMMEDIATELY upon meeting him. These women are then usually killed off, to spur the hero on to further righteous accomplishment (maybe...since it's hard to tell what he is doing or why he is doing it the whole time). This, plus the exceedingly dodgy "science" and the extremely Arthur C. Clarke ending, make me question why this is commonly classified as hard/cyberpunk sci-fi, as we are clearly well into fantasy territory here.
The short stories at the end of this edition have much tighter writing and more coherent plotting (except for the very last, which is literally a list of 20 bullet points about a character, and seems more like an outline for another book/story than anything else). All in all, it seems like Sterling should have stuck to the short story format, because the novel hangs together not at all.
1. WHAT HAPPENED
2. LITERALLY WHAT IS ANYONE’S DRIVING PHILOSOPHY OR MOTIVATION
I agree wholeheartedly with another review that called this book under-theorized, but with sharp descriptions. The problem is, the descriptions go nowhere. None of the factions and why they are fighting are ever explained in any coherent way, and the main character is a bit of a feckless Gary Stu. It also suffers from that common yet unpleasant trope of its time, wherein the most amazing thing is that the hero manages to accomplish anything at all, what with all the Space Babes throwing themselves at him and demanding he make the sex with them IMMEDIATELY upon meeting him. These women are then usually killed off, to spur the hero on to further righteous accomplishment (maybe...since it's hard to tell what he is doing or why he is doing it the whole time). This, plus the exceedingly dodgy "science" and the extremely Arthur C. Clarke ending, make me question why this is commonly classified as hard/cyberpunk sci-fi, as we are clearly well into fantasy territory here.
The short stories at the end of this edition have much tighter writing and more coherent plotting (except for the very last, which is literally a list of 20 bullet points about a character, and seems more like an outline for another book/story than anything else). All in all, it seems like Sterling should have stuck to the short story format, because the novel hangs together not at all.
April 5, 2020
This is it. This is my very favorite book, one of the immortal classics of 20th century science fiction, and a work that is as live and thrilling as the first time I read it.
Sterling captures the epic of sweep of posthuman history, following Abelard Lindsay, diplomat, playwright, scholar, defector, through centuries of adventures across the vast expanse of the solar system. Space-faring humanity has been blown apart by their technology, drifting into the major camps of the cybernetically enhanced Mechanists and the genetically altered Shapers. The two sides engage in constant covert war, pushing at the very limits of what it means to be a cohesive human community, and evolving towards something as far beyond humanity as life is beyond dead matter.
Against this incredibly imaginative cosmological speculation, Sterling tackles very grounded questions. How do much do we love? How much do we hate? Can we be freely redefined, or are some things (ideals, scars, destinies) fixed? How can we measure ambition, power, accomplishment, the value of a life? This book, with the novel and handful of Shaper/Mechanist short stories included, is Sterling's masterpiece-the high voltage work of an author at the top of his game. Read it.
***
Updated for Jan 8, 2017: Still perfect.
Sterling captures the epic of sweep of posthuman history, following Abelard Lindsay, diplomat, playwright, scholar, defector, through centuries of adventures across the vast expanse of the solar system. Space-faring humanity has been blown apart by their technology, drifting into the major camps of the cybernetically enhanced Mechanists and the genetically altered Shapers. The two sides engage in constant covert war, pushing at the very limits of what it means to be a cohesive human community, and evolving towards something as far beyond humanity as life is beyond dead matter.
Against this incredibly imaginative cosmological speculation, Sterling tackles very grounded questions. How do much do we love? How much do we hate? Can we be freely redefined, or are some things (ideals, scars, destinies) fixed? How can we measure ambition, power, accomplishment, the value of a life? This book, with the novel and handful of Shaper/Mechanist short stories included, is Sterling's masterpiece-the high voltage work of an author at the top of his game. Read it.
***
Updated for Jan 8, 2017: Still perfect.
July 4, 2019
I enjoyed this! Sterling's writing style hooked me int he first few pages. I appreciate his literary feel, and his use of drama, and non-typical sci-fi aspects in his novel. The story unfolds over the life of the main character. It's a future world hooked into computer systems, genetic manipulations and hybrids, aliens, inter-planetary issues, action, mystery, suspense. Although I found the writing difficult to adapt to, I found this a great pleasure. I like his characters. They have depth to me. He also describes in detail the workings of the technology, which makes it more believable.
March 20, 2020
I don't normally like cyberpunk and given the choice, I never would have picked this up. But a book club chose it, so I had to read it. And then I actually...liked it? I can't even put my finger on what exactly I liked about it. It was a romp through space without a storyline. The characters did not do anything meaningful or memorable. I just enjoyed myself.
It vaguely reminded me of the Culture series by Iain M. Banks. If you are looking for something to fill the Banks shaped hole in your life, maybe this would be a good thing to pick up.
It vaguely reminded me of the Culture series by Iain M. Banks. If you are looking for something to fill the Banks shaped hole in your life, maybe this would be a good thing to pick up.
June 21, 2016
[somewhere at the bottom of a well]
"Steve! Steve, wake up! Come on, Steve, we got work to do. Steve!"
"Senhor, is that you shouting? It's two in the morning. I was sleeping. Who died, where is burning?"
"Nonsense, Steve. It's two in the midnight. Come, we have work to do. We're back in business, I have a review to write and you're staring in it. I'll tell you the plan on the way, come, come."
"Senhor, you're an asshole."
"I know it, the Queen gave me a medal for it, that's why I'm a sir."
[next evening]
A May rabbit rabbit rabbit walks into a bar. The shocked bartender asks:
"My god, what happ-"
"Sim perguntas, Decim. The reviewer deludes himself he's a Shaper artist."
"Oh, come on, Steve. Just play your part. I should have left you on that Jalapeño pirate ship. Decim, come drink with us on the table. I've just read this book, Schismatrix Plus, got some notes from it and I want us to discuss it so I can make a review."
"I had read it too, a long time ago, don't remember much from it, save for the cockroach tequilas I still make from time to time."
"I'll have one of those, if I may. Senhor is paying."
"Alright, the general impression: this book is a basket full of goodies the writer took a piss on then ejected into space."
"Isn't this a bit harsh? I know it has an experimental structure, but it was meant as a cyberpunk experiment."
"This is no excuse for the characters he came up with. It felt like I was in a shady oriental open bazaar. Weird characters and entities popping up everywhere begging for your attention, promising you services you didn't even knew existed, behaving strangely (one was walking on his nose hairs instead of his feet) for in the end you discover you got pickpocketed, your trousers are on, but your underpants are gone."
"I never was a fan of cyberpunk, it feels so artificial. Fantasy feels real, I accept talking dragons, but ordinary people being familiar with basic principles of physics and chemistry? That's fake all day. They rather gargle water a beardy mad guy blessed to cure cancer, than actually seek medical care."
"Scientists say all particles vibrate. Does this mean vibrators are particle accelerators?"
"That's not how it works. The closest particle accelerator you're going to use is your microwave oven. You can make popcorn and fly in space with sublight speed in less than 2.5 minutes. I told you that crate of second-hand sex toys was a bad investment. Read this book, genetically engineered prostitutes are the future."
"Speaking of popcorn, I find it interesting how in these cyberpunk novels the human race is augmenting itself with drugs, hormones, prosthetics, jumps from one fashion to another, from an extreme to another, they are restless, eager to accede another state of mind, yet politically they behave the same for thousands of years."
"Maybe it's politics that defines humanity. Bad politics that is."
" The book itself it's lacking a direction, a certain plan, a fluent story, some characters to love and others to hate. I wish the main character wasn't so over sexualized, or maybe this is due to the drugs."
"What drugs, the ones mentioned as aphrodisiacs are good only to dye your eggs."
"Steve, don't dye your Easter eggs with aphrodisiacs, please. You also have vasopressin which is %$*@& and *@&_)#(. At some point I found
TCGAGGCTATCGTAGCTAAAGCTCTCCCGATCGATATCGTCTCGAGATCGATCGATGC-TTAGCTAGCTAGTTGTCGA TCGTAGGGCTCGAGCTA
And I was really excited to decode it hoping there was a secret message hidden in it. There isn't, but then it is too short to even mean something else than a string."
"So is your life."
"Decim, I thought you got rid of that annoying talking goat."
"It isn't a goat, it's an alien that calls himself the Swarm."
"Makes perfect sense. Then I'm left with all these ideas that floats into a void which is the story, ideas that revolves around the fact that we are a primitive society and will always be because it's in our design and the fact that the threat of death is bigger for the happy ones."
"Let's not forget about the obsession with bacteria, mold and microorganisms."
"Speaking about molds, I'd have another beer. And a cockroach tequila for Steve. In the end I just hope this book will serve as inspiration for writers such as Al Reynolds and expect nothing more from it in terms of a story. About the ideas I've noted, we'll talk when you get back with the drinks."
"Steve! Steve, wake up! Come on, Steve, we got work to do. Steve!"
"Senhor, is that you shouting? It's two in the morning. I was sleeping. Who died, where is burning?"
"Nonsense, Steve. It's two in the midnight. Come, we have work to do. We're back in business, I have a review to write and you're staring in it. I'll tell you the plan on the way, come, come."
"Senhor, you're an asshole."
"I know it, the Queen gave me a medal for it, that's why I'm a sir."
[next evening]
A May rabbit rabbit rabbit walks into a bar. The shocked bartender asks:
"My god, what happ-"
"Sim perguntas, Decim. The reviewer deludes himself he's a Shaper artist."
"Oh, come on, Steve. Just play your part. I should have left you on that Jalapeño pirate ship. Decim, come drink with us on the table. I've just read this book, Schismatrix Plus, got some notes from it and I want us to discuss it so I can make a review."
"I had read it too, a long time ago, don't remember much from it, save for the cockroach tequilas I still make from time to time."
"I'll have one of those, if I may. Senhor is paying."
"Alright, the general impression: this book is a basket full of goodies the writer took a piss on then ejected into space."
"Isn't this a bit harsh? I know it has an experimental structure, but it was meant as a cyberpunk experiment."
"This is no excuse for the characters he came up with. It felt like I was in a shady oriental open bazaar. Weird characters and entities popping up everywhere begging for your attention, promising you services you didn't even knew existed, behaving strangely (one was walking on his nose hairs instead of his feet) for in the end you discover you got pickpocketed, your trousers are on, but your underpants are gone."
"I never was a fan of cyberpunk, it feels so artificial. Fantasy feels real, I accept talking dragons, but ordinary people being familiar with basic principles of physics and chemistry? That's fake all day. They rather gargle water a beardy mad guy blessed to cure cancer, than actually seek medical care."
"Scientists say all particles vibrate. Does this mean vibrators are particle accelerators?"
"That's not how it works. The closest particle accelerator you're going to use is your microwave oven. You can make popcorn and fly in space with sublight speed in less than 2.5 minutes. I told you that crate of second-hand sex toys was a bad investment. Read this book, genetically engineered prostitutes are the future."
"Speaking of popcorn, I find it interesting how in these cyberpunk novels the human race is augmenting itself with drugs, hormones, prosthetics, jumps from one fashion to another, from an extreme to another, they are restless, eager to accede another state of mind, yet politically they behave the same for thousands of years."
"Maybe it's politics that defines humanity. Bad politics that is."
" The book itself it's lacking a direction, a certain plan, a fluent story, some characters to love and others to hate. I wish the main character wasn't so over sexualized, or maybe this is due to the drugs."
"What drugs, the ones mentioned as aphrodisiacs are good only to dye your eggs."
"Steve, don't dye your Easter eggs with aphrodisiacs, please. You also have vasopressin which is %$*@& and *@&_)#(. At some point I found
TCGAGGCTATCGTAGCTAAAGCTCTCCCGATCGATATCGTCTCGAGATCGATCGATGC-TTAGCTAGCTAGTTGTCGA TCGTAGGGCTCGAGCTA
And I was really excited to decode it hoping there was a secret message hidden in it. There isn't, but then it is too short to even mean something else than a string."
"So is your life."
"Decim, I thought you got rid of that annoying talking goat."
"It isn't a goat, it's an alien that calls himself the Swarm."
"Makes perfect sense. Then I'm left with all these ideas that floats into a void which is the story, ideas that revolves around the fact that we are a primitive society and will always be because it's in our design and the fact that the threat of death is bigger for the happy ones."
"Let's not forget about the obsession with bacteria, mold and microorganisms."
"Speaking about molds, I'd have another beer. And a cockroach tequila for Steve. In the end I just hope this book will serve as inspiration for writers such as Al Reynolds and expect nothing more from it in terms of a story. About the ideas I've noted, we'll talk when you get back with the drinks."
December 30, 2017
Humanity has moved out into the solar system... and schismed, with different factions employing different philosophies to endure and thrive in the harsh environment. The Shapers rely on genetically engineering themselves. Mechanists rely on cybernetic enhancement. They aren't the only factions out there, just the biggest, in the ongoing quest to determine humanity's destiny. Abelard Lindsay is an assassin, a diplomat, a con artist, a political exile, an entrepeneur, and someone who finds himself in plenty of crazy situations in his long life.
This book collects not only the novel Schismatrix, but also all five stories in the Shaper/Mechanist universe. I had only read one story in that universe, "Swarm," which I liked enough to instantly want the whole universe to read in one handy book.
Unfortunately, that presented bit of a disappointment problem, because, at least to my tastes, "Swarm" is far and away the best story in the book, and everything else really isn't even all that similar in style.
I still enjoyed the book, mind you, it's got enough of the cool ideas, eyeball-kicks full of wild concepts and environments and people that I love from science fiction, and you can see where other authors I've enjoyed got influenced by this book, which is enjoyable on a more fandom level. But it just didn't live up to what I was hoping it'd be.
One problem is that the novel jumps around an awful lot, most sections of the book are years or decades past a previous section and deal with whole new events, making the novel feel a bit like a series of short stories itself (leaving aside the actual short stories included at the end). Sure, they focus on the same cast but there wasn't a whole lot to hold on to. This reminded me of Charles Stross' much later book Accelerando, but it didn't work nearly as well for me, the characters weren't quite as relateable to start with, never mind what they turned into.
There were certainly moments of intense interest (particularly when the alien Investors started coming into the story, but that highlighted one of the disappointments, I was hoping more of the alien angle would work into things), but it was also, occasionally, a slog. And by the end of the book, I think I have officially gotten thoroughly and completely sick of the phrase "Prigoginic Levels of Complexity," a phrase I'm not sure I'd heard before it but now am pretty sure I never want to see again... not from the idea itself, but just from the overuse of the buzzword. That's not a good thing from a SF book which usually leaves me excited with the new ideas or terms it exposes me to. How it related to the ending of the novel also made it fall flat for me, it's just not the kind of SF conceit I'm that into, unless done very well.
It wasn't really a huge issue for me, because I'd been exposed to details about the factions long before I read the book, but I also feel the novel was lacking a decent 'mission statement' for who the different groups were and how they operated that might have helped people who went into this cold. I feel like reading it like that you'd just be thrown in with names of groups and told they were conflicting major powers without really knowing what philosophy binds them or how they developed (and I was also hoping to see more of that info myself).
If I just read the novel, I'd probably rank it as a high two star book, while acknowledging how important it was. With the short stories included, it brings it up somewhere in the low-mid three star range, though mostly for "Swarm" rather than the others (which to be fair, had their moments too).
This book collects not only the novel Schismatrix, but also all five stories in the Shaper/Mechanist universe. I had only read one story in that universe, "Swarm," which I liked enough to instantly want the whole universe to read in one handy book.
Unfortunately, that presented bit of a disappointment problem, because, at least to my tastes, "Swarm" is far and away the best story in the book, and everything else really isn't even all that similar in style.
I still enjoyed the book, mind you, it's got enough of the cool ideas, eyeball-kicks full of wild concepts and environments and people that I love from science fiction, and you can see where other authors I've enjoyed got influenced by this book, which is enjoyable on a more fandom level. But it just didn't live up to what I was hoping it'd be.
One problem is that the novel jumps around an awful lot, most sections of the book are years or decades past a previous section and deal with whole new events, making the novel feel a bit like a series of short stories itself (leaving aside the actual short stories included at the end). Sure, they focus on the same cast but there wasn't a whole lot to hold on to. This reminded me of Charles Stross' much later book Accelerando, but it didn't work nearly as well for me, the characters weren't quite as relateable to start with, never mind what they turned into.
There were certainly moments of intense interest (particularly when the alien Investors started coming into the story, but that highlighted one of the disappointments, I was hoping more of the alien angle would work into things), but it was also, occasionally, a slog. And by the end of the book, I think I have officially gotten thoroughly and completely sick of the phrase "Prigoginic Levels of Complexity," a phrase I'm not sure I'd heard before it but now am pretty sure I never want to see again... not from the idea itself, but just from the overuse of the buzzword. That's not a good thing from a SF book which usually leaves me excited with the new ideas or terms it exposes me to. How it related to the ending of the novel also made it fall flat for me, it's just not the kind of SF conceit I'm that into, unless done very well.
It wasn't really a huge issue for me, because I'd been exposed to details about the factions long before I read the book, but I also feel the novel was lacking a decent 'mission statement' for who the different groups were and how they operated that might have helped people who went into this cold. I feel like reading it like that you'd just be thrown in with names of groups and told they were conflicting major powers without really knowing what philosophy binds them or how they developed (and I was also hoping to see more of that info myself).
If I just read the novel, I'd probably rank it as a high two star book, while acknowledging how important it was. With the short stories included, it brings it up somewhere in the low-mid three star range, though mostly for "Swarm" rather than the others (which to be fair, had their moments too).
January 22, 2015
SCHISMATRIX PLUS is one of Bruce Sterling's early novels, long unavailable, and now back in print as an ebook. (The "Plus" indicates that the book also includes a bunch of short stories set in the same future world as the novel itself). This novel has much more of a far-future setting than the bulk of Sterling's subsequent work. It follows the adventures of the main character, Abelard Lindsay (though at times he uses many other names) from being a 20-something rebel to being the 200 years old or so (due to life extension technologies) guru of his own particular faction of posthumans. The novel explores the posthuman condition -- or better, a multitude of posthuman conditions, as advancing technology leads human beings into many different possible reconfigurations, many of which do not sit well with one another. In the course of the book, there is a kind of speciation of multiple, and incompatible, posthuman variants. The main social development in the solar system of the novel -- filled with inhabited moons, planetoids, asteroids, and artificial habitats -- is the split between Shapers (who retool the human genome for increased healthy, intelligence, and agility) and Mechanists (who retool their bodies with all sorts of mechanical and computational augmentations). But in the course of the book, this basic duality or antagonism seems less and less important, as multiple new forms of posthumanity get constructed. By the end of the novel, we are looking at radical genetic reconstruction to allow posthumans to live, breathe, eat, and reproduce in the oceans beneath the crust of Europa (the Jovian moon). What gives the book its power and tension is the harsh conflict between a sense of wonder at the majestic technological reinventions of humanity on the one hand, and a depressing view of ugly power politics which seem to be replayed endlessly regardless of technological means. At one point, the narrator notes, of the expansion of human beings into other parts of the solar system: "It was a complex and depressing history, littered with betrayals, small-scale rivalries, and pointless power games." In Sterling's vision, however much we change ourselves, we never really get away from this sort of recurring and stupid conflict. But Sterling also suggests that it may well be this sort of "depressing history" that spurs potentially liberatory inventions. Throughout the novel, Abelard Lindsay is never contented. He is perpetually restless, or even perpetually in a rage, over the limitations of society and indeed of embodied experience. And so he continually moves from one sort of technological and social living arrangement to another -- the continual process of discovery and innovation itself seems to be the point for him, rather than its necessarily limited results. I am inclined to think that this is all too accurate a portrayal of how desire and innovation work under capitalism -- though the aesthete in me insists that another world is possible. Sterling doesn't himself envision such another world, but his novel convincingly shows that no degree of technological self-transformation can in and of itself change the gloomy parameters of this one.
March 29, 2016
The huge issue with this book is the fact that the story is told as if the reader is present and infinitely familiar with the social, political, and technological developments in the Shapers/Mechanists universe. Sterling occasionally has a a moment where another character talks about what's going on on the various planets (like when Ryumin or Greta Beatty gives him a quick tour of their world), and those parts read smoother than the rest of the novel. In sci-fi and fantasy, world-building is incredibly important; the author can't assume we understand his/her world like he/she does. Especially when the main character is basically a con-man of sorts for most of the novel.
The second major issue was characterization. I didn't understand why Lindsay and Constantine were fighting over Vera in the first place. How did they get together? Why was Vera so fascinating to both men? There were a bunch of words talking about Lindsay's stint at Shaper Summer Camp for Diplomatic Leaders (TM) but no exposition as to why they "rebelled" or what they "rebelled" against. Okay, I do concede one thing--Lindsay was quite a condescending bougie asshole when they were younger. I'd have tried to kill him too.
I was quite irritated with the Geisha Bank as a concept. It seemed exoticizing and weird--why is it that Japan (and now Korea, I guess) are always the only Asian countries with any influence in future worlds? Looking population size and their long lasting histories, it'd be India or China that would exert the major influence of the area. I also hate it when Western writers use Geisha as concepts because they always end up as whores, which isn't really how they're seen in Japanese society.
The short stories, on the whole, did a better job of world-building and exposition than Schismatrix itself. The extra star goes for those. In fact, Swarm is probably the single gem in the entire book, worth a good 4-5 stars on its own, but because the majority of the book is terrible, I almost didn't even get to that part.
The second major issue was characterization. I didn't understand why Lindsay and Constantine were fighting over Vera in the first place. How did they get together? Why was Vera so fascinating to both men? There were a bunch of words talking about Lindsay's stint at Shaper Summer Camp for Diplomatic Leaders (TM) but no exposition as to why they "rebelled" or what they "rebelled" against. Okay, I do concede one thing--Lindsay was quite a condescending bougie asshole when they were younger. I'd have tried to kill him too.
I was quite irritated with the Geisha Bank as a concept. It seemed exoticizing and weird--why is it that Japan (and now Korea, I guess) are always the only Asian countries with any influence in future worlds? Looking population size and their long lasting histories, it'd be India or China that would exert the major influence of the area. I also hate it when Western writers use Geisha as concepts because they always end up as whores, which isn't really how they're seen in Japanese society.
The short stories, on the whole, did a better job of world-building and exposition than Schismatrix itself. The extra star goes for those. In fact, Swarm is probably the single gem in the entire book, worth a good 4-5 stars on its own, but because the majority of the book is terrible, I almost didn't even get to that part.
August 4, 2008
This was the science fiction odyssey that I've been longing to read all summer. I'm glad that I finally found one that captivated me from start to finish as I was starting to think I might be burnt out on the genre- a frightening thought.
Sterling's book collects a number of stories all set within his Shaper-Mechanist universe, with his first novel Schismatrix forming the backbone of the story. Following humankind's ascent into the stars, Sterling creates two competing directions for our evolutionary path. The first is that of the Shapers, a segment of humanity using genetic modifications to make themselves smarter, faster and more capable of facing the challenges of space. Opposed to the Shapers are the Mechanists who, as their name implies, are relying upon machines to lengthen their lives and repair the frail human form.
More than just blandly stating his take on the important "where is humanity going?" question inherent in most good scifi, this stands out as a series with fleshed out and realistic characters. The only other book that I can think of where he accomplished this is the fantastic Distraction.
I have to admit that this is one of very few Sterling novels that I've enjoyed with no hesitation. It had everything cyberpunk is supposed to have and I can finally see why he is viewed as a godfather of this genre. At his best, as he is here, he is a visionary writer who crafts worlds that feel feasible as though he is looking down a quantum portal at the possibilities of humankind. I have another collection of his works here and I'm sorely tempted to keep the Sterling binge going.
Sterling's book collects a number of stories all set within his Shaper-Mechanist universe, with his first novel Schismatrix forming the backbone of the story. Following humankind's ascent into the stars, Sterling creates two competing directions for our evolutionary path. The first is that of the Shapers, a segment of humanity using genetic modifications to make themselves smarter, faster and more capable of facing the challenges of space. Opposed to the Shapers are the Mechanists who, as their name implies, are relying upon machines to lengthen their lives and repair the frail human form.
More than just blandly stating his take on the important "where is humanity going?" question inherent in most good scifi, this stands out as a series with fleshed out and realistic characters. The only other book that I can think of where he accomplished this is the fantastic Distraction.
I have to admit that this is one of very few Sterling novels that I've enjoyed with no hesitation. It had everything cyberpunk is supposed to have and I can finally see why he is viewed as a godfather of this genre. At his best, as he is here, he is a visionary writer who crafts worlds that feel feasible as though he is looking down a quantum portal at the possibilities of humankind. I have another collection of his works here and I'm sorely tempted to keep the Sterling binge going.
October 17, 2012
I picked up this book based solely on Alastair Reynolds insane props:
"I owe an equally obvious debt to Bruce Sterling, whose 'Shaper/Mechanist' sequence blew my mind on several levels. Sterling's future history, even though it consists of only a single novel and a handful of stories, still feels utterly plausible to me twenty years after I first encountered it. Part of me wishes Sterling would write more 'Shaper/Mechanist' stories; another part of me admires him precisely for not doing so. Read Schismatrix if you haven't already done so: it will melt your face."
That is exactly what it did too, melt my face. I still remember when I finished it, I honestly sat there for 30 minutes utterly stunned by what I had just read. This isn't typical cyberpunk either, but it was written a year after Nueromancer and was also one of the books that has heavily influenced and defined what cyberpunk has become. Schismatrix Plus is everything ever written about the 'Shaper/Mechanist' Universe. It includes every short story as well as the full length novel Schismatrix, what's more is that it is all arranged in the way the Sterling intended it to be read. It is difficult, abstract, and intense beyond anything I could have imagined, but when you finish, you will utterly agree with Reynolds description.
More reviews and recommendations at http://ryetopia.blogspot.com
"I owe an equally obvious debt to Bruce Sterling, whose 'Shaper/Mechanist' sequence blew my mind on several levels. Sterling's future history, even though it consists of only a single novel and a handful of stories, still feels utterly plausible to me twenty years after I first encountered it. Part of me wishes Sterling would write more 'Shaper/Mechanist' stories; another part of me admires him precisely for not doing so. Read Schismatrix if you haven't already done so: it will melt your face."
That is exactly what it did too, melt my face. I still remember when I finished it, I honestly sat there for 30 minutes utterly stunned by what I had just read. This isn't typical cyberpunk either, but it was written a year after Nueromancer and was also one of the books that has heavily influenced and defined what cyberpunk has become. Schismatrix Plus is everything ever written about the 'Shaper/Mechanist' Universe. It includes every short story as well as the full length novel Schismatrix, what's more is that it is all arranged in the way the Sterling intended it to be read. It is difficult, abstract, and intense beyond anything I could have imagined, but when you finish, you will utterly agree with Reynolds description.
More reviews and recommendations at http://ryetopia.blogspot.com
September 22, 2018
Skvělá věc, jak román, tak zejména povídky ze světa Schismatrixu. Je to vlastně příběh o konci lidstva, o jeho přeměnách, o mnoha cestách, kterými se vydává. Zažijete časy válečné i mírové, revoluce jak politické, tak technologické, mezihvězdné cesty, kontakty s mimozemšťany, smrt i nesmrtelnost...
Moc se mi to líbilo.
Dvě věci mě mrzí: je velká škoda, že toho ze světa Schismatrixu pan Sterling nenapsal víc a také to, že jsem tuhle knížku neotevřel dřív.
Moc se mi to líbilo.
Dvě věci mě mrzí: je velká škoda, že toho ze světa Schismatrixu pan Sterling nenapsal víc a také to, že jsem tuhle knížku neotevřel dřív.
May 19, 2018
Essential reading. Fucking unbelievable.
Even more useful in the Age of Trump, considering the adjustments you have to do every day. The parallels are that far afield, and little else will thusly stretch your mind.
You'll be better off.
(Buy it, and share with friends! This is banding together; this is sharing resources.)
Even more useful in the Age of Trump, considering the adjustments you have to do every day. The parallels are that far afield, and little else will thusly stretch your mind.
You'll be better off.
(Buy it, and share with friends! This is banding together; this is sharing resources.)
April 4, 2015
This is a most difficult read. If you're considering reading this book, be forewarned - information overload is the name of the game. This is not confusing in a modernist stream-of-consciousnessness Joycean sort of way; it's just confusing in that the information and exposition are delivered so quickly, in so few words, you may have to reread several paragraphs numerous times before the facts finally "click."
But when they do, and you suddenly understand, your brain will glow with new knowledge, your eyes will widen, your heartbeat will quicken, and you will be pulled along rapturously into one seriously bizarre and unforgettable epic. This is science fiction of the most ambitious and wide-ranging kind, with constructions of future humanity taken as far as imagination could take them without crossing the line into all-out fantasy. It has politics, psychology, drama, tragedy, backstabbing, adventure, economics, space travel, science, science gone haywire, a plot as complex and gripping as all hell, and characters as strange as they are believable. Sometimes, the stranger they get, the more believable they get.
Again, this is hard stuff. It needs to be read slowly, in chunks, and those chunks often reread slowly. But the investment is absolutely worth it. This is a towering narrative of the future, a marvellous romance in the old definition of the term, and a very strange ride. Enjoy.
But when they do, and you suddenly understand, your brain will glow with new knowledge, your eyes will widen, your heartbeat will quicken, and you will be pulled along rapturously into one seriously bizarre and unforgettable epic. This is science fiction of the most ambitious and wide-ranging kind, with constructions of future humanity taken as far as imagination could take them without crossing the line into all-out fantasy. It has politics, psychology, drama, tragedy, backstabbing, adventure, economics, space travel, science, science gone haywire, a plot as complex and gripping as all hell, and characters as strange as they are believable. Sometimes, the stranger they get, the more believable they get.
Again, this is hard stuff. It needs to be read slowly, in chunks, and those chunks often reread slowly. But the investment is absolutely worth it. This is a towering narrative of the future, a marvellous romance in the old definition of the term, and a very strange ride. Enjoy.
December 27, 2009
SHORT VERSION: (not a real review)
• 1st: "Swarm" — reeeeeally liked; I can see why it's so popular and well known — reminds me of Blindsight — except that Blindsight was probably in-part inspired by this...?
• 2nd: "Spider Rose" — reminds me of that PKD story "Beyond Lies the Wub"
• aspects of the main novel (Schismatrix) cued in my mind visions of: "this is Neuromancer on extraversion" (but mostly I think that b/c they're contemporaries?); also cued: "smatterings of this show up in Accelerando " (but maybe they're just sharing tropes and/or formats? arcs?)
• I think I need a re-read to unpack it and put it all back together
--
A note about this edition: it's an omnibus—and as such it contains Sterling's novel (Schismatrix) plus all the short stories in the Shaper/Mechanist milieu.
• 1st: "Swarm" — reeeeeally liked; I can see why it's so popular and well known — reminds me of Blindsight — except that Blindsight was probably in-part inspired by this...?
• 2nd: "Spider Rose" — reminds me of that PKD story "Beyond Lies the Wub"
• aspects of the main novel (Schismatrix) cued in my mind visions of: "this is Neuromancer on extraversion" (but mostly I think that b/c they're contemporaries?); also cued: "smatterings of this show up in Accelerando " (but maybe they're just sharing tropes and/or formats? arcs?)
• I think I need a re-read to unpack it and put it all back together
--
A note about this edition: it's an omnibus—and as such it contains Sterling's novel (Schismatrix) plus all the short stories in the Shaper/Mechanist milieu.
October 5, 2007
The cyberpunk movement is one I will never be able to get into. It is creative, but one of the characteristics of this book is that the author writes as if the story is happening in our present world, so he does not define words and key elements just as an author writing in the present wouldn't define terms they assume are collective knowledge. It bored me.
June 20, 2013
Quite remarkable. One of the best solar system colonization universes with a baroque and cyberpunk-inflected computer/biology split.
October 9, 2014
J'avais lu ce livre il y a déja quelques années, et en avait étéé positivement émerveillé. Car après la déferlante du cyberpunk, Sterling nous revenait avec une oeuvre aux dimensions épiques, embrasssant dans sa fresque futuriste de très nombreuses visions de l'humanité et une rencontre avec les extra-terrestres.
J'ai cette fois-ci été un peu plus touché par le côté humain du personnage principal (auquel on ne peut décement pas donner le titre de héros, puisqu'il passe l'essentiel du roman à fuir : sa femme, ses anciens amis, ses responsabilités, l'humanité). Toutefois, à cause d'une éducation étrangement écartelée, sa fuite n'est pas réellement éperdue, mais massquée la plupart du temps derrière des motifzs nobles. Et ce sont ces motifs qui vont nous permettre de visiter les endroits les plus interlopes que cette humanité spatiale a conquis : des stations spatiales quasiment abandonnées, des centres diplomatiques et commerciaux de contact avec les extra-terrestres, et enfin le centre de terraformation de Mars.
Et à chaque fois, comme lors de la première lecture, j'ai été ébahi devant le sens de la mise en scène dont sait faire preuve l'auteur pour nous rendre des décors tour à tour inquiétants, merveilleux, totallement invivables, ou tout simplement dangereux.
Un autre point intéressant dans ce roman, c'est la philosophie évoquée par ce personnage. Car même si les objectifs qu'il défend évoluent (mais quels objectifs n'évolueraient pas au cours dde périodes de vies de plusieurs siècles - en passant, c'est un point commun avec Les menhirs de glace, qui montre néanmoins plus en détail les limites de la mémoire - qui sont néanmoins évoqués ici avec ce que j'appelerais de la finesse, à défaut d'un terme plus approprié), il garde tout au long de sa vie une confiance claire en les capacités d'une bonne négociation à éviter tous les conflits, confiance qui sera régulièrement trahie par d'autres humains qui ont moins foi que lui en les capacités de la diplomatie. Peut-être que, dans ce cas, l'un des postulats de Sterling a été de donner corps à la phrase célèbre qui dit que la guerre est la continuation de la diplomatie par d'autres moyens, mais j'en doute.
Je parlais du côté humain du livre en préambule, mais je m'aperçois que je ne parle que du personnage principal. Or tous sont traités avec la même finesse, qui leur permet d'exisster avec une réelle force. C'est ainsi le cas des différents personnages secondaires, mais aussi de l'humanité dans son ensemble, qui garde dans l'espace toutes ses bassesses, comme les luttes d'influence, mais aussi toutes ses grandeurs, comme la capacité à créer et à imaginer toujours un monde meilleur.
Tout ça fait de ce rtoman une oeuvre incroyablement clairvoyante, je trouve, même si elle présente certains défaults, comme par exemple un certain manque d'unité.
Peut-être que ce manque d'unité est dû à nos limites d'humains actuels, incapables d'embrasser des espérances de vies se comptant en siècles, mais je crois plutôt que c'est la variété des lieux dans lesquels l'auteur promène son personnage principal qui m'a donné cette impression.
Notez bien qu'il s'agit d'un défaut minime, rendu encore plus mineur d'ailleurs par les nouvelles suivant le roman, qui ouvrent de nouveaux aperçus sur l'univers autour du héros, même s'il s'agit plutôt de l'univers à la fin du roman, avec une planète Mars quasiment colonisée.
Enfin, dans tous les cas j'ai beaucoup aimé cette oeuvre qui, en mon sens, apporte beaucoup de fraîcheur au space-opera en en étant un, par le décor, sans en être un, par le manque d'action, rempalcé ici par une vue beaucoup plus contemplative de ce décor, au demeurant magnifique.
Ci-dessous, une discussion de fr.rec.arts.sf ayant eu lieu lors de ma première lecture
Trick a écrit d'une plume inspirée
> En bref : c'est zarb mais en définitive ça vaut vraiment la peine.
>
Ah, damned, je suis eu ! Je l'ai également lu la semainde dernière (dans son édition Folio Sf augmentée de quelques nouvelles tout à fait fabuleuses et par conséquent habilement nommé "Schismatrice +") et j'avais également l'intention d'en poster mon avis. Et malheureusement, je fus précédé, et de peu, pour mon malheur. Bref, à mon tour d'en rajouter dans le spoiler honteux, la réflexion pitoyable et l'humour de bas étage...
On retrouve là quelque chose de très connu : la révolte des nouveaux contre les anciens, lorsque ceux-ci se révèlent sclérosés et incapables d'agir d'une manière ambitieuse (ce qui peut également sembler un miroir assez intéressant de la société actuelle).
>
> Abélard Lindsay aurait du disparaître avec sa belle mais le hasard
> l'épargne. Devenu trop dangeureux pour son clan, il est banni vers un
> habitat désolé où commencera une vie nouvelle en compagnie des
> marginaux de la Schismatrice, ce vaste ensemble de mondes
> indépendants, rivaux et bouillonnants, cette machine à fragmenter
> l'humanité.
>
Je ne suis pas tout à fait d'accord avec ton interprétation : "le hasard l'épargne". Ne s'agit-il pas plutôt pour lui de survivre, quel qu'en soit le déshonneur ? Pour le jeune révolutionnaire qu'il est alors, la mort est la seule transgression possible, dans un univers asseptisé où tout est contrôlé par les familles régnantes. Et cette transgression, qu'il choisit selon moi de ne pas effectuer, le pourcharssera toute sa vie, que ce soit sous al forme des assassins envoyés par Constantin, mais surtout par sa propre image : il sait qu'il aurait dû mourir avec Véra, mais que le fait de ne pas l'avoir fait lui permet de plonger dans la vie de la Schismatrice.
>
> Ce n'est pas un roman facile d'accès. D'abord à cause d'un style de la
> même veine que celui de Gibson, c'est-à-dire fourmillant de
> néologismes et très fracturé. Sterling élude des passages entiers si
> bien qu'on a parfois l'impression de disposer d'une édition incomplète
> ou tronquée du bouquin. Le sujet n'est pas non plus très clair et les
> vingts premières pages suggèrent plus une sorte de space-opera
> carabiné à la Vance, avec des héros insurpassables et indestructibles,
> que la fresque sociale et technique qu'est véritablement _La
> Schismatrice_.
Si le style de ce roman est effectivement très élusif, c'est par nécessité selon moi : lorsqu'on est plongé dans une humanité dispersée dans tout le système solaire, et que les voyages durent des mois entiers, il n'est peut-être pas nécessaire de les mentionner. Mais ce n'est qu'un des nombreux points éludés. En fait, il me semble que le bon angle de lecture est de voir Abéliard Lindsay comme un catalyseur : lorsqu'il crée sa compagnie de théatre dans l'habitat des apaches, son habitat originel est déserté. Lorsque les Investisseurs arrivent, il est propuslé sur le devant de la scène et rejoint ainsi Wells, avec lequel ils vont lancer le projet de terraformation du satellite de Jupiter (dont évidement j'ai oublié le nom).
>
> Car au-delà des aventures rocambolesques du sieur Lindsay, on découvre
> une société ou plutôt une myriade de sociétés nées des conditions
> extrèmement hostiles et changeantes de la vie en plein espace. Des
> sociétés divisées par les luttes incessantes entre mécanistes et
> formationnistes, ces derniers étant adeptes de manipulations
> génétiques dans un optique clairement eugéniste, et de techniques de
> conditionnement. Ce petit monde dynamique et en perpétuelle mutation
> n'est pas sans rappeler celui de _Dune_ par sa complexité, ses
> intrigues et sa façon d'être constamment sur le point de se briser.
Là, je ne suis franchement pas d'accord. Là où Dune est un essai politique franchement inspiré par le Prince de Machiavel, la Schismatrice se rapproche plus pour moi d'un traité d'évolution des sociétés, ou plutôt des clades. La notion de niveau de complexité de Prigogine (dont j'ignore évidement si c'est une fumisterie ou une idée avérée) par exemple, représente bien le champ d'intérêt de Sterling : il s'agit plus d'expérimenter sur les micro-sociétés qui peuvent émerger plus facilement dans l'espace que de fouiller en profondeur les structures du pouvoir. Enfin, j'ai pour ma part un reproche conceptuel à faire : les deux opposants, morphos et mécas, ne représentent pour moi que les deux faces d'une même pièce. Ils ont tous voué leur vie au progrès scientifique, quitte à se laisser dévorer par ce progrès, et à ne plus avoir d'humain que le nom (comme par exemple les Homards). Cependant, on ne voit nulle part de conservateurs ou, comme j'aurais tendance à les appeler, de néo-obscurantistes, déclarant que toute cette technologie est sale, que l'âme des morphos n'existe pas et que celles des mécas est indubitablement corrompue par ce mélange avec la machine maudite. Bien sûr, les terriens sont ainsi, plongés dans la stase, mais il aurait été amusant de voir, dans l'espace, des partisants d'un retour à des technologies externes.
>
> Si vous arrivez à vous faire au style un peu étrange de Sterling, et à
> passer outre certains aspects kitschs ou réducteurs de cet immense
> tableau, voici un roman surprenant de vitalité et d'originalité.
Tout à fait. je rajouterai également qu'il donne un aperçu moderne de la vie telle qu'elle pourrait apparaître pour un individu capable de vivre plus de trois cent ans, dépassé par un progrès qui va en s'accélérant, et cherchant de nouvelles sources d'émerveillement.
Ah, oui, au fait, ne loupez pas non plus les nouvelles incluses dans "la Schismatrice +", elles fournissent un éclairage plus percutant - à la manière d'un court-métrage flashant l'individu - sur la complexité de la schismatrice, cette humanité de nom.
J'ai cette fois-ci été un peu plus touché par le côté humain du personnage principal (auquel on ne peut décement pas donner le titre de héros, puisqu'il passe l'essentiel du roman à fuir : sa femme, ses anciens amis, ses responsabilités, l'humanité). Toutefois, à cause d'une éducation étrangement écartelée, sa fuite n'est pas réellement éperdue, mais massquée la plupart du temps derrière des motifzs nobles. Et ce sont ces motifs qui vont nous permettre de visiter les endroits les plus interlopes que cette humanité spatiale a conquis : des stations spatiales quasiment abandonnées, des centres diplomatiques et commerciaux de contact avec les extra-terrestres, et enfin le centre de terraformation de Mars.
Et à chaque fois, comme lors de la première lecture, j'ai été ébahi devant le sens de la mise en scène dont sait faire preuve l'auteur pour nous rendre des décors tour à tour inquiétants, merveilleux, totallement invivables, ou tout simplement dangereux.
Un autre point intéressant dans ce roman, c'est la philosophie évoquée par ce personnage. Car même si les objectifs qu'il défend évoluent (mais quels objectifs n'évolueraient pas au cours dde périodes de vies de plusieurs siècles - en passant, c'est un point commun avec Les menhirs de glace, qui montre néanmoins plus en détail les limites de la mémoire - qui sont néanmoins évoqués ici avec ce que j'appelerais de la finesse, à défaut d'un terme plus approprié), il garde tout au long de sa vie une confiance claire en les capacités d'une bonne négociation à éviter tous les conflits, confiance qui sera régulièrement trahie par d'autres humains qui ont moins foi que lui en les capacités de la diplomatie. Peut-être que, dans ce cas, l'un des postulats de Sterling a été de donner corps à la phrase célèbre qui dit que la guerre est la continuation de la diplomatie par d'autres moyens, mais j'en doute.
Je parlais du côté humain du livre en préambule, mais je m'aperçois que je ne parle que du personnage principal. Or tous sont traités avec la même finesse, qui leur permet d'exisster avec une réelle force. C'est ainsi le cas des différents personnages secondaires, mais aussi de l'humanité dans son ensemble, qui garde dans l'espace toutes ses bassesses, comme les luttes d'influence, mais aussi toutes ses grandeurs, comme la capacité à créer et à imaginer toujours un monde meilleur.
Tout ça fait de ce rtoman une oeuvre incroyablement clairvoyante, je trouve, même si elle présente certains défaults, comme par exemple un certain manque d'unité.
Peut-être que ce manque d'unité est dû à nos limites d'humains actuels, incapables d'embrasser des espérances de vies se comptant en siècles, mais je crois plutôt que c'est la variété des lieux dans lesquels l'auteur promène son personnage principal qui m'a donné cette impression.
Notez bien qu'il s'agit d'un défaut minime, rendu encore plus mineur d'ailleurs par les nouvelles suivant le roman, qui ouvrent de nouveaux aperçus sur l'univers autour du héros, même s'il s'agit plutôt de l'univers à la fin du roman, avec une planète Mars quasiment colonisée.
Enfin, dans tous les cas j'ai beaucoup aimé cette oeuvre qui, en mon sens, apporte beaucoup de fraîcheur au space-opera en en étant un, par le décor, sans en être un, par le manque d'action, rempalcé ici par une vue beaucoup plus contemplative de ce décor, au demeurant magnifique.
Ci-dessous, une discussion de fr.rec.arts.sf ayant eu lieu lors de ma première lecture
Trick a écrit d'une plume inspirée
> En bref : c'est zarb mais en définitive ça vaut vraiment la peine.
>
Ah, damned, je suis eu ! Je l'ai également lu la semainde dernière (dans son édition Folio Sf augmentée de quelques nouvelles tout à fait fabuleuses et par conséquent habilement nommé "Schismatrice +") et j'avais également l'intention d'en poster mon avis. Et malheureusement, je fus précédé, et de peu, pour mon malheur. Bref, à mon tour d'en rajouter dans le spoiler honteux, la réflexion pitoyable et l'humour de bas étage...
On retrouve là quelque chose de très connu : la révolte des nouveaux contre les anciens, lorsque ceux-ci se révèlent sclérosés et incapables d'agir d'une manière ambitieuse (ce qui peut également sembler un miroir assez intéressant de la société actuelle).
>
> Abélard Lindsay aurait du disparaître avec sa belle mais le hasard
> l'épargne. Devenu trop dangeureux pour son clan, il est banni vers un
> habitat désolé où commencera une vie nouvelle en compagnie des
> marginaux de la Schismatrice, ce vaste ensemble de mondes
> indépendants, rivaux et bouillonnants, cette machine à fragmenter
> l'humanité.
>
Je ne suis pas tout à fait d'accord avec ton interprétation : "le hasard l'épargne". Ne s'agit-il pas plutôt pour lui de survivre, quel qu'en soit le déshonneur ? Pour le jeune révolutionnaire qu'il est alors, la mort est la seule transgression possible, dans un univers asseptisé où tout est contrôlé par les familles régnantes. Et cette transgression, qu'il choisit selon moi de ne pas effectuer, le pourcharssera toute sa vie, que ce soit sous al forme des assassins envoyés par Constantin, mais surtout par sa propre image : il sait qu'il aurait dû mourir avec Véra, mais que le fait de ne pas l'avoir fait lui permet de plonger dans la vie de la Schismatrice.
>
> Ce n'est pas un roman facile d'accès. D'abord à cause d'un style de la
> même veine que celui de Gibson, c'est-à-dire fourmillant de
> néologismes et très fracturé. Sterling élude des passages entiers si
> bien qu'on a parfois l'impression de disposer d'une édition incomplète
> ou tronquée du bouquin. Le sujet n'est pas non plus très clair et les
> vingts premières pages suggèrent plus une sorte de space-opera
> carabiné à la Vance, avec des héros insurpassables et indestructibles,
> que la fresque sociale et technique qu'est véritablement _La
> Schismatrice_.
Si le style de ce roman est effectivement très élusif, c'est par nécessité selon moi : lorsqu'on est plongé dans une humanité dispersée dans tout le système solaire, et que les voyages durent des mois entiers, il n'est peut-être pas nécessaire de les mentionner. Mais ce n'est qu'un des nombreux points éludés. En fait, il me semble que le bon angle de lecture est de voir Abéliard Lindsay comme un catalyseur : lorsqu'il crée sa compagnie de théatre dans l'habitat des apaches, son habitat originel est déserté. Lorsque les Investisseurs arrivent, il est propuslé sur le devant de la scène et rejoint ainsi Wells, avec lequel ils vont lancer le projet de terraformation du satellite de Jupiter (dont évidement j'ai oublié le nom).
>
> Car au-delà des aventures rocambolesques du sieur Lindsay, on découvre
> une société ou plutôt une myriade de sociétés nées des conditions
> extrèmement hostiles et changeantes de la vie en plein espace. Des
> sociétés divisées par les luttes incessantes entre mécanistes et
> formationnistes, ces derniers étant adeptes de manipulations
> génétiques dans un optique clairement eugéniste, et de techniques de
> conditionnement. Ce petit monde dynamique et en perpétuelle mutation
> n'est pas sans rappeler celui de _Dune_ par sa complexité, ses
> intrigues et sa façon d'être constamment sur le point de se briser.
Là, je ne suis franchement pas d'accord. Là où Dune est un essai politique franchement inspiré par le Prince de Machiavel, la Schismatrice se rapproche plus pour moi d'un traité d'évolution des sociétés, ou plutôt des clades. La notion de niveau de complexité de Prigogine (dont j'ignore évidement si c'est une fumisterie ou une idée avérée) par exemple, représente bien le champ d'intérêt de Sterling : il s'agit plus d'expérimenter sur les micro-sociétés qui peuvent émerger plus facilement dans l'espace que de fouiller en profondeur les structures du pouvoir. Enfin, j'ai pour ma part un reproche conceptuel à faire : les deux opposants, morphos et mécas, ne représentent pour moi que les deux faces d'une même pièce. Ils ont tous voué leur vie au progrès scientifique, quitte à se laisser dévorer par ce progrès, et à ne plus avoir d'humain que le nom (comme par exemple les Homards). Cependant, on ne voit nulle part de conservateurs ou, comme j'aurais tendance à les appeler, de néo-obscurantistes, déclarant que toute cette technologie est sale, que l'âme des morphos n'existe pas et que celles des mécas est indubitablement corrompue par ce mélange avec la machine maudite. Bien sûr, les terriens sont ainsi, plongés dans la stase, mais il aurait été amusant de voir, dans l'espace, des partisants d'un retour à des technologies externes.
>
> Si vous arrivez à vous faire au style un peu étrange de Sterling, et à
> passer outre certains aspects kitschs ou réducteurs de cet immense
> tableau, voici un roman surprenant de vitalité et d'originalité.
Tout à fait. je rajouterai également qu'il donne un aperçu moderne de la vie telle qu'elle pourrait apparaître pour un individu capable de vivre plus de trois cent ans, dépassé par un progrès qui va en s'accélérant, et cherchant de nouvelles sources d'émerveillement.
Ah, oui, au fait, ne loupez pas non plus les nouvelles incluses dans "la Schismatrice +", elles fournissent un éclairage plus percutant - à la manière d'un court-métrage flashant l'individu - sur la complexité de la schismatrice, cette humanité de nom.
May 4, 2015
This book includes not just Schismatrix, but also a handful of short stories set in the same universe.
Schismatrix itself I'm going to review separately, because there's so much to talk about, so in this review I will focus on the short stories and what they add to the experience of reading Schismatrix.
There are five stories: "Swarm," "Spider Rose," "Cicada Queen," "Sunken Gardens" and "Twenty Evocations."
Swarm - a suspenseful tale in the classic tradition of "hunter becomes prey" stories; it follows two Shaper scientists, Simon Afriel and Galina Mirny, as they engage in some very dangerous field research. They are studying one of the nineteen other space-faring races besides humankind and its new trading partners, the Investors. The beings they are studying -- by means no less drastic than going to live in one of their colonies for two years -- are essentially gigantic social insects called the Swarm. Like ants or termites, the Swarm lives in a vast complex of underground tunnels that they have dug for themselves. Also like ants, they have many different castes, with body types specialized for each caste's function. There are large, imposing warriors with huge mandibles; there's a vast Queen who lays eggs endlessly and is the mother of every individual in the colony; there are legions of small, bustling workers; there are a few "sensors" whose function is to monitor air quality in the colony to make sure it stays livable -- they are little more than eyes, brain, antennae and lungs, and have to be carried by workers; and there are tunnelers, huge living bulldozers with spadelike legs and jaws adapted for crunching rocks. There are also an astonishing array of "symbiotes" -- creatures that are not of the Swarm, that had clearly once been something else, but which, through long cohabitation, have been absorbed into it.
None of these critters possesses anything like human intelligence or sentience; in an exchange that effectively sets the mood for the whole story, Simon Afriel tells an ensign on the Investor ship that carries him to the Swarm colony that this alone makes them worth studying. How does a species without higher consciousness take to the stars?
The Investor, characteristically of his species, cannot understand why Afriel is so anxious to know this. He tells Afriel that humans place too much value on mere information, information that cannot possibly profit them. Afriel tells the Investor that humans are a young species, only children to the ancient and long-lived Investors, so the Investor should not be surprised to see a childlike curiosity from them.
I don't want to reveal too much about what happens in this story, because it's such an incredible twist, but let's just say that this Investor ensign -- and also Mirny, who has been with the colony longer than Afriel has and who shows him the ropes when he arrives -- serve very poignantly as voices of reason, trying in vain to sway Afriel from his hubris. The ensign's words, especially, give you insight into how the Investors have lasted for so long as a species, and hints that perhaps their laziness and incuriosity are survival traits rather than vices.
Spider Rose - This is a very sad story. It's also the only one told from the perspective of a Mechanist rather than a Shaper (although there is one character who is both, but he begins as a Shaper so I'm not sure he counts). The protagonist, Lydia Martinez, has been widowed for thirty years (her husband, a wealthy businessman who traded with the Investors, had been murdered by Shaper assassins) and has taken to calling herself Spider Rose. Where the "Rose" comes from I don't know, but the "Spider" serves as a neat symbol of her approach to ensuring her own survival; she's a Mechanist, and an old one, so her body has been extensively modified with cybernetics. The surveillance system of her spaceship feeds seamlessly into her brain; its cameras are her eyes just as much as the ones in her head; and the vast nets she uses to fish for salvageable materials in the rings of Uranus feel like a web in whose center she waits. A spider can sense prey approaching by feeling the vibrations in its web; so for Spider Rose, nothing enters the perimeter of her tiny enclave without her knowledge.
This sounds nice and cozy, but it's not the whole story. Inside her spaceship, the only thing Spider Rose has for company -- besides some pet cockroaches -- is her grief, with which she is locked in an eternal stalemate. She can keep it at bay with mood-suppressing drugs, but it's always there, waiting. So in a sense Spider Rose has an internal version of the web she's built in space ... a fragile wall around herself consisting mainly of her own vigilance.
The plot of the story concerns a huge jewel she's found in the Ring. Its immense size and the unique circumstances of its formation ensure that no Investor will be able to resist it, so she haggles shamelessly with one, trying, it seems, to buy herself a way out of her emotional hell. The Investor starts out by making her generous offers of money, technology, information ... but she refuses them all. Eventually the Investor realizes what she's looking for, and offers her a cute animal that he calls his ship's mascot. She is taken with the animal and accepts the offer, for a trial period of a little under two years.
The animal does make her happy, but the story ends tragically. I'm not sure if it happened because she let down her guard a little, because she finally has a little joy in her life -- something to take her mind off the grim, monotonous business of survival -- or if it would have happened regardless, but just the possibility that it might have been this fleeting happiness that doomed her makes this story almost unbearable.
(It's not a bad story -- it's a very, very good one -- but if your emotional landscape is anything like mine it will make you cry.)
Cicada Queen - One of the more interesting stories in terms of worldbuilding, and also the one that overlaps the most with the events of Schismatrix. Both texts benefit hugely from being in the same volume, so that the reader can page back and forth for additional context.
This story takes place in Czarina-Kluster, the floating city-state built around the engineless hulk of an Investor ship that imprisons the disgraced Investor Queen whom Lindsay blackmails in Schismatrix, and picks up pretty much where the novel leaves off; Wellspring, the enigmatic terraforming advocate whom Lindsay coached in the art of cultivating a personal mystique, has successfully risen to prominence in Czarina-Kluster's government, and is busily directing the terraforming of Mars.
The plot concerns a new arrival to Czarina-Kluster, a Shaper named Hans Landau (which is bizarrely the name of the Nazi character in Quentin Tarantino's "Inglourious Basterds" -- a fact that, lacking the gift of prophecy, Bruce Sterling could not have known when he wrote the story but which is nonetheless very distracting to the modern reader! Even though I succeeded in stripping the name of its sinister connotations, I continued to imagine the character looking and sounding exactly like Christoph Waltz) who is a gifted genetic engineer and scholar of lichens. He has invented a lichen that can grow inside stone, which he has used to create a unique gem as a gift for Czarina-Kluster's Queen. (Lavish gifts are the rent she extracts from people who want to settle in Czarina-Kluster -- they call it "the Queen's Percentage"). Landau has the singular bad luck to make his debut just as the political structure of Czarina-Kluster is imploding, with the Queen growing increasingly bored and frustrated with her exile and wishing to leave, venting her rage by ordering whichever of her advisers is currently annoying her to kill himself.
The plot also concerns a space voyage intended to tow a vast ball of ice from the rings of Saturn to Mars, where it will be steered onto a collision course with the planet in hopes of creating a sea. Landau seizes upon this as an opportunity to leave the fraught environment of Czarina-Kluster, to pursue his research on Mars as part of the terraforming project.
The voyage to Mars is ... eventful, to say the least.
Sunken Gardens - A follow-up to "Cicada Queen," taking place on Mars two hundred years after the fall of Czarina-Kluster and Hans Landau's migration to Mars. Landau, having undergone extensive cybernetic alteration to enable himself to survive in space, is still alive (err, for certain values of "alive), ruling Mars as its "Lobster King".
He does not directly appear in this story, though; the plot of this story concerns people living on Mars as the unwilling hostages of Terraform-Kluster, a satellite orbiting Mars where Landau and his clique live and direct the ongoing terraforming project happening on the surface of Mars.
We only meet one member of Terraform-Kluster in the story; Arkadya Sorienti, who appeared briefly in "Cicada Queen" and now serves as the Lobster King's envoy to the surface. Her job is to judge the competition that takes up the bulk of this story: a sort of ecological Hunger Games in which five participants battle for control of one of the Sunken Gardens -- craters on Mars where a rich atmosphere has pooled and water has settled, enabling the growth of vegetation. The contestants each come from a different faction that has been subjugated by Terraform-Kluster and marooned on Mars, forced to give their labor to the terraforming project started by Wellspring and Landau. Each contestant is given their own sector of the Garden to seed with whatever life forms they want -- they use robot drones to do this, and also to make whatever modifications to the environment they see fit, like cutting down trees, spraying herbicides, setting fires etc. The only rule limits their interference with the Garden ecosystem to a period of twelve hours. After that, they can only watch and wait, to see whose life forms survive and whose do not. The winner will ascend to Terraform-Kluster with Arkadya Sorienti, and take his or her place among the ruling faction.
The protagonist of this story is a young woman named Mirasol ("look at the sun" -- appropriate advice for a terraformer), who is a member of a splinter group of Superbright Shapers called Patternists, after the nature of their neurological ReShaping. They all have hypertrophied right brain hemispheres, which enable them to see patterns everywhere.
Mirasol's competitors are just as outre and remote from recognizable humanity as she is -- the weirdest one is a nameless woman whose legs terminate in a second set of hands, and whose knees bend like elbows. Two of them are Mechanists -- one so unaccustomed to planetary gravity that he requires a cybernetic exoskeleton to walk, and another who is heavily armed and armored, and clearly does not trust his fellow human-offshoots. There is also a sixth competitor who never appears, and whose sector is divided among the rest. It is to be inferred that he died, and possibly that Arkadya killed him for violating some rule of the contest.
This story serves as kind of a counterweight to the ecstatic hopefulness of the terraforming ideology presented in Schismatrix and "Cicada Queen." The people doing the actual work of terraforming are slaves, and the Sunken Gardens are more like arenas than gardens, where each nascent life form that appears is dwarfed by piles and piles of dead ones, and the horizon of that life form's future may only last until the next competition is held in that particular Sunken Garden.
Twenty Evocations - Paradoxically the most and the least accessible story in this collection. It's very, very short; more a prose poem than a story, with twenty very cryptic passages a paragraph or two in length that tell the story of Nikolai Leng, a Shaper whose life path echoes those of the two main characters of Schismatrix in a lot of ways. Like Lindsay, he defects from the Shaper Ring Council, marries advantageously (but also really loves his wife), carves out a sphere of influence outside the Ring Council, meets the Investors, founds a satellite Kluster and crosses paths with an assassin. Like Constantine, he loses the woman he loves early in their relationship and tries to fill the hole in his heart by having her cloned. Unlike either of them, though, he gives the impression of being buffeted along by events, just trying to keep his head above water, rather than trying to seize the reins of history like Lindsay and Constantine do.
Probably my favorite thing about this story is its judicious employment of word salad. Every so often, the final paragraph of one of the numbered sections will just be a string of phrases echoed from previous paragraphs, but placed in a new, surreal order that gives them new meaning. It can be very hard to see what this meaning is supposed to be, though. It gives us glimpses into Leng's state of mind at various important moments in his life, but his mind is chaotic. The reader has to do a lot of work to piece together a coherent story, a consistent characterization for Leng, and a sense of his emotional journey through the twenty vignettes. The reader has to do a lot of work to piece it all together, but Sterling has made sure there is enough raw material there to work with.
Sometimes it feels like it's only just barely enough, though. Even when I did put all the pieces into place, I never felt as much for Nikolai Leng, or got as deeply absorbed in his story, as I did for Abelard Lindsay, Simon Afriel, Spider Rose, Hans Landau and Mirasol. There wasn't as much to grapple with, thematically and in terms of worldbuilding, as there was in "Swarm," "Cicada Queen" and "Sunken Gardens," and there was nowhere near the emotional depth of "Spider Rose." Especially when you've already read the whole of Schismatrix, "Twenty Evocation" feels a lot like a dry run at telling that story.
Schismatrix itself I'm going to review separately, because there's so much to talk about, so in this review I will focus on the short stories and what they add to the experience of reading Schismatrix.
There are five stories: "Swarm," "Spider Rose," "Cicada Queen," "Sunken Gardens" and "Twenty Evocations."
Swarm - a suspenseful tale in the classic tradition of "hunter becomes prey" stories; it follows two Shaper scientists, Simon Afriel and Galina Mirny, as they engage in some very dangerous field research. They are studying one of the nineteen other space-faring races besides humankind and its new trading partners, the Investors. The beings they are studying -- by means no less drastic than going to live in one of their colonies for two years -- are essentially gigantic social insects called the Swarm. Like ants or termites, the Swarm lives in a vast complex of underground tunnels that they have dug for themselves. Also like ants, they have many different castes, with body types specialized for each caste's function. There are large, imposing warriors with huge mandibles; there's a vast Queen who lays eggs endlessly and is the mother of every individual in the colony; there are legions of small, bustling workers; there are a few "sensors" whose function is to monitor air quality in the colony to make sure it stays livable -- they are little more than eyes, brain, antennae and lungs, and have to be carried by workers; and there are tunnelers, huge living bulldozers with spadelike legs and jaws adapted for crunching rocks. There are also an astonishing array of "symbiotes" -- creatures that are not of the Swarm, that had clearly once been something else, but which, through long cohabitation, have been absorbed into it.
None of these critters possesses anything like human intelligence or sentience; in an exchange that effectively sets the mood for the whole story, Simon Afriel tells an ensign on the Investor ship that carries him to the Swarm colony that this alone makes them worth studying. How does a species without higher consciousness take to the stars?
The Investor, characteristically of his species, cannot understand why Afriel is so anxious to know this. He tells Afriel that humans place too much value on mere information, information that cannot possibly profit them. Afriel tells the Investor that humans are a young species, only children to the ancient and long-lived Investors, so the Investor should not be surprised to see a childlike curiosity from them.
I don't want to reveal too much about what happens in this story, because it's such an incredible twist, but let's just say that this Investor ensign -- and also Mirny, who has been with the colony longer than Afriel has and who shows him the ropes when he arrives -- serve very poignantly as voices of reason, trying in vain to sway Afriel from his hubris. The ensign's words, especially, give you insight into how the Investors have lasted for so long as a species, and hints that perhaps their laziness and incuriosity are survival traits rather than vices.
Spider Rose - This is a very sad story. It's also the only one told from the perspective of a Mechanist rather than a Shaper (although there is one character who is both, but he begins as a Shaper so I'm not sure he counts). The protagonist, Lydia Martinez, has been widowed for thirty years (her husband, a wealthy businessman who traded with the Investors, had been murdered by Shaper assassins) and has taken to calling herself Spider Rose. Where the "Rose" comes from I don't know, but the "Spider" serves as a neat symbol of her approach to ensuring her own survival; she's a Mechanist, and an old one, so her body has been extensively modified with cybernetics. The surveillance system of her spaceship feeds seamlessly into her brain; its cameras are her eyes just as much as the ones in her head; and the vast nets she uses to fish for salvageable materials in the rings of Uranus feel like a web in whose center she waits. A spider can sense prey approaching by feeling the vibrations in its web; so for Spider Rose, nothing enters the perimeter of her tiny enclave without her knowledge.
This sounds nice and cozy, but it's not the whole story. Inside her spaceship, the only thing Spider Rose has for company -- besides some pet cockroaches -- is her grief, with which she is locked in an eternal stalemate. She can keep it at bay with mood-suppressing drugs, but it's always there, waiting. So in a sense Spider Rose has an internal version of the web she's built in space ... a fragile wall around herself consisting mainly of her own vigilance.
The plot of the story concerns a huge jewel she's found in the Ring. Its immense size and the unique circumstances of its formation ensure that no Investor will be able to resist it, so she haggles shamelessly with one, trying, it seems, to buy herself a way out of her emotional hell. The Investor starts out by making her generous offers of money, technology, information ... but she refuses them all. Eventually the Investor realizes what she's looking for, and offers her a cute animal that he calls his ship's mascot. She is taken with the animal and accepts the offer, for a trial period of a little under two years.
The animal does make her happy, but the story ends tragically. I'm not sure if it happened because she let down her guard a little, because she finally has a little joy in her life -- something to take her mind off the grim, monotonous business of survival -- or if it would have happened regardless, but just the possibility that it might have been this fleeting happiness that doomed her makes this story almost unbearable.
(It's not a bad story -- it's a very, very good one -- but if your emotional landscape is anything like mine it will make you cry.)
Cicada Queen - One of the more interesting stories in terms of worldbuilding, and also the one that overlaps the most with the events of Schismatrix. Both texts benefit hugely from being in the same volume, so that the reader can page back and forth for additional context.
This story takes place in Czarina-Kluster, the floating city-state built around the engineless hulk of an Investor ship that imprisons the disgraced Investor Queen whom Lindsay blackmails in Schismatrix, and picks up pretty much where the novel leaves off; Wellspring, the enigmatic terraforming advocate whom Lindsay coached in the art of cultivating a personal mystique, has successfully risen to prominence in Czarina-Kluster's government, and is busily directing the terraforming of Mars.
The plot concerns a new arrival to Czarina-Kluster, a Shaper named Hans Landau (which is bizarrely the name of the Nazi character in Quentin Tarantino's "Inglourious Basterds" -- a fact that, lacking the gift of prophecy, Bruce Sterling could not have known when he wrote the story but which is nonetheless very distracting to the modern reader! Even though I succeeded in stripping the name of its sinister connotations, I continued to imagine the character looking and sounding exactly like Christoph Waltz) who is a gifted genetic engineer and scholar of lichens. He has invented a lichen that can grow inside stone, which he has used to create a unique gem as a gift for Czarina-Kluster's Queen. (Lavish gifts are the rent she extracts from people who want to settle in Czarina-Kluster -- they call it "the Queen's Percentage"). Landau has the singular bad luck to make his debut just as the political structure of Czarina-Kluster is imploding, with the Queen growing increasingly bored and frustrated with her exile and wishing to leave, venting her rage by ordering whichever of her advisers is currently annoying her to kill himself.
The plot also concerns a space voyage intended to tow a vast ball of ice from the rings of Saturn to Mars, where it will be steered onto a collision course with the planet in hopes of creating a sea. Landau seizes upon this as an opportunity to leave the fraught environment of Czarina-Kluster, to pursue his research on Mars as part of the terraforming project.
The voyage to Mars is ... eventful, to say the least.
Sunken Gardens - A follow-up to "Cicada Queen," taking place on Mars two hundred years after the fall of Czarina-Kluster and Hans Landau's migration to Mars. Landau, having undergone extensive cybernetic alteration to enable himself to survive in space, is still alive (err, for certain values of "alive), ruling Mars as its "Lobster King".
He does not directly appear in this story, though; the plot of this story concerns people living on Mars as the unwilling hostages of Terraform-Kluster, a satellite orbiting Mars where Landau and his clique live and direct the ongoing terraforming project happening on the surface of Mars.
We only meet one member of Terraform-Kluster in the story; Arkadya Sorienti, who appeared briefly in "Cicada Queen" and now serves as the Lobster King's envoy to the surface. Her job is to judge the competition that takes up the bulk of this story: a sort of ecological Hunger Games in which five participants battle for control of one of the Sunken Gardens -- craters on Mars where a rich atmosphere has pooled and water has settled, enabling the growth of vegetation. The contestants each come from a different faction that has been subjugated by Terraform-Kluster and marooned on Mars, forced to give their labor to the terraforming project started by Wellspring and Landau. Each contestant is given their own sector of the Garden to seed with whatever life forms they want -- they use robot drones to do this, and also to make whatever modifications to the environment they see fit, like cutting down trees, spraying herbicides, setting fires etc. The only rule limits their interference with the Garden ecosystem to a period of twelve hours. After that, they can only watch and wait, to see whose life forms survive and whose do not. The winner will ascend to Terraform-Kluster with Arkadya Sorienti, and take his or her place among the ruling faction.
The protagonist of this story is a young woman named Mirasol ("look at the sun" -- appropriate advice for a terraformer), who is a member of a splinter group of Superbright Shapers called Patternists, after the nature of their neurological ReShaping. They all have hypertrophied right brain hemispheres, which enable them to see patterns everywhere.
Mirasol's competitors are just as outre and remote from recognizable humanity as she is -- the weirdest one is a nameless woman whose legs terminate in a second set of hands, and whose knees bend like elbows. Two of them are Mechanists -- one so unaccustomed to planetary gravity that he requires a cybernetic exoskeleton to walk, and another who is heavily armed and armored, and clearly does not trust his fellow human-offshoots. There is also a sixth competitor who never appears, and whose sector is divided among the rest. It is to be inferred that he died, and possibly that Arkadya killed him for violating some rule of the contest.
This story serves as kind of a counterweight to the ecstatic hopefulness of the terraforming ideology presented in Schismatrix and "Cicada Queen." The people doing the actual work of terraforming are slaves, and the Sunken Gardens are more like arenas than gardens, where each nascent life form that appears is dwarfed by piles and piles of dead ones, and the horizon of that life form's future may only last until the next competition is held in that particular Sunken Garden.
Twenty Evocations - Paradoxically the most and the least accessible story in this collection. It's very, very short; more a prose poem than a story, with twenty very cryptic passages a paragraph or two in length that tell the story of Nikolai Leng, a Shaper whose life path echoes those of the two main characters of Schismatrix in a lot of ways. Like Lindsay, he defects from the Shaper Ring Council, marries advantageously (but also really loves his wife), carves out a sphere of influence outside the Ring Council, meets the Investors, founds a satellite Kluster and crosses paths with an assassin. Like Constantine, he loses the woman he loves early in their relationship and tries to fill the hole in his heart by having her cloned. Unlike either of them, though, he gives the impression of being buffeted along by events, just trying to keep his head above water, rather than trying to seize the reins of history like Lindsay and Constantine do.
Probably my favorite thing about this story is its judicious employment of word salad. Every so often, the final paragraph of one of the numbered sections will just be a string of phrases echoed from previous paragraphs, but placed in a new, surreal order that gives them new meaning. It can be very hard to see what this meaning is supposed to be, though. It gives us glimpses into Leng's state of mind at various important moments in his life, but his mind is chaotic. The reader has to do a lot of work to piece together a coherent story, a consistent characterization for Leng, and a sense of his emotional journey through the twenty vignettes. The reader has to do a lot of work to piece it all together, but Sterling has made sure there is enough raw material there to work with.
Sometimes it feels like it's only just barely enough, though. Even when I did put all the pieces into place, I never felt as much for Nikolai Leng, or got as deeply absorbed in his story, as I did for Abelard Lindsay, Simon Afriel, Spider Rose, Hans Landau and Mirasol. There wasn't as much to grapple with, thematically and in terms of worldbuilding, as there was in "Swarm," "Cicada Queen" and "Sunken Gardens," and there was nowhere near the emotional depth of "Spider Rose." Especially when you've already read the whole of Schismatrix, "Twenty Evocation" feels a lot like a dry run at telling that story.
April 9, 2018
A sweeping history of man's future in space, a time when humanity has reworked itself in dozens of different ways at the fundamental levels of thought, biology, and technology in order to adapt to its new environment. These scattered, interrelated communities exist within two general, mutually antagonistic factions: the Shapers, who rely on genetic manipulation, and the Mechanists, who rely on advanced technology. Bruce Sterling is an inventive writer with a lively intellect, but his novel often introduces such a barrage of names and factions that it was difficult for me to orient myself. Furthermore, the action sometimes leaps years forward with scarcely any attention given to what happened in between. Sterling's focus is more on developing his complex history than his characters and the novel suffers as a result.
Fortunately, this volume also contains Sterling's short fiction set within the same universe. Every one of them is a gem--a rabbit punch to the mind with sharply drawn characterizations. I would recommend reading the stories before the novel. They supply an introduction to the Shaper/Mechanist universe and a firm grounding in its realities that probably would have increased my appreciation of the novel.
Fortunately, this volume also contains Sterling's short fiction set within the same universe. Every one of them is a gem--a rabbit punch to the mind with sharply drawn characterizations. I would recommend reading the stories before the novel. They supply an introduction to the Shaper/Mechanist universe and a firm grounding in its realities that probably would have increased my appreciation of the novel.
August 14, 2017
This book slowly grew on me. Honestly, I didn't like the first 100 pages of so; it was too cyber-punky (and I have read enough of that). But then it got weirder and weirder and it started to grasp me very deeply. It is a mad difficult book to write (and due to that, it is quite obscure in places; but that's alright). The rivalry developed between Lindsay and Constantine over a very long time span in environments which are joy to imagine was wonderful. It is not a wonder why nobody ever touched it to make it a feature movie (it would make a wonderful animation though).
The Schismatrix plus version was a better read; actually my note for the book is 4 which mecomes 5 with the stories particulaly the Swarm and Spider Rose. From the cyber-punk era Sterling is my favourite writer and I don't understand why he has a lower profile compared to Gibson or Stephenson. I will end up reading all his books I think.
The Schismatrix plus version was a better read; actually my note for the book is 4 which mecomes 5 with the stories particulaly the Swarm and Spider Rose. From the cyber-punk era Sterling is my favourite writer and I don't understand why he has a lower profile compared to Gibson or Stephenson. I will end up reading all his books I think.
January 17, 2024
Delightfully weird. I see I'm not only one who recognizes A. Reynolds' echoing much of the bizarreness of Sterling's future. I found this title far more fun scifi with the braces of hard science much looser in the shaping the story.
Bruce flushing out as many ideas possible proved as coherent as it could be. And towards the end I could see how people can consider the story progressively disjointed. However I took it to be an Old man's retelling, as our main character got older the story, the vibrant coherency of youth the boiled granular crumbs leading to the end of Lindsay's story. The gaps between snippets of Lindsay's and uncertainty of a future he fought to create invokes much in the personally.
Also did very much like the last short stories.
Bruce flushing out as many ideas possible proved as coherent as it could be. And towards the end I could see how people can consider the story progressively disjointed. However I took it to be an Old man's retelling, as our main character got older the story, the vibrant coherency of youth the boiled granular crumbs leading to the end of Lindsay's story. The gaps between snippets of Lindsay's and uncertainty of a future he fought to create invokes much in the personally.
Also did very much like the last short stories.
November 24, 2018
Una novela que explora varios conceptos de evolución personal, tecnológica, cultural, y política, más bien en cantidad que en profundidad. Siento que podría haber sido mucho más interesante, pero la estructura de la historia, y su foco, me resultaron demasiado tediosos.
Las historias cortas al final me resultaron más entretenidas, merecedoras de una mejor calificación (un poco más de 3 estrellas?).
Las historias cortas al final me resultaron más entretenidas, merecedoras de una mejor calificación (un poco más de 3 estrellas?).
Displaying 1 - 30 of 248 reviews