Abstract
Free full text
Identification of host receptor and receptor-binding module of a newly sequenced T5-like phage EPS7
Abstract
The virulent bacteriophage EPS7 active against a number of Salmonella serovar and Escherichia coli strains, isolated from the local sewage in Korea, belongs to the family Siphoviridae. The ESP7 genome constitutes a linear double-stranded DNA of 111 382 bp. DNA sequencing and genomic analysis of EPS7 showed that it belongs to the phage T5 family. We identified the EPS7 genes involved in DNA repair, replication, viral structure and bacterial lysis by comparing the EPS7 genome with that of T5. In contrast, the tail genes encoding for putative host receptor-binding protein and the putative receptor-blocking lipoprotein precursor of EPS7 exhibit high homologies with the corresponding gene products of BF23, another member of the T5-family. BF23 binds to BtuB, a surface receptor in the host and involved in vitamin B12 uptake, but its infection is independent of TonB. By constructing a series of deletion mutants in Salmonella and in E. coli and studying phage infection in the mutant hosts, we showed that BtuB is also the host receptor of the phage EPS7. Whether EPS7 infection depends on TonB needs to be further studied.
Introduction
The first step of phage infection involves interaction between the host receptor and the phage receptor-binding protein (RBP). Components of the outer membrane in Gram-negative bacteria often serve as a receptor for bacteriophage. Interestingly, phage T5 has two tail components for binding the host: the RBP (pb5 encoded by oad gene) and the L-shaped tail fibers, binding to the host FhuA and lipopolysaccharide, respectively (Saigo, 1978; Heller & Braun, 1979, 1982; Heller, 1984; Krauel & Heller, 1991; Mondigler et al., 1995). Other T5-like phages, BF23 (containing Hrs as RBP) and H8 (Rbp), utilize the outer membrane transporter for vitamin B12, BtuB (Heller & Kadner, 1985; Mondigler et al., 1996), and the ferric enterobactin receptor, FepA (Rabsch et al., 2007), respectively. In this study, we isolated a phage EPS7 that was able to infect both Salmonella and Escherichia coli. Morphological characterization and the complete genome sequence of EPS7 highly resembled those of T5 and T5-like phages in the family Siphoviridae. DNA sequence analysis of the putative RBP gene and the receptor-blocking lipoprotein (Llp) gene of EPS7 revealed its close relatedness to that of a T5-like phage BF23. By constructing various deletion mutants of the hosts and studying phage infection in the mutants, we demonstrated that BtuB is also the bacterial receptor of EPS7. It is the fourth phage characterized as having a receptor-binding/receptor-blocking module.
Materials and methods
Bacteriophage isolation and propagation
Six sewage samples were collected from Seoul and Il-san city, Korea. After centrifugation (6000 g, 10 min) and filtration (0.2 μm in pore size) (Millipore), 45 mL of the filtrate was mixed with an equal volume of Luria–Bertani (LB) broth (1%, tryptone peptone; 1%, NaCl; 0.5%, yeast extract) and a propagation strain (Salmonella enterica serovar Typhimurium LT2), and incubated at 37°C for 12–18h with constant shaking (180r.p.m.). The culture was centrifuged and the supernatant was filtered as above. Plaque formation was confirmed using LT2-containing molten soft agar (0.6% agar in LB) as previously described (Adams, 1959). Individual plaques were picked, and phages were eluted with sodium chloride–magnesium sulfate (SM) buffer (50 mM Tris-HCl,pH7.5,100mM NaCl, 10 mM MgSO4), and replated and repicked two times.
Bacteriophages were propagated as described by Sambrook (2001). Exponentially growing S. enterica serovar Typhimurium SL1344 (OD600 nm = 0.5) was infected with EPS7 at a multiplicity of infection (MOI) of 2 and incubated for 4 h at 37 °C. Removal of cell debris, precipitation of phage particles by poly(ethylene) glycol treatment and subsequent CsCl density gradient ultracentrifugation(60 000 g, 4 h at 4 °C) were carried out. Viral particles were recovered, dialyzed using SM buffer and stored at 4 °C.
Energy-filtering transmission electron microscopy
CsCl-purified high-titer phages were placed on carbon-coated copper grids and negatively stained with 2% aqueous uranyl acetate (pH 4.0) (Fisher Scientific). Electron microscopy was carried out using an energy-filtering transmission electron microscope (LIBRA 120, Carl Zeiss) at 80 kV accelerating voltage at the National Instrumentation Center for Environmental Management (Seoul, Korea).
Sequencing of phage genomic DNA
Phage genomic DNA was prepared as described elsewhere (Sambrook, 2001). A Genome Sequencer 20 System (454 Life Science Corp.) was initially used for whole genome sequencing at Macrogen Inc., Korea, which resulted in the construction of 21 contigs. In order to reduce the contigs, a shotgun library was prepared with randomly sheared DNA using Hydroshear (part no. JHSH000000–1, Gene machines). DNA fragments of desired sizes (1–3 kb) were cloned into pCR4Blunt-TOPO vector (Invitrogen, CA) and DNA sequencing was performed using the Applied Biosystems BigDye v3.0 and an ABI Prism 3730 XL DNA analyzer. Finally, sequence gaps were filled by primer walking. The complete genome was assembled using the SEQMAN II sequence analysis software (DNASTAR Inc., Madison, WI). Almost eightfold average sequence coverage was achieved.
Nucleotide accession number
The GenBank accession number of EPS7 is CP000917.
Genomic sequence analysis
ORFs were identified using GENEMARK (window length: 96; window step: 12; threshold value: 0.5) (Besemer & Borodovsky, 2005) and analyzed using the BLAST algorithm (Altschul et al., 1997). The PROSITE database (Sigrist et al., 2002) was used for possible protein domain searches and tRNA-coding sequences were detected by the TRNASCAN-SE program (Lowe & Eddy, 1997). Multiple sequence alignment was performed using the CLUSTALW program (Chenna et al., 2003).
Genetic manipulation of Salmonella Typhimurium SL1344
In-frame deletion mutants of entire fhuA, fepA or btuB in Salmonella Typhimurium SL1344 were constructed using the λ-red recombination system as previously described (Datsenko & Wanner, 2000). Briefly, FRT-flanked kanamycin resistance gene cassette from pKD4 was PCR-amplified using appropriate primer sets and transformed into SL1344 containing pKD46: the primer sets used were for fhuA, fhuA-F (5’-AATAATTATCGTTTACGTTATCATTCACTTTC ATCAGAGAGTGTAGGCTGGAGCTGCTTC-3’) and fhuA-R (5’-TTCGTTCTGGAAATAAGAAAGGAACGTAAAATTCGT TTTCCATATGAATATCCTCCTTAG-3’); for fepA, fepA-F (5’-TTGCCAATTCCCTCCCCGAATGAGGGAGGGAAGG TTGCCAGTGTAGGCTGGAGCTGCTTC-3’) and fepA-R (5’GCGCTTTGGC TTATGTGGCTAAAGAAAAGCAGGA TATACACATATGAATATCCTCCTTAG-3’); for btuB, btuB-F (5’-GAAGCCTGCGGCATCCTTCTTATATTGTGGATGCTTT ACA GTGTAGGCTGGAGCTGCTTC-3’) and btuB-R (5’-ACCGACGCCG GAATCAAATA CCAGCACGGTGG GACGTGGTCATATGAATATCCTCCTTAG-3’). Each primer contained the Salmonella target gene sequence, shown as underlined. After selection in the presence of kanamycin and ampicillin, pKD46 was cured as described by Datsenko & Wanner (2000). The genome-integrated kanamycin resistance gene was then removed by introducing pCP20, followed by curing of pCP20.
For complementation study, the complete btuB from Salmonella SL1344 was amplified using primers containing an artificial restriction enzyme cleavage site (underlined), btuB-C1 (CTCGAGTACAATGATTAAAAAAGC) and btuB-C2 (GGATCCTGGTTCAGAAGGTGTA). Amplified btuB fragment was cleaved with XhoI and BamHI, and ligated into equally treated pZC320 (Shi & Biek, 1995), named pZC003. The ligated pZC003 was transformed into btuB deletion mutant (ΔbtuB).
Phage infection and adsorption assays
An overnight culture of Salmonella SL1344 was used to inoculate fresh LB (1% inoculum) medium and incubated at 37 °C with constant shaking (180 r.p.m.). When the cell density reached 0.4 of OD600 nm (c. 5 × 107 CFU mL−1), CsCl-purified bacteriophage was added at an MOI of 20 (109 PFUmL−1) and bacterial growth was monitored by measuring absorbance at A600 nm. A HITACHIU-1100 spectrophotometer and 100 semi-micro cuvettes (Ratiolab, Germany) were used for measurement.
For adsorption assay, exponentially growing cells were collected (16 000 g, 2 min), washed once with phosphate-buffered saline (pH 7.2) and resuspended in LB. EPS7 was added at an MOI of 0.01 (106 PFU) and incubated at 37 °C. At 0, 5, 10 and 15 min after phage infection, cells were removed by centrifugation (16 000 g for 5 min at 4 °C), and the PFU counts in the supernatant were determined. All data are shown as an average of triplicate experiments, and SD is indicated by error bars.
Results and discussion
Isolation and morphological characterization of EPS7
A total of 15 bacteriophages infecting an indicator strain Salmonella Typhimurium LT2 were isolated from sewage samples, and their host range was determined according to the ability to form plaques on other Salmonella strains as well as on E. coli hosts. Among them, phage EPS7 was able to infect all of the tested 11 Salmonella Typhimurium, seven Salmonella Enteritidis and seven E. coli strains (data not shown), and were thus chosen for the further studies. Morphological characterization examined by negative staining and transmission electron microscopy reveals that EPS7 belongs to the family Siphoviridae featuring an icosahedral head with a diameter of 65 nm and a long noncontractile tail, 185 nm long (Fig. 1).
Transmission electron micrographs of EPS7. Scale bar = 100 nm.
Complete genome sequencing and organization of the EPS7 genome
EPS7 genome comprises 111 382 bp with an overall G+C content of 39%, which is significantly lower than that of Salmonella (52%) (McClelland et al., 2001) or E. coli (50%) (Blattner et al., 1997). As determined by the BLAST search, dot-plot analysis (Supporting Information, Fig. S1) and gene annotation of putative ORFs, EPS7 genome is highly similar to that of bacteriophage T5 (Fig. 2), which is one of the best-studied phages among enterobacterial virulent phages in the family Siphoviridae (Wang et al., 2005). The gene-coding potential for EPS7 is 82.9%, similar to 83.1% of T5. The complete genome sequence and annotation information is deposited in GenBank (accession number CP000917).
Genome structure of bacteriophage EPS7. Note that the terminally redundant DNA sequence is not included. Pre-early, early and late regions are indicated by red, blue and yellow base lines, respectively. Genes and their transcription directions are indicated with arrows that are colored according to annotation, homology and function: annotated genes, red; T5 homology genes, green; other genes that did not show homology in the database search, yellow. tRNA-coding sequences are colored in gray at the same line with genes. Approximate loci of direct repeats, inverted repeats and palindrome sequences are marked in blue. Also refer to the information accessible on the web (GenBank Accession number: CP000917).
A key feature of the T5 genome is the terminally redundant DNA sequence in the form of direct repeats (Rhoades & Rhoades, 1972). Significantly higher coverage of shotgun reads was obtained from c. 10kb spanning the pre-early region of the phage (Fig. 2), similar to another T5-like phage H8 (Rabsch et al., 2007). In addition, restriction enzyme digestion patterns of EPS7 genomic DNA revealed that there is a 10-kb redundant sequence at the right end of the chromosome (data not shown). These results are in line with members of the T5 family, T5, BF23 and H8 (Wiest & McCorquodale, 1990; Wang et al., 2005; Rabsch et al., 2007), indicating a common feature of T5-like bacteriophages. EPS7 genome could be functionally divided into three regions: pre-early, early and late regions (Fig. 2).
Pre-early region
The pre-early region of T5, spanning 0–8.3% of the total genome, is initially transferred to the host cell (first step transfer, FST) upon irreversible binding of the phage (Lanni, 1968). Further penetration the of phage genome (second step transfer, SST) facilitates T5 pre-early gene expression, producing various host enzyme inhibitors and gene product A1, which play a role in the inhibition of host DNA, RNA and protein synthesis, and degradation of host DNA (Zweig et al., 1972; Wang et al., 2005). In addition, the T5 Dmp gene encodinga deoxyribonucleoside-5’-monophosphatase enzyme converts deoxyribonucleotides to deoxyribonucleosides, which are eventually secreted as bases and nucleotides (Warner et al., 1975). The gene product A2-3 is also needed for SST.
The pre-early region of EPS7 includes 18 ORFs (17 in T5). Among them, ORF1, ORF4 and ORF5 share highest homologies with Dmp (91%), A1 (90%) and A2-3 (87%), respectively. ESP7 also appears to encode homologous gene products, ORF12–15 in ESP7 corresponding to ORF12–17 in T5 encoding various enzymatic inhibitors. However, unlike in T5 (Wang et al., 2005), protein motif analysis of EPS7 ORFs, using PROSITE, revealed no protein modification sites that are thought to play a role in inactivating host functions (Wang et al., 2005), suggesting a different mode of host cell takeover program.
Direct or inverted repeats and palindrome sequences at the end of the pre-early region play an important role in the DNA transfer system during DNA replication (Heusterspreute et al., 1987). In EPS7, repeats or palindrome sequences are widespread all over the phage genome (Fig. 2), which makes it difficult to identify the pause sequence for FST, implying that EPS7 may have a genome transfer system different from that of T5.
Early region
The early gene expression of T5 begins 5 min after infection and the region is located in 8.3–67.3% and 90.8–91.7% of the phage chromosome containing 111 predicted ORFs (Wang et al., 2005). T5 early gene products are involved in replication (gene products of dpol and obp, primase, helicase, endonuclease), recombination, DNA repair, transcription (D5, gene product of exo5), signal transduction (serine/threonine phosphatase), metabolism (gene products of dnk, thy, B3-frd, rir1, rir2, nrdA,B,C,D and dut) and cell lysis (endolysin, holin, lytic conversion lipoprotein) (Wang et al., 2005; Rabsch et al., 2007).
The putative early genes of ESP7 are highly homologous to those in T5. However, EPS7 encodes only one putative endonuclease (ORF104) in the early region, while T5 contains four endonucleases and two HNH-homing endonucleases, which degrade host genomic DNA to provide nucleotides for the synthesis of phage DNA (Wang et al., 2005). In addition, the cAMP-dependent receptor and cAMP-dependent protein kinase catalytic subunit (kapc), present in T5, are missing in EPS7 and H8. Whereas the T5 early region contains a large dispensable segment of DNA (21.1–32.3%) encoding 24 tRNAs (Shlyapnikov et al., 1995), the corresponding ESP7 genome encodes 22 tRNAs (Fig. 2). The significance of the different number and repertoire of tRNA-encoding sequences among the T5-like phages is currently unclear.
Late region
The late region of T5 includes segment 67.3–90.8% of the phage genome, containing 23 predicted ORFs. The late gene expression begins 10–12 min after infection (Wang et al., 2005). The late gene products in T5 constitute mainly structural and morphogenesis proteins including D20–21 (major capsid protein), N4 (major tail protein) and Ltf (L-shaped tail fiber) (Wang et al., 2005). In addition, sciB gene product functions as endonuclease for introducing nicks in the T5 genome (Rogers & Rhoades, 1976; Wang et al., 2005).
In EPS7 (Fig. 2), prohead protease (98% amino acid homology with that of T5), sciB (95%) and portal protein (97%) are highly conserved, while distal tail fiber protein, tail protein (pb4), pore-forming tail tip protein (pb2) and putative major tail subunit gene showed lower but still significant homologies (62–87% identity) with the corresponding T5 genes. The L-shaped tail fiber protein (vltf gene product) involved in LPS binding also contains significant homology with that of T5, but tail fibers were not visible in our study (Fig. 1). In addition, EPS7 encoded an RBP (Bp7) homologue, but it showed low homology (30%) with the corresponding T5 gene product pb5 while being highly similar to that of BF23 (Hrs) (75%).
RBPs and receptor-blocking proteins (Llps) among the T5-like viruses
EPS7 genome analysis reveals the presence of a putative RBP (Bp7 in EPS7) and a receptor-blocking protein (LlpEPS7), which are transcribed in opposite directions. The Bp7-Llp module in EPS7 is followed by a hypothetical protein, which is not conserved among the T5 family (Fig. 3a).
(a) RBPs and lytic conversion lipoprotein precursor (Llps) modules of four T5-like viruses. White and black arrows are RBP and Llp proteins, respectively. Hypothetical proteins of BF23 and T5 are reported to be similar to each other (Mondigler et al., 2006), but those of EPS7 and H8 do not contain significant homology with that of T5. (b) CLUSTAL W analysis of RBPs of T5-like viruses, BF23, EPS7, T5 and H8. Boxes show five conserved regions (C1–C5) and two variable regions (V1 and V2) (Mondigler et al., 1996), while the dotted boxes in T5 indicate regions that are reported to be essential for T5 binding to the host receptor (Mondigler et al., 1996). (c) CLUSTAL W alignment of lytic conversion lipoprotein precursors from BF23, EPS7 and T5.
RBP of EPS7 (Bp7) showed the highest homology with that of BF23 (Hrs) (75% identical, 85% similar), but lower homologies with those of T5 (pb5) and of H8 (Rbp) (30% and 25% identical, 44% and 59% similar, respectively). Alignment of the Rbp, Hrs, pb5 and Bp7 found four regions (C1–C4) with high similarities, which is in agreement with previous studies (Rabsch et al., 2007). Especially N-terminal sequences are highly conserved, the first 45 residues of which showed 47.8% identity and 93% similarity (Fig. 3b). In contrast, a previously identified C5 region (Rabsch et al., 2007) is missing in Bp7 of EPS7, suggesting that this region may not be essential for binding to the host receptor. Mondigler et al. (1996) also reported, based on various deletion mutant studies of pb5 of T5, that the region spanning 487–640 amino acids was not essential for receptor binding.
Rabsch et al. (2007) also implicated two variable regions, designated as V1 and V2 (Fig. 3b), which might play an important role in interaction with the host receptor. Similarly, Mondigler et al. (1996) found the segment from 359 to 486 amino acids of pb5 of T5 in binding to the receptor. Whether these regions in EPS7 function similarly remains to be elucidated.
Lytic conversion by llp gene product in T5 and BF23 is accomplished by interacting with and blocking the host receptor, FhuA and BtuB, respectively (Decker et al., 1994; Pedruzzi et al., 1998; Mondigler et al., 2006). This process was known to require a large excess of the lipoprotein (10 : 1) in order to fully block the interaction of phage with the host receptor (Pedruzzi et al., 1998). EPS7 also encodes an Llp homologue. The protein (LlpEPS7) is again highly similar to lipoprotein of BF23 (LlpBF23) (64.6% identity, 73.7% similarity) but exhibits limited homology with that of T5 (LlpT5) (14.4% identity, 25.6% similarity) (Fig. 3c). Interestingly, the N-terminal 15 amino acids of precursor Llps are highly homologous (60% similarity); considering their possibly similar mode of action acting as a blocking agent, it is likely that this region plays a role in cellular localization of lipoproteins (Braun et al., 1994).
Evidence of Salmonella BtuB as a receptor for EPS7
As Bp7 of EPS7 exhibits high homologies with other RBPs of the T5 family members, we determined the corresponding host receptor. As mentioned above, host receptors for T5-like phages confirmed thus far include FhuA (for T5), BtuB (BF23) and FepA (H8). We constructed deletion mutants in fhuA, btuB or fepA in Salmonella SL1344, and tested the susceptibility of the mutants to EPS7. As shown in Fig. 4a, the btuB deletion mutant (ΔbtuB) became resistant to EPS7 infection while the fhuA (ΔfhuA) and the fepA (ΔfepA) deletion mutants were as sensitive as the wild-type SL1344 (Fig. 4a). When btuB was complemented extra-chromosomally by a plasmid-borne BtuB gene, a complete restoration of bacterial susceptibility was observed, strongly suggesting the involvement of BtuB of Salmonella in EPS7 infection. In addition, as shown in Fig. 4b, deletion of btuB in Salmonella completely abolishes the phage–host interaction, whereas the absence of either FhuA or FepA does not affect EPS7 adsorption to the host. In the ΔbtuB carrying the wild-type gene in the plasmid, the adsorption efficiency is fully restored (Fig. 4b). These data strongly support that EPS7 utilizes Salmonella BtuB as a bacterial receptor.
EPS7 infection (a) and adsorption (b) studies to Salmonella Typhimurium SL1344, ΔfhuA, ΔfepA, ΔbtuB and a btuB complementation strain [ΔbtuB(pZC003)]. See the text for details.
As EPS7 is also able to infect E. coli, we examined the role of the corresponding BtuB gene in E. coli. The BtuB gene in E. coli exhibits high similarity with that of Salmonella (94.8%). Our results showed that BtuB deletion is resistant to ESP7 infection. Thus BtuB also functions as an EPS7 receptor in E. coli (data not shown).
The inner membrane protein TonB is required for the activity of a number of outer membrane transporters, including FepA (Buchanan et al., 1999), BtuB (Chimento et al., 2003) and FhuA (Killmann & Braun, 1994). However, infection of T5 (Killmann & Braun, 1994) or BF23 (Rabsch et al., 2007) is not dependent on TonB, although that of phage H8 is TonB dependent (Rabsch et al., 2007). It was suggested that different ligand molecules have different requirements for TonB (Rabsch et al., 2007). Whether TonB is essential for EPS7 infection needs to be further elucidated.
In conclusion, we isolated and sequenced an Enterobacteriaceae phage EPS7. EPS7 is included in the T5 group of phages in the family Siphoviridae. High sequence homologies between two RBPs of EPS7 and BF23, and bacterial infection and adsorption studies in various deletion mutants confirmed BtuB as a bacterial receptor for EPS7.
Supplementary Material
Supple fig 1
Fig. S1. Dot-plot analysis between nucleotide sequences of T5 (x-axis) (NCBI, accession number NC005859) and EPS7 (y-axis), generated using MUMmer (Kurtz et al., 2008), which is a suffix tree algorithm designed to find maximal exact matches of some minimum length between two input sequences.
Acknowledgements
J.H. has been the recipient of a graduate fellowship provided by the Ministry of Education through the Brain Korea 21 Project. This work was supported by a grant (Code # 20070301034035) from BioGreen 21 Program, Rural Development Administration, Republic of Korea.
References
- Adams MH (1959) Methods of study of bacterial viruses. Bacteriophages (Hershey AD, ed), pp. 443–457. Interscience Publishers Inc., New York. [Google Scholar]
- Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389–3402. [Europe PMC free article] [Abstract] [Google Scholar]
- Besemer J & Borodovsky M (2005) GeneMark: web software for gene finding in prokaryotes, eukaryotes and viruses. Nucleic Acids Res 33: W451–W454. [Europe PMC free article] [Abstract] [Google Scholar]
- Blattner FR, Plunkett G III, Bloch CA et al. (1997) The complete genome sequence of Escherichia coli K-12. Science 277: 1453–1474. [Abstract] [Google Scholar]
- Braun V, Killmann H & Herrmann C (1994) Inactivation of FhuA at the cell surface of Escherichia coli K-12 by a phage T5 lipoprotein at the periplasmic face of the outer membrane. J Bacteriol 176: 4710–4717. [Europe PMC free article] [Abstract] [Google Scholar]
- Buchanan SK, Smith BS, Venkatramani L, Xia D, Esser L, Palnitkar M, Chakraborty R, van der Helm D & Deisenhofer J (1999) Crystal structure of the outer membrane active transporter FepA from Escherichia coli. Nat Struct Biol 6: 56–63. [Abstract] [Google Scholar]
- Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG & Thompson JD (2003) Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res 31: 3497–3500. [Europe PMC free article] [Abstract] [Google Scholar]
- Chimento DP, Mohanty AK, Kadner RJ & Wiener MC (2003) Substrate-induced transmembrane signaling in the cobalamin transporter BtuB. Nat Struct Biol 10: 394–401. [Abstract] [Google Scholar]
- Datsenko KA & Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. P Natl Acad Sci USA 97: 6640–6645. [Europe PMC free article] [Abstract] [Google Scholar]
- Decker K, Krauel V, Meesmann A & Heller KJ (1994) Lytic conversion of Escherichia coli by bacteriophage T5: blocking of the FhuA receptor protein by a lipoprotein expressed early during infection. Mol Microbiol 12: 321–332. [Abstract] [Google Scholar]
- Heller H & Kadner RJ (1985) Nucleotide sequence of the gene for the vitamin B12 receptor protein in the outer membrane of Escherichia coli. J Bacteriol 161: 904–908. [Europe PMC free article] [Abstract] [Google Scholar]
- Heller K & Braun V (1979) Accelerated adsorption of bacteriophage T5 to Escherichia coli F, resulting from reversible tail fiber-lipopolysaccharide binding. J Bacteriol 139: 32–38. [Europe PMC free article] [Abstract] [Google Scholar]
- Heller K & Braun V (1982) Polymannose O-antigens of Escherichia coli, the binding sites for the reversible adsorption of bacteriophage T5+ via the L-shaped tail fibers. J Virol 41: 222–227. [Europe PMC free article] [Abstract] [Google Scholar]
- Heller KJ (1984) Identification of the phage gene for host receptor specificity by analyzing hybrid phages of T5 and BF23. Virology 139: 11–21. [Abstract] [Google Scholar]
- Heusterspreute M, Ha-Thi V, Tournis-Gamble S & Davison J (1987) The first-step transfer-DNA injection-stop signal of bacteriophage T5. Gene 52: 155–164. [Abstract] [Google Scholar]
- Killmann H & Braun V (1994) Energy-dependent receptor activities of Escherichia coli K-12: mutated TonB proteins alter FhuA receptor activities to phages T5, T1, phi 80 and to colicin M. FEMS Microbiol Lett 119: 71–76. [Abstract] [Google Scholar]
- Krauel V & Heller KJ (1991) Cloning, sequencing, and recombinational analysis with bacteriophage BF23 of the bacteriophage T5 oad gene encoding the receptor-binding protein. J Bacteriol 173: 1287–1297. [Europe PMC free article] [Abstract] [Google Scholar]
- Lanni YT (1968) First-step-transfer deoxyribonucleic acid of bacteriophage T5. Bacteriol Rev 32: 227–242. [Europe PMC free article] [Abstract] [Google Scholar]
- Lowe TM & Eddy SR (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25: 955–964. [Europe PMC free article] [Abstract] [Google Scholar]
- McClelland M, Sanderson KE, Spieth J et al. (2001) Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413: 852–856. [Abstract] [Google Scholar]
- Mondigler M, Vogelë RT & Heller KJ (1995) Overproduced and purified receptor binding protein pb5 of bacteriophage T5 binds to the T5 receptor protein FhuA. FEMS Microbiol Lett 130: 293–300. [Abstract] [Google Scholar]
- Mondigler M, Holz T & Heller KJ (1996) Identification of the receptor-binding regions of pb5 proteins of bacteriophage T5 and BF23. Virology 219: 19–28. [Abstract] [Google Scholar]
- Mondigler M, Ayoub AT & Heller KJ (2006) The DNA region of phage BF23 encoding receptor binding protein and receptor blocking lipoprotein lacks homology to the corresponding region of closely related phage T5. J Basic Microbiol 46: 116–125. [Abstract] [Google Scholar]
- Pedruzzi I, Rosenbusch JP & Locher KP (1998) Inactivation in vitro of the Escherichia coli outer membrane protein FhuA by a phage T5-encoded lipoprotein. FEMS Microbiol Lett 168: 119–125. [Abstract] [Google Scholar]
- Rabsch W, Ma L, Wiley G et al. (2007) FepA- and TonB-dependent bacteriophage H8: receptor binding and genomic sequence. J Bacteriol 189: 5658–5674. [Europe PMC free article] [Abstract] [Google Scholar]
- Rhoades M & Rhoades EA (1972) Terminal repetition in the DNA of bacteriophage T5. J Mol Biol 69: 187–200. [Abstract] [Google Scholar]
- Rogers SG & Rhoades M (1976) Bacteriophage T5-induced endonucleases that introduce site-specific single-chain interruptions in duplex DNA. P Natl Acad Sci USA 73: 1576–1580. [Europe PMC free article] [Abstract] [Google Scholar]
- Saigo K (1978) Isolation of high-density mutants and identification of nonessential structural proteins in bacteriophage T5; dispensability of L-shaped tail fibers and a secondary major head protein. Virology 85: 422–433. [Abstract] [Google Scholar]
- Sambrook DW (2001) Molecular Cloning: A Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
- Shi J & Biek DP (1995) A versatile low-copy-number cloning vector derived from plasmid F. Gene 164: 55–58. [Abstract] [Google Scholar]
- Shlyapnikov MG, Ksenzenko VN, Kryukov VM & Bayev AA (1995) Specific properties of phage T5-encoded tRNAs. Mol Biol 28: 818–823. [Google Scholar]
- Sigrist CJ, Cerutti L, Hulo N, Gattiker L, Pagni M, Bairoch A & Bucher P (2002) PROSITE: a documented database using patterns and profiles as motif descriptors. Brief Bioinform 3: 265–274. [Abstract] [Google Scholar]
- Wang J, Jiang Y, Vincent M, Sun Y, Yu H, Wang J, Bao Q, Kong H & Hu S (2005) Complete genome sequence of bacteriophage T5. Virology 332: 45–65. [Abstract] [Google Scholar]
- Warner HR, Drong RF & Berget SM (1975) Early events after infection of Escherichia coli by bacteriophage T5. Induction of a 5’-nucleotidase activity and excretion of free bases. J Virol 15: 273–280. [Europe PMC free article] [Abstract] [Google Scholar]
- Wiest JS & McCorquodale JD (1990) Characterization of preearly genes in the terminal repetition of bacteriophage BF23 DNA by nucleotide sequencing and restriction mapping. Virology 177: 745–754. [Abstract] [Google Scholar]
- Zweig M, Rosenkranz HS & Morgan C (1972) Development of coliphage T5: ultrastructural and biochemical studies. J Virol 9: 526–543. [Europe PMC free article] [Abstract] [Google Scholar]
Full text links
Read article at publisher's site: https://doi.org/10.1111/j.1574-6968.2008.01397.x
Read article for free, from open access legal sources, via Unpaywall:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9021807
Citations & impact
Impact metrics
Citations of article over time
Alternative metrics
Discover the attention surrounding your research
https://www.altmetric.com/details/99042583
Smart citations by scite.ai
Explore citation contexts and check if this article has been
supported or disputed.
https://scite.ai/reports/10.1111/j.1574-6968.2008.01397.x
Article citations
Bacteriophage specificity is impacted by interactions between bacteria.
mSystems, 9(3):e0117723, 20 Feb 2024
Cited by: 0 articles | PMID: 38376179 | PMCID: PMC11237722
Phage-driven coevolution reveals trade-off between antibiotic and phage resistance in Salmonella anatum.
ISME Commun, 4(1):ycae039, 01 Jan 2024
Cited by: 0 articles | PMID: 38616926 | PMCID: PMC11014889
T5-like phage BF23 evades host-mediated DNA restriction and methylation.
Microlife, 4:uqad044, 26 Oct 2023
Cited by: 0 articles | PMID: 38025991 | PMCID: PMC10644984
Characterization of a Diverse Collection of Salmonella Phages Isolated from Tennessee Wastewater.
Phage (New Rochelle), 4(2):90-98, 19 Jun 2023
Cited by: 1 article | PMID: 37350991 | PMCID: PMC10282790
Complete genome sequencing of a Tequintavirus bacteriophage with a broad host range against Salmonella Abortus equi isolates from donkeys.
Front Microbiol, 13:938616, 16 Aug 2022
Cited by: 5 articles | PMID: 36051756 | PMCID: PMC9424859
Go to all (35) article citations
Data
Data behind the article
This data has been text mined from the article, or deposited into data resources.
BioStudies: supplemental material and supporting data
Nucleotide Sequences
- (3 citations) ENA - CP000917
Similar Articles
To arrive at the top five similar articles we use a word-weighted algorithm to compare words from the Title and Abstract of each citation.
FepA- and TonB-dependent bacteriophage H8: receptor binding and genomic sequence.
J Bacteriol, 189(15):5658-5674, 25 May 2007
Cited by: 47 articles | PMID: 17526714 | PMCID: PMC1951831
The DNA region of phage BF23 encoding receptor binding protein and receptor blocking lipoprotein lacks homology to the corresponding region of closely related phage T5.
J Basic Microbiol, 46(2):116-125, 01 Jan 2006
Cited by: 10 articles | PMID: 16598825
Identification of a new site for ferrichrome transport by comparison of the FhuA proteins of Escherichia coli, Salmonella paratyphi B, Salmonella typhimurium, and Pantoea agglomerans.
J Bacteriol, 180(15):3845-3852, 01 Aug 1998
Cited by: 15 articles | PMID: 9683481 | PMCID: PMC107368
Characterization of a T5-like coliphage, SPC35, and differential development of resistance to SPC35 in Salmonella enterica serovar typhimurium and Escherichia coli.
Appl Environ Microbiol, 77(6):2042-2050, 21 Jan 2011
Cited by: 66 articles | PMID: 21257810 | PMCID: PMC3067339
[Escherichia coli phage receptors. Minor porins and proteins participating in the specific transport as phage receptors].
Mol Gen Mikrobiol Virusol, (12):3-12, 01 Dec 1989
Cited by: 1 article | PMID: 2561376
Review
Funding
Funders who supported this work.
Intramural NIH HHS (1)
Grant ID: Z01 BC010017
