Documentos de Académico
Documentos de Profesional
Documentos de Cultura
Tesis Productos Fermentados
Tesis Productos Fermentados
ADVERTIMENT. La consulta d’aquesta tesi queda condicionada
a l’acceptació de les següents condicions d'ús: La difusió
d’aquesta tesi per mitjà del servei TDX (www.tdx.cat) i a través
del Dipòsit Digital de la UB (diposit.ub.edu) ha estat
autoritzada pels titulars dels drets de propietat intel·lectual únicament per a usos privats emmarcats en activitats
d’investigació i docència. No s’autoritza la seva reproducció amb
finalitats de lucre ni la seva difusió i posada a disposició
des d’un lloc aliè al servei TDX ni al Dipòsit Digital de la UB. No s’autoritza la presentació del seu contingut en una finestra
o marc aliè a TDX o al Dipòsit Digital de la UB (framing). Aquesta reserva de drets afecta tant al resum de presentació de
la tesi com als seus continguts. En la utilització o cita de parts de la tesi és obligat indicar el nom de la persona autora.
ADVERTENCIA. La consulta de esta tesis queda condicionada a la aceptación de las siguientes condiciones de uso: La
difusión de esta tesis por medio del servicio TDR (www.tdx.cat) y a través del Repositorio Digital de la UB
(diposit.ub.edu) ha sido autorizada por los titulares de los derechos de propiedad intelectual únicamente para usos
privados enmarcados en actividades de investigación y docencia. No se autoriza su reproducción con finalidades de lucro
ni su difusión y puesta a disposición desde un sitio ajeno al servicio TDR o al Repositorio Digital de la UB. No se autoriza
la presentación de su contenido en una ventana o marco ajeno a TDR o al Repositorio Digital de la UB (framing). Esta
reserva de derechos afecta tanto al resumen de presentación de la tesis como a sus contenidos. En la utilización o cita de
partes de la tesis es obligado indicar el nombre de la persona autora.
WARNING. On having consulted this thesis you’re accepting the following use conditions: Spreading this thesis by the
TDX (www.tdx.cat) service and by the UB Digital Repository (diposit.ub.edu) has been authorized by the titular of the
intellectual property rights only for private uses placed in investigation and teaching activities. Reproduction with lucrative
aims is not authorized nor its spreading and availability from a site foreign to the TDX service or to the UB Digital
Repository. Introducing its content in a window or frame foreign to the TDX service or to the UB Digital Repository is not
authorized (framing). Those rights affect to the presentation summary of the thesis as well as to its contents. In the using or
citation of parts of the thesis it’s obliged to indicate the name of the author.
UNIVERSITAD DE BARCELONA
FACULTAD DE FARMÁCIA
2010
UNIVERSITAD DE BARCELONA
FACULTAD DE FARMÁCIA
DEPARTAMENTO DE NUTRICIÓNY BROMATOLOGÍA
Dirección:
Dra. M. Carmen Vidal Carou Dra. Sara Bover i Cid
Doctoranda:
INTRODUCCIÓN ......................................................................................................................................... 1
INTRODUCCIÓN ...........................................................................................................3
1 ...............................................................................................................................7
OBJETIVOS .............................................................................................................................................. 53
MUESTRAS ............................................................................................................. 61
4.1 Muestras y muestreo ......................................................................................................... 61
i
ÍNDICE
ii
ÍNDICE
13 ........................................................................................................................ 299
iii
INTRODUCCIÓN
INTRODUCCIÓN
1
INTRODUCCIÓN
Introducción
Las aminas biógenas son unos microcomponentes de los alimentos para las que
no se ha demostrado ningún efecto favorable sobre los productos alimenticios.
Además de indicar una pérdida de la calidad higiénica del producto, se asocian a
posibles riesgos en consumidores sensibles. En consecuencia, muchos productores de
alimentos se enfrentan al reto de producir alimentos con un bajo contenido de aminas,
optimizando la calidad del producto final y minimizando los riesgos para la salud.
3
INTRODUCCIÓN
4
REVISIÓN BIBLIOGRÁFICA
REVISIÓN BIBLIOGRÁFICA
5
REVISIÓN BIBLIOGRÁFICA
1
PRODUCTOS CÁRNICOS CRUDOS-CURADOS
FERMENTADOS
7
PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
8
REVISIÓN BIBLIOGRÁFICA
En los embutidos fermentados, las bacterias del ácido láctico, con recuentos
finales de 107-109 ufc/g, convierten los azúcares en ácido láctico, de manera que se
produce una disminución del pH. Esta acidificación favorece la selección de la propia
microbiota fermentativa, inhibiendo a su vez el desarrollo de microorganismos
causantes de alteraciones y de patógenos. La disminución del pH también produce la
desnaturalización de las proteínas, permitiendo la coagulación proteica y,
consecuentemente, la aparición de la cohesión y la textura características de estos
productos. Por otro lado, la desnaturalización proteica provoca una pérdida de la
capacidad de retención de agua por parte de las proteínas cárnicas, hecho que
favorece el proceso de secado del producto sometido a maduración.
9
PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
Especias y Nitritos y
condimentos nitratos
Inhibición
Patógenos
NO2 Lipolisis Proteólis Patógenos
is Cohesión y
desnaturalización
de proteínas
NO Ácidos Amino
Grasos ácidos
Desecación
Nitrosomioglobina
(Mb +NO)
10
REVISIÓN BIBLIOGRÁFICA
11
PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
12
REVISIÓN BIBLIOGRÁFICA
Proteínas
proteasas
Oligopéptidos
peptidasas
Péptidos
peptidasas
AMINOÁCIDOS
13
PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
14
REVISIÓN BIBLIOGRÁFICA
15
PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
organolépticas que deseamos transmitir a la nueva partida (Geisen y col., 1992) o (iii)
emplear carnes presaladas o saladas, en las que se ha desarrollado un microbiota
láctica homofermentativa (Rovira y col., 1994).
Sin embargo, las normas de calidad e higiene definidas para las grades
industrias de procesado no siempre son compatibles con las habitualmente pequeñas
plantas de elaboración de embutidos artesanales, que necesitarían un tratamiento
más individualizado. Es fundamental por lo tanto, proporcionar a los productores
artesanales los medios para obtener productos seguros, asegurando también la
supervivencia de las economías locales y sus efectos positivos sobre el empleo. Por
este motivo parece de gran importancia el estudio de las comunidades microbianas
naturales con interés tecnológico, a fin de obtener cultivos iniciadores específicos que
sean capaces de producir embutidos de tipo artesanal con una óptima calidad
higiénico-sanitaria (con mejores garantías que los procedimientos naturales) pero
respetando las cualidades organolépticas y sensoriales de la región de origen. De esta
manera, se superaría el inconveniente de la obtención de productos “globalizados” y/o
estandarizados por el uso de cultivos iniciadores comerciales utilizados en la
elaboración industrial de embutidos fermentados.
16
REVISIÓN BIBLIOGRÁFICA
2
AMINAS BIÓGENAS EN PRODUCTOS
CÁRNICOSCRUDOS-CURADOS
FERMENTADOS
17
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
NH2
NH2
N
NH2 H H
N NH2
FENILETILAMINA TRIPTAMINA
HO N
NH2
H2 N
O O O
NH2
NH2 NH2
HN NH O lisina
glutamina
NH2
arginina
HN NH
NH2 1.3. CDA
H2N
NH2
1.4. AG AGMATINA
PUTRESCINA
1.5. PUT
NH2 NH NH2
POLIAMINAS H2N NH H2N NH
Espermidina
NATURALES
1.2. ESP
ESPERMIDINA 1.1. ESP ESPERMINA
18
REVISIÓN BIBLIOGRÁFICA
matriz de las materias primas y por los diferentes tipos de procesado a los que se los
somete (Mariné-Font y col., 1995). Así, podemos clasificar los alimentos como:
19
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
El origen del estudio de las aminas biógenas se remonta a mediados del siglo XIX.
En 1846 Liebig describe por primera vez la presencia de una amina en un alimento a la
que llamó precisamente amina del queso o tiramina, (TYROS significa “queso” en
griego). Sin embargo hasta 1919 no aparecen los primeros estudios de Koessler y
Hanke sobre producción de aminas (histamina) por microorganismos intestinales
(Bacillus coli, más tarde Escherichia coli). Es ya desde este momento que se reconoce
que las aminas biógenas son metabolitos de origen microbiano resultantes de la
descarboxilación de aminoácidos precursores. Es también en esta época que se
evidencia que los enzimas responsables de esta reacción son más o menos específicos
del sustrato y que no siempre están presentes en todos los microorganismos. Tanto es
así, que en los años 50 se describió la capacidad de formar ciertas aminas biógenas
como uno de los criterios taxonómicos a tener en cuenta para la identificación de
enterobacterias. Aunque los estudios microbiológicos no cesaron, no fue hasta la
década de los 50, que aparecieron los primeros trabajos en los que se tratan las
aminas biógenas como componentes de los alimentos, como por ejemplo, Tarantola
(1954) que describe la presencia de histamina en vino. A partir de los años 60,
precisamente en relación con los alimentos, resurgió el interés del estudio de las
aminas biógenas a raíz de las crisis hipertensivas graves (algunas mortales) causadas
por la interacción entre alimentos ricos en aminas (concretamente tiramina en queso)
y los medicamentos inhibidores de la enzima mono-aminooxidasa (IMAOs), que
inhiben los enzimas responsables de la destoxificación de las aminas en el organismo
(Blackwell, 1963). Desde entonces, las aminas biógenas se han considerado unos
microcomponentes de los alimentos indeseables, por su potencial efecto negativo
sobre la salud del consumidor y, por lo tanto, se han enmarcado en el ámbito de la
seguridad alimentaria (Shalaby, 1990; Mariné-Font y col., 1995).
20
REVISIÓN BIBLIOGRÁFICA
Por otra parte, las aminas biógenas son también relevantes desde los puntos de
vista higiénico y tecnológico (Brink y col. 1990; Mariné-Font y col. 1995; Izquierdo-
Pulido y col. 1999). Varias aminas biógenas (principalmente las diaminas, putrescina y
cadaverina, y la histamina) pueden formarse como consecuencia de la actividad de
ciertas bacterias contaminantes (enterobacterias y pseudomonas), por lo que estos
compuestos pueden ser útiles como indicadores químicos de unas condiciones
higiénicas defectuosas de las materias primas y/o de los procesos de elaboración.
También como metabolitos microbianos, algunas aminas biógenas (principalmente
tiramina), se han relacionado con la fermentación de la leche y la carne, por lo que en
algunas ocasiones se ha considerado que la aparición de tiramina es inherente al
proceso de fabricación de los productos cárnicos fermentados. Sin embargo, se ha
demostrado que los alimentos fermentados pueden mostrar también contenidos bajos
de esta amina en particular, y de otras aminas biógenas en general. Por lo tanto, es
importante determinar los niveles de aminas biógenas (como la suma de aminas o de
una en particular), que podrían considerarse como normales y/o inevitables, y, por
tanto, establecer un valor umbral que pueda indicar unas prácticas higiénicas
inadecuadas.
21
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
22
REVISIÓN BIBLIOGRÁFICA
23
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
24
REVISIÓN BIBLIOGRÁFICA
La Tabla 2.2 recoge algunos de los trabajos que describen las dosis necesarias
de aminas para desencadenar crisis hipertensivas, migrañas o intoxicaciones
histamínicas. La toxicidad derivada del efecto vasoconstrictor de la tiramina está
documentada sobre todo en estudios clínicos sobre la interacción entre la tiramina
procedente de la dieta y los medicamentos IMAO. Estos estudios demuestran que las
barreras intestinales para la tiramina en voluntarios sanos no medicados (grupo
placebo) son bastante eficaces, ya que son necesarios entre 200 mg y 2000 mg de
tiramina para provocar una mínima respuesta en la presión arterial.
25
Tabla 2.1. Identificación del peligro
26
Tasa media anual (casos/año/millón de
personas) de intoxicaciones histamínicas por
consumo de pescado: 31 en Hawái, USA; 4.9
en Dinamarca; 3.1 en Nueva Zelanda; 2.5 en La información disponible es limitada
Brotes Francia; 2.1 en Finlandia; 1.5 en Taiwán; 1.1 debido a la falta de datos --
en Japón; <1 en Reino Unido, Noruega, epidemiológicos
Suiza, Sudáfrica, Australia, USA, Suecia,
Canadá, Holanda, Filipinas (Dalgaard et al.,
2008)
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
REVISIÓN BIBLIOGRÁFICA
27
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
oral de la histamina (Tabla 2.2), en general reflejan "la opinión de expertos", ya que los
estudios clínicos en los que se sustentan no son del todo adecuados (Raucher y
Gabering, 2009), ya que no es fácil reproducir la intoxicación histamínica en estudios
clínicos. Los resultados de los pocos estudios toxicológicos existentes, generalmente
realizados con un número reducido de personas, se encuentran también resumidos en
la Tabla 2.2.
28
Tabla2.2. Caracterización del riesgo.
Relación dosis- respuesta Población afectada Referencias
(límite tóxico)
HISTAMINA
Intoxicación 5 - 6 mg umbral tóxico Raucher y Gaberning 2009 citado en Henry
histamínica 8 – 40 mg intoxicación leve (1960) y Peeters (1963)
(histaminosis 70 – 1000 mg intoxicación moderada
1500 – 4000 intoxicación severa Población en general;
enteral)
8 – 40 mg intoxicación leve Shalaby (1996), citado en el libro de Askar
> 40 mg intoxicación moderada Individuos sensibles-deficientes en DAO y Treptow (1986)
> 100 mg intoxicación severa (Sattler et al.,1988)
8-40 mg intoxicación leve Ienistea (1973), citado en Henry (1960) y
70-1000 mg intoxicación moderada Peeters (1963)
1500-4000 mg intoxicación severa
100-180 mg en una comida 25% -50% de los voluntarios estudiados Motil y Scrimshaw (1979)
50% de los voluntarios estudiados (mujeres Wohrl y col., (2004)
75 mg histamina pura (en té de
sanas sin historial de intolerancias
menta)
alimentarias)
90 mg en una comida 25% de los voluntarios estudiados Van Gelderen y col., (1992)
29
120 mg (administración 70% de lo pacientes con urticaria (voluntarios Kanny y col., (1996)
intraduodenal) susceptibles)
TIRAMINA
(β
β -FENILETILAMINA)
Crisis hipertensivas 200 mg – 2000 mg TI Korn y col., (1988); Berlin y col., (1989);
Población sana (100%) (50%)
(ED50 ≈ 1400 mg) Patat (1995); Dingemanse y col., (1998)
c
PD30a 6 mg síntomas leves IMAO clásicos McCabe (1986);
dosis de TI causante 10-25 mg síntomas severos
de un incremento de RIMA Korn y col., (1988); Bieck y Antonin (1988,
30 mmHg en la PS 50 – 100 mg tolerados (pacientes bajo tratamiento con 3rd 89); Patat y col., (1995);Van der Berg
generación de IMAO: reversible / selectivo) (2003)
Migrañab 80% migrañosos Haningtong (1967-1980)
100 mg TI
(0-15% no -migrañosos)
3 mg FE 50% migrañosos Sandler y col., (1974)
5 mg FE Síntomas de intoxicación Lüthy y Schlatter (1983)
a
Incremento de la presión sanguínea sistólica de 30 mmHg por una dosis de tiramina dada. Sólo se han considerad estudios clínicos
b
realizados con voluntarios sanos en los que la tiramina se administró oralmente mediante una comida. La literatura científica (des de 1967-
c
2001) apenas es capaz de demostrar la relación entre tiramina y migraña (Jansen et al. 2003). medicamentos IMAO: Tranylcypromina 20-
REVISIÓN BIBLIOGRÁFICA
56; Clorgylina10; Brofaromina 10; Phenelzina 13; Moclobemida 5-7; Befloxatona 5-8; Selegilina 2-5.
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
30
Tabla 2.3. Datos publicados en relación a los contenidos de aminas biógenas (mg/kg peso fresco) en embutidos
fermentados del mercado de diferentes países.
País de Referencia Producto n TIRAMINA HISTAMINA FENILETILAMINA TRIPTAMINA CADAVERINA PUTRESCINA ESPERMIDINA ESPERMINA
origen
a
ESPAÑA Vidal-Carou 176 ± 149 76 ± 80 c
Chorizo 11 - - - - - -
y col. (1990) (2 – 509)b (2 – 249)
133 ± 62 18 ± 27
Salchichón 19 - - - - - -
(35 – 270) (1 – 103)
6±3
66 ± 39
Salami 5 (3 - - - - - - -
(2 – 102)
12)
8±6 55 ± 36
Sobrasada 3 - - - - - -
(3 – 14) (14 – 78)
Hernandez-
282 ± 129 18 ± 27 1±3 16 ± 20 20 ± 16 60 ± 141 4± 3 26 ± 8
Jover y col. Chorizo 20
(30 - 627) (0 - 314) (0 - 52) (0 - 88) (0 - 658) (3 - 416) (2 - 10) (14 - 44)
(1997a)
281 ± 109 7 ± 14 7± 6 9 ± 11 12 ± 23 103 ± 76 5± 3 15 ± 8
Salchichón 22
(53 - 513) (0 - 151) (0 - 35) (0 - 65) (0 - 342) (6 - 400) (1 - 14) (7 - 43)
31
191 ± 73 2 ± 40 2± 4 9 ±8 19 ± 18 72 ± 41 5± 3 17 ± 7
Fuet 11
(32 - 743) (0 - 358) (0 - 34) (0 - 68) (5 - 51) (2 - 222) (1 - 11) (9 - 30)
332 ± 131 9 ± 17 2 ±6 12 ± 23 13 ± 14 65 ± 50 3±2 14 ± 7
Sobrasada 7
(58 - 501) (3 - 143) (0 - 39) (0 - 65) (3 - 42) (2 - 501) (2 - 7) (10 - 18)
14 ± 20 12 ± 28 15 ± 33 18 ± 30 99 ± 96 4±3 25 ± 13
Salchichón 19 141 ± 124
(0 – 59) (0 – 126) (0 – 142) (0 – 127) (0 - 325) (1 – 13) (7 – 52)
(3 – 490)
Ruiz-
129 ± 100 6±9 103 ± 113 92 ± 92 8±1 46 ± 11
Capillas Chorizo 3 nd nd
(19 – 214) (1 – 16) (9 – 229) (0.8 – 185) (7 – 8) (39 – 59)
y col. (2004)
a b c
REVISIÓN BIBLIOGRÁFICA
:: media ± desviación estándar (si está disponible); : rango (mínimo - máximo); : -, no publicado
Tabla 2.3 (CONTINUACIÓN)
País de Referencia Producto n TIRAMINA HISTAMINA FENILETILAMINA TRIPTAMINA CADAVERINA PUTRESCINA ESPERMIDINA ESPERMINA
origen
FRANCIA 220
Montel y col. Saucisson 71 4 4 103 279 5 91
5 (172 -
(1999) (industrial) (16 - 151) (0 - 8) (0 - 9) (31 - 192) (195 - 410) (4 - 6) (59 - 119)
268)
Saucisson 164 15 1 71 223 4 84
3 nd
(traditional) (84 - 217) (15 - 16) (0 - 4) (39 - 110) (61- 317) (2 - 6) (82 - 86)
ITALIA Parente y col., 178 22 3 61 99 40 36
Soppressata 9 -
(2001) (0 - 557) (0 - 101) (0 - 20) (0 - 271) (0 - 416) (0 - 91) (0 - 98)
77 7 20 19 3
Salsiccia 10 nd nd -
(0 - 339) (0 - 39) (0 - 78) (0 - 57) (0 - 28)
Coisson y col.
Salamini 205 ± 105 14 ± 20 20 ± 25
(2004) 10 46 ± 54 - - - -
Italiani (60 - 372) (nd - 53) (nd - 69)
(8 - 165)
FINLANDIA Eerola y col. (1998) Finnish 88 54 13 14 50 79 4 31
11
sausage (4 - 200) (0 - 180) (2 -248) (0 - 43) (0 - 270) (0 - 230) (2 - 7) (19 - 46)
32
Russian 110 89 11 22 10 93 5 33
4
sausage (6 - 240) (0 - 200) (1 - 33) (0 - 43) (3 - 18) (3 - 310) (2 - 8) (23 - 40)
Danish 54 9 2 27 180 130 7 37
8
sausage (5 - 110) (1 - 56) (0 - 4) (0 - 91) (0 - 790) (0 - 450) (3 - 9) (23 - 47)
72 21 3 18 6 77 6 29
Meatwurst 12
(5 - 320) (0 - 170) ( 0 - 5) (0 - 54) (0 - 16) (2 - 580) (3 - 11) (22 - 38)
73 6 4 10 3 49 5 33
Lubeck 9
(9 – 150) (0 - 40) (0 – 7) (0 – 20) (0 – 8) (0- 220) (3 – 7) (20 – 40)
93 3 5 20 14 54 5 30
Salami 13
(3 – 200) (0 – 9) (0 – 8) (0 – 51) (0 – 71) (0 – 210) (1 – 8) (19 – 45)
94 21 6 18 82 61 6 33
Pepperoni 11
(5 – 190) (0 – 200) (0 – 48) (0 – 42) (0 – 390) (0 – 230) (3 – 11) (21 – 48)
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
Tabla 2.3. (CONTINUACIÓN)
País de Referencia Producto n TIRAMINA HISTAMINA FENILETILAMINA TRIPTAMINA CADAVERINA PUTRESCINA ESPERMIDINA ESPERMINA
origen
ALEMANIA
110 11 14 63 52
Brink y col. (1990) 14 - - -
(40 - 310) (1 - 63) (5 - 45) (1 - 150) (1 - 190)
EGIPTO
Shalaby Egyptian 14 5 10 13 19 39 2 2
50
(1993) sausages (10 - 53) (7 - 41) (2 - 81) (3 - 34) (6 -39) (12 - 100) (5 - 12) (2 - 5)
TAILANDIA
Riebroy y col. 87 ± 72 120 ± 82 49 ± 25 161 ± 111 127 ± 90
Som-fug 7 - - -
(2004) (19 – 228) (55 – 291) (19 – 86) (20 – 328) (17 – 275)
TURQUIA Turkish
Ekici y col. 32 ± 17
dry 46 - - - - - - -
(2004) (20 - 87)
sausage
33
Sucuk - 62 ± 69 69 ± 83 9 ± 20 11 ± 14 75 ± 123 13 ± 14
Erkmen y col. (2004) 19 - -
factory (1 – 189) (4 -255) (0 – 87) (0 -47) (0 – 383) (0 – 50)
34
REVISIÓN BIBLIOGRÁFICA
A la vista de los datos de la exposición al riesgo del estudio realizado por Bover-
Cid y col., (2006), la probabilidad de sufrir trastornos de salud debida a las aminas y
potencialmente asociados al consumo de productos cárnicos fermentados, se detallan
a continuación:
35
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
En vista de todos estos datos y desde el punto de vista de las aminas biógenas,
los productos cárnicos fermentados podrían ser considerados, por lo general, como
productos seguros para las personas sanas. Sin embargo, hay que tener en cuenta que
otras potenciales fuentes de aminas biógenas en alimentos están bastante extendidas
en la dieta diaria. Además de los embutidos fermentados, muchos otros productos
alimenticios (como el queso, pescado o sus derivados, las bebidas fermentadas y
algunos vegetales) puede contener cantidades significativas de varias aminas biógenas
(Stratton y col., 1991; Mariné-Font y col., 1995; Shalaby, 1996). En consecuencia, la
exposición real al conjunto de aminas biógenas de una comida o el consumo diario de
alimentos sería mucho mayor que la contribución particular estimada para embutidos
fermentados. En este sentido, se encontraría justificada la recomendación médica para
los pacientes bajo tratamiento con fármacos IMAO, de reducir o incluso evitar el
consumo de embutidos fermentados y otros posibles productos ricos en aminas. Para
el caso particular de los medicamentos de nueva generación IMAO, la restricción
dietética puede ser menos estricta, pero también sería deseable evitar la ingesta de
tiramina (Prasad y col., 1988; Korn y col., 1996).
36
REVISIÓN BIBLIOGRÁFICA
37
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
38
REVISIÓN BIBLIOGRÁFICA
Tabla 2.5. Microorganismos, con una reconocida capacidad para producir una o
más aminas biógenas, asociados con la carne o los productos cárnicos.
Especies TI FE TR HI PU CA Referencias
Enterococcus faecalis + + 3, 11
Enterococcus faecium + + 11
Pediococcus pentosaceus + 9
Staphylococcus epidermidis + + + 7
Staphylococcus xylosus + 8
Staphylococcus warneri + 7
Citrobacter freundii + + 4
Escherichia coli + 14
Hafnia alvei + + + 12
Pseudomonas sp. + 12
Referencias: (1) Ansorena y col. (2002); (2) Aymerich y col. (2006); (3) Bover-Cid y col. (2001a); (4)
Durlu-Ózkaya y col. (2001); (5) Hammes y col. (1995); (6) Kranner y col. (1991); (7) Martín y col.
(2006); (8) Marstuscelli y col. (2000); (9) Masson y col. (1996); (10) Roig-Saués y col. (1996); (11)
Roig-Sagués y col. (1997); (12) Slerm (1981); (13) Straub y col. (1995); (14) Tscgabrun y col. (1990).
39
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
40
REVISIÓN BIBLIOGRÁFICA
Estas variables ejercen influencias sobre uno o más fenómenos asociados con el
proceso de aminogénesis, incluyendo el crecimiento y la interacción entre las
comunidades microbianas, la acidificación, la proteólisis y la producción y actividad de
la enzima descarboxilasa, por lo que los efectos particulares son difíciles de concretar.
En algunas ocasiones incluso se pueden dar efectos aparentemente paradójicos. Este
sería el caso, por ejemplo, del pH, que se ha descrito como un factor regulador de la
aminogénesis ya que la actividad aminoácido descarboxilasa funciona como un sistema
fisiológico de las bacterias para intentar neutralizar un ambiente ácido desfavorable.
De hecho, la máxima acumulación de tiramina durante la fermentación de los
embutidos suele producirse cuando el pH alcanza los valores más bajos (Santos-Buelga
y col., 1986; Bunic y col., 1993; Bover-Cid y col., 2001).
41
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
42
REVISIÓN BIBLIOGRÁFICA
43
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
44
REVISIÓN BIBLIOGRÁFICA
45
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
46
Tabla 2.6. Estudios sobre el efecto de diferentes tipos de cultivos iniciadores en la formación de aminas
biógenas durante la elaboración industrial de productos cárnicos fermentados.
47
REVISIÓN BIBLIOGRÁFICA
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
48
REVISIÓN BIBLIOGRÁFICA
procedimientos más utilizados para este fin (Straub y col., 1993; Hernández-Jover y
col., 1996; Draisci y col., 1998; Sacanni, 2005; Favaro y col., 2007). La detección de
estos compuestos suele ser mediante técnicas de fluorimetría (Straub y col., 1993;
Hernández-Jover y col., 1996; Taminm y col., 2002), absorción ultravioleta (Eerola y
col., 1993; Smela y col., 2004) o espectrometría de masas (Sacanni y col., 2005).
49
AMINAS BIÓGENAS EN PRODUCTOS CÁRNICOS CRUDOS CURADOS FERMENTADOS
50
REVISIÓN BIBLIOGRÁFICA
51
OBJETIVOS
OBJETIVOS
53
OBJETIVOS
3
PLANTEAMIENTO Y OBJETIVOS DEL ESTUDIO
55
OBJETIVOS
56
OBJETIVOS
57
MATERIAL Y MÉTODOS
MATERIAL Y MÉTODOS
59
MATERIAL Y MÉTODOS
4
MUESTRAS
61
MUESTRAS
Ingredientes y
aditivos
Cultivo iniciador
Troceado (starter)
picado
Dosificación
pesado
disolución
en agua
Amasado
Penicillium
nalgiovense
Embutido
implantación
del moho
FERMENTACIÓN (AHUMADO)
MADURACIÓN - SECADO
62
MATERIAL Y MÉTODOS
63
Capítulo Formulación Condiciones de Elaboración
/
Artículo Producto Nitrito/
Tipo carne NaCl Azúcar Cultivo
Nitrato Otros Presurización Ahumado Fermentación Curado
magro/grasa (g/kg) (g/kg) iniciador
(g/kg)
10-22 ºC 8-14 ºC
6/I Saucisson Cerdo 0-0,08/ Pimienta,
14-30 0-8 no no no 76-99 % HR 70-90 %HR
(Francia) 80 / 20 0-0,30 vino y ajo
2-8 días 31-82 días
2-24 ºC 10-18 ºC
Fuet Cerdo Pimienta y
6/I 13-23 0-0,5 0-33 no no no 49-94 % HR 58-85 %HR
(España) 75-90 /25-10 vino
<1-5 días 15-60 días
Salame 4-26 ºC 6-22 ºC
Cerdo Pimienta,
6/I abruzzese empírico empírico empírico no no no 70-84 % HR 58-83 %HR
50-90 /50-10 vino y ajo
(Italia) 1-10 días 15-90 días
2-21 ºC 2-21 ºC 2-21 ºC
Chouriço Cerdo Pimentón,
6/I empírico 0,6 no no no 50-90%HR 50-90 % HR 50-90 %HR
(Portugal) 60-90/40-10 vino y ajo
5-45 días 5-45 días 5-45 días
Pimienta,
Aeros Cerdo 18-20 ºC 12-24 ºC 12-17 ºC
pimentón
6/I thasou 50-90/50-10 20-30 0,15/0,2 0-3 no no 85-89%HR 93-80 % HR 76-78 %HR
dulce y
(Grecia) 2 días 1-7 días 14-60 días
picante
Embutido Pimientón >26 ºC 15-16 ºC 15-25 ºC
Cerdo
6/I Eslova- empírico - 0-6 picante y no no 30-95%HR 80 % HR 82-90 %HR
40-70/60-30
quia ajo empírico 5-12 días 12-21 días
Tabla 4.1. Características de los productos cárnicos fermentados utilizados en los diferentes estudios realizados en trabajo
64 de tesis.
MUESTRAS
Tabla 4.1. (CONTINUACIÓN)
Capítulo
Formulación Condiciones de Elaboración
/
Artículo Producto Nitrito/
Tipo carne NaCl Azúcar Cultivo
Nitrato Otros Presurización Ahumado Fermentación Curado
magro/grasa (g/kg) (g/kg) iniciador
(g/kg)
(a) 20-23 ºC (a)12-14 ºC
90-95 % HR 70 %HR
Fuet Cerdo L. curvatus 3 días 20 días
8 / V, VI 28 0,15 30 Pimienta no no
80/20 CTC273 (b) 12-13 ºC (b) 12-13 ºC
70-90 % HR 70-90 %HR
23 días 23 días
(a) 20-23 ºC (a)12-14 ºC
90-95 %HR 70 %HR
Salchichón Cerdo L. curvatus 3 días 20 días
8 / V, VI 28 0,15 30 Pimienta no no
80/20 CTC273 (b)12-13 ºC (b) 12-13 ºC
65
Capítulo
Formulación Condiciones de Elaboración
/
Artículo Producto Nitrito/
Tipo carne NaCl Azúcar
Nitrato Otros Cultivo iniciador Presurización Ahumado Fermentación Curado
magro/grasa (g/kg) (g/kg)
(g/kg)
L. sakei F08F202+
S. equorum 20 ºC 12 ºC
Saucisson Cerdo 0-0,08/ Pimienta,
9/VIII, IX 14-30 5 F08bF15 + no no 90 %HR 80 %HR
(Francia) 80 / 20 0-0,30 vino y ajo
S. succinus 2 días 52 días
F08bF19
L. sakei CTC6626
+
S. xylosus
CTC6013 2-24 ºC 10-18 ºC
Fuet Cerdo Pimienta
9/VII 13-23 0-0,5 0-33 no no 49-94 %HR 58-85 %HR
(España) 75-90 /25-10 y vino L. sakei
66
Pimienta,
18-20 ºC
Aeros Cerdo Pimentón 12-24 ºC 12-17 ºC
85-89
9/VII thasou 50-90/50-10 20-30 0,15/0,2 0-3 y L. sakei no 93-80 %HR 76-78 %HR
%HR
(Grecia) Satureja 1-7 días 14-60 días
2 días
thymbra
MUESTRAS
MATERIAL Y MÉTODOS
5
METODOLOGÍA ANALÍTICA
67
METODOLOGÍA ANALÍTICA
68
MATERIAL Y MÉTODOS
1200.00 A
CAD
1000.00
mV
PUT
AGM
FENIL
800.00
OCT
ESPD
HIST
TRIP
600.00 DOP
TIR
ESPM
400.00
SER
200.00
0.00
0.00 5.00 10.00 15.00 20.00 25.00 30.00 35.00 40.00 45.00 50.00 55 .00 60.00
Minutes
1200.00
CAD
CAD
B
C
1000.00 B
C
mV
800.00
ESPM ESP M
600.00
ESPD
TIR
TIR
400.00
ESPD
PUT
PUT
200.00
0.00
0.00 5.00 10 .0 0 15.00 20.00 25.00 30.00 35.00 40.00 45.00 50.00 55 .00 60.00
Minutes
69
METODOLOGÍA ANALÍTICA
70
MATERIAL Y MÉTODOS
0,0 80 20 -
33,0 50 50 10
elución
44,0 40 60 9
48,0 20 80 4
Retorno y 50,0 80 20 6
equilibrio 53,0 80 20 11
a
: curvas que describen el perfil de la modificación de la composición de la fase móvil en el
intervalo de tiempo especificado. De 1 a 5 son curvas logaritmicas, la 6 es una recta de
pendiente 1, mientras que de la 7 a la 11 son curvas exponenciales cada vez más
pronunciadas.
71
METODOLOGÍA ANALÍTICA
CHO S R'
+ R' SH + NH2 R
N R
CHO
TIOL AMINA
OPA
5.3.3 Cuantificación
72
MATERIAL Y MÉTODOS
de alguna amina, por encima de la concentración más alta utilizada para calcular la
recta, se procedió a una nueva extracción partiendo de menor cantidad de muestra o
utilizando volúmenes de ácido perclórico superiores para que la concentración final
quedara dentro del intervalo de la recta de trabajo.
5.4.1 Valores de pH
73
METODOLOGÍA ANALÍTICA
Pi − Pf
Agua (%) = × 100
Pi − T
donde T:peso (g) del pesafiltro seco (tara); Pi: Peso (g) del pesafiltro con la
muestra fresca (peso inicial); Pf: peso (g) del pesafiltro con la muestra desecada (peso
final).
74
MATERIAL Y MÉTODOS
V × N × 1,4
(a) Nt (%) =
P
(b) N t (% V × N × 140
peso seco ) =
P × (100 − A )
75
METODOLOGÍA ANALÍTICA
NNP
IP (% ) = × 100
Nt
76
MATERIAL Y MÉTODOS
Donde V: volumen (mL) de hidróxido sódico gastado para valorar el extracto; Vbl:
volumen (mL) de hidróxido sódico gastado para valorar el blanco; N: normalidad
exacta de la solución de hidróxido sódico valorada; Vd: volumen (mL) de extracto
utilizado; Ve: volumen (mL) final del extracto perclórico de la muestra; P: peso (g) de la
muestra extraída; A: contenido acuoso (%) de la muestra.
77
METODOLOGÍA ANALÍTICA
1
El análisis microbiológico de los capítulos 6 y 9 lo llevaron a cabo los diferentes grupos
de investigación participantes en el proyecto europeo.
78
MATERIAL Y MÉTODOS
Se realizó la siembra de más de una dilución decimal, de tal forma que al menos
una proporcionase entre 30 y 300 colonias, a partir de la cual se llevó a cabo el
recuento. En el caso de las placas sembradas en espiral, el recuento se realizó
automáticamente con el sistema contador de colonias Protos (AES-Laboratorie®). Los
resultados se expresaron en log10 (ufc/g), y para su cálculo, a partir del número de
colonias, se tuvieron en cuenta la dilución y la cantidad de inóculo sembrado en cada
caso.
79
METODOLOGÍA ANALÍTICA
80
MATERIAL Y MÉTODOS
Condiciones
Familia microbiana Medio de Cultivo
(Temperatura/Tiempo/ Oxígeno)
Bacterias del ácido láctico 30ºC / 48-72 h/ aeróbico
Man-Rogosa-Sharpe (MRS)
Cocos Gram positivos Manitol Salt Agar (MSA) 30ºC / 48 h/ aeróbico
catalasa positivos (CGC+)
M-enterococcus (ME) 37ºC / 48 h/ aeróbico
Enterococos
Kanamicina Esculina Azida 37ºC / 24 h/ aeróbico
(KAA)
Enterobacterias Agar Bilis Rojo Violeta con 37ºC / 24 h/ aeróbico
glucosa (VRBG)
Cetrimide-Fucidin-
Pseudomonas 25ºC / 48 h/ aeróbico
Cephaloridine Agar
suplementado con SR 103E
Extracto de levadura,
Levaduras y mohos 25ºC / 48 h/ aeróbico
Glucosa, Cloramfenicol
(YGC)
El análisis estadístico de los datos se realizó con el software SPSS versión 11.0
(SPSS Inc). En primer lugar, se examinó la distribución de los valores de cada una de las
variables para cada grupo (o lote) a comparar. Previa comprobación de la normalidad
(prueba Shapiro-Wilks), la asimetría y la homogeneidad de las variancias (prueba de
Levene), se aplicaron los diferentes métodos de análisis estadístico (prueba t de
Student, análisis de la variancia, ANOVA, correlación de Pearson, análisis de
componentes principales (ACP) y análisis de conglomerados) que se detallan en cada
una de las publicaciones presentadas en este trabajo de tesis.
81
RESULTADOS
RESULTADOS Y DISCUSIÓN
83
RESULTADOS
6
AMINOGÉNESIS EN PRODUCTOS CÁRNICOS
CRUDOS-CURADOS FERMENTADOS
EUROPEOS DE ELABORACIÓN ARTESANAL
Este capítulo recoge dos trabajos que pretenden caracterizar, desde el punto
de vista de los contenidos en aminas biógenas, los embutidos crudos-curados
fermentados elaborados artesanalmente, originarios de diferentes regiones o países
europeos del área mediterránea y Eslovaquia. El primer trabajo estudia la evolución de
la acumulación de aminas durante el proceso de elaboración, es decir desde las
materias primas hasta el producto acabado. El segundo estudio se centra en la
evolución de estos compuestos durante el periodo de almacenamiento de dichos
productos.
85
RESULTADOS
Artículo I
M.L. Latorre-Moratalla, T. Veciana-Nogués, S. Bover-Cid, M. Garriga, T. Aymerich, E.
Zanardi, A. Ianieri, M.J. Fraqueza, L. Patarata, E.H. Drosinos, R. Talon, M.C. Vidal-Carou
(2008). Biogenic amines in traditional fermented sausages produced in selected European
countries. Food Chemistry, 107: 912-921.
Índice de impacto (JCR 2008): 2,696
Posición en el área “Food and Science Technology”: 9/107
87
AMINOGÉNESIS EN EMBUTIDOS FERMENTADOS DE ORIGEN ARTESANAL
6.1.3 Resultados
88
RESULTADOS
89
AMINOGÉNESIS EN EMBUTIDOS FERMENTADOS DE ORIGEN ARTESANAL
Grupo A (n=21) incluye los productos de muy bajo y bajo contenido total de
aminas (desde no detectadas hasta 150 mg/kg).
Grupo B (n= 19) incluye los productos con niveles moderados de aminas(des de
150 a 350 mg/kg), siendo la tiramira la amina principal.
Grupo C (n=12), incluye los productos con niveles moderados de aminas (des de
150 a 350 mg/kg) siendo la cadaverina la amina cuantitativamente más importante.
Grupo D (n=8) incluye los productos con contenidos altos de aminas totales
(desde 350 a 550 mg/kg)
90
RESULTADOS
Grupo E (n=6) incluye los productos con contenidos de aminas totales muy
altos (superiores a 550 mg/kg).
Así pues, des del punto de vista higiénico-tecnológico, más de la mitad de los
productos (61 %), incluidos en los grupos A y B, se clasificaron como satisfactorios y
aceptables, respectivamente. Sin embargo, un 39% de ellos se incluyeron en los grupos
C (debido a la relación de la cadaverina con la microbiota alterante), D y E (por sus
altos contenidos totales) y se consideraron de peor calidad higiénica que el resto.
91
RESULTADOS
Artículo I
M.L. Latorre-Moratalla, T. Veciana-Nogués, S. Bover-Cid, M. Garriga, T. Aymerich, E.
Zanardi, A. Ianieri, M.J. Fraqueza, L. Patarata, E.H. Drosinos, R. Talon, M.C. Vidal-
Carou (2008). Biogenic amines in traditional fermented sausages produced in
selected European countries. Food Chemistry, 107: 912-921.
Índice de impacto (JCR 2008): 2,696
Posición en el área Food and Science Technology: 9/107
93
Available online at www.sciencedirect.com
Food
Chemistry
Food Chemistry 107 (2008) 912–921
www.elsevier.com/locate/foodchem
Analytical Methods
Received 30 January 2007; received in revised form 11 July 2007; accepted 18 August 2007
Abstract
Aminogenesis in traditional fermented sausages produced in Europe was studied during manufacturing process taking into account
technological, physico-chemical and microbial factors. Tyramine was the major amine, followed by putrescine and cadaverine, although
the occurrence of di-amines was much more variable. By principal component analysis, relationships between aminogenesis and the
country of origin, physico-chemical parameters, processing conditions and microbial counts, were not found, probably due to the high
dispersion observed in those variables. Therefore, biogenic amines occurred irrespectively of physico-chemical changes and technological
conditions applied for sausage manufacture. By cluster analysis, five groups of fermented sausages were identified on the basis of their
quantitative and qualitative profile of total biogenic amine content. Group A included products from very low to low total amine content
(from not detected to 150 mg/kg); group B, products with moderate levels (from 150 to 350 mg/kg) tyramine being the major amine;
group C, also with moderate amine contents but cadaverine being the major amine; and groups D and E, comprising products with high
(from 350 to 550 mg/kg) and very high (higher than 550 mg/kg) amine content, respectively. Samples with moderate, high or very high
levels of biogenic amines could be considered as products of less quality, and their consumption could be unhealthy for sensitive indi-
viduals or for those under classical monoamine oxidase inhibitor drug therapy.
Ó 2007 Elsevier Ltd. All rights reserved.
Keywords: Traditional fermented sausage; Biogenic amines; Tyramine; Histamine; Cadaverine; Hygienic quality
1. Introduction
0308-8146/$ - see front matter Ó 2007 Elsevier Ltd. All rights reserved.
doi:10.1016/j.foodchem.2007.08.046
M.L. Latorre-Moratalla et al. / Food Chemistry 107 (2008) 912–921 913
sausage, for which minced meat, together with several profiles may vary depending on several extrinsic and intrin-
ingredients, such as salt, sugar, spices and curing agents, sic factors during the manufacturing process, such as the
is fermented and stuffed into a casing. Although the type ripening conditions, formulation, physico-chemical and
and manufacture of fermented sausages differ depending proteolytic parameters, as well as microflora development
on the region, industrial manufacturing processes tend to and its decarboxylase activity.
standardize procedures. Artisanal sausages are increasingly In the frame of Tradisausage project, biogenic amine
appreciated by consumers because of their sensory proper- accumulation in sausages from several regions throughout
ties and their authenticity. Traditional products are usually the Mediterranean area and Slovakia was studied. In par-
manufactured in small-scale plants following spontaneous ticular, the objective of the present work was to study the
fermentation. Given the size of these operations, tradi- aminogenesis during the manufacturing of traditional fer-
tional producers may encounter difficulties (technical and mented sausages taking into account several factors such
financial) to comply with food safety standards established as origin, technological conditions, physico-chemical
for industrial processes, such as for example, the introduc- parameters and microbial counts. Moreover, biogenic
tion of the hazard analysis and critical control point amine contents in the final product were assessed to deter-
(HACCP) plan. mine their hygienic implications as well as their potential
The European project ‘‘Tradisausage” (QLK1 CT-2002- risk for health.
02240) aimed to evaluate and eventually improve the safety
of fermented sausages produced via traditional methods in
Europe while preserving their authenticity. In the frame of 2. Materials and methods
this project, biogenic amines (tyramine, putrescine, cadav-
erine, histamine, b-phenylethylamine, tryptamine), micro- 2.1. Samples and sampling
bial metabolites resulting from the decarboxylation of
precursor amino acids (tyrosine, ornithine, lysine, histidine, The different types of European fermented sausages
phenylalanine, tryptophan) (Brink, Damink, Joosten, & examined in this study were manufactured by a total
Huis in’t Veld, 1990), have been evaluated. Polyamines, of 54 traditional processing units (PUs), which were
spermidine and spermine, are considered natural amines, selected by each country participating in the project to
since they are not related to inducible microbial decarbox- include different typologies according to the guidelines
ylase activity. of the European Project Tradisausage: France (10
Interest in biogenic amine content of food, in particular PUs), Spain (10), Italy (10), Portugal (11), Greece (10)
fermented sausages, lies in safety and quality issues. From and Slovakia (3).
a toxicological point of view, the vasoactive and psychoac- Table 1 shows the range of length, temperature and rel-
tive effects, of mainly tyramine and histamine, are related ative humidity, both in fermentation and ripening steps
to the occurrence of histaminic intoxication, food-induced used for the sample elaboration following the traditional
migraines and hypertensive crises in sensitive individuals. customs of each country. All types of sausages were man-
The risk of health implications may be increased when ufactured with pork (without beef); however, distinct types
the efficiency of enzymatic systems is blocked by mono- and/or amounts of ingredients, spices and additives were
amine oxidase inhibitors (MAOI drugs), gastrointestinal included. Fermentation was mediated by spontaneous
diseases, genetic deficiencies, or potentiating factors such flora, except in 5 PUs (1 in France, 2 in Spain, 1 in Greece
as alcohol or other biogenic amines (Brink et al., 1990; and 1 in Slovakia), which used a starter culture. Products
Mariné-Font, Vidal-Carou, Izquierdo-Pulido, Veciana- were smoked in Portugal, Greece and Slovakia.
Nogués, & Hernández-Jover, 1995). Furthermore, some For each PUs (n = 54), sausages were sampled at
biogenic amines (mainly cadaverine and histamine) have three points during the manufacturing process, point zero
been proposed as chemical indicators of the hygienic condi- (Z): meat batter just before stuffing, mid point (M): after
tions of raw material and/or manufacturing practices since fermentation (at the end of microbial exponential
their accumulation is associated with the activity of con- growth), and final point (F): product after ripening when
taminant bacteria (Bover-Cid, Hernández-Jover, Migué- the product was ready for consumption. Moreover, to
lez-Arrizado, & Vidal-Carou, 2003; Halász, Baráth, study the effect of batch, 13 additional batches from
Simon-Sarkadi, & Holzapfel, 1994; Hernández-Jover, some selected PUs were studied. Three sausages at each
Izquierdo-Pulido, Veciana-Nogués, Marine-Font, & sampling point were sampled. Samples were wrapped in
Vidal-Carou, 1997). aluminium foil, packed under vacuum, frozen at
Among the numerous studies on biogenic amines in fer- ÿ20 °C and sent in dry ice to our laboratory. There
mented sausages, few have focused specifically on tradi- the samples were stored at ÿ20 °C until analysis. A total
tional manufacture (Miguélez-Arrizado, Bover-Cid, of 201 samples were examined for biogenic amine con-
Latorre-Moratalla, & Vidal-Carou, 2006; Montel, Masson, tents, nitrogen fractions (total nitrogen, a-amino nitrogen
& Talon, 1999; Parente et al., 2001). In this kind of sau- and non-protein nitrogen), and physico-chemical param-
sage, the occurrence of biogenic amines could be consider- eters (pH, water activity and moisture). Analyzes were
able and higher than industrial ones. Amine content and performed in triplicate.
914 M.L. Latorre-Moratalla et al. / Food Chemistry 107 (2008) 912–921
Table 1
Composition and technological conditions of fermented sausages from several countries (minimum and maximum of 10 processing units/country)
France Spain Italy Portugal Greece Slovakia
Formulation
Meat species Pork Pork Pork Pork Pork Pork
Meat/fat ratio (%) 80/20 75–90/25–10 50–90/50–10 60–90/40–10 50–90/50–10 40–70/60–30
Salt (NaCl) (g/kg) 14–30 13–23 Unknown Empirically 20–30 Empirically
Nitrates/Nitrites (g/kg) 0–0.08/ 0–0.3 0–0.5 Unknown 0.6 0.15/0.2 Unknown
Glucides (g/kg) 0–8 0–33 Unknown None 0–3 0–6
Other Pepper, wine, Pepper, wine Pepper, wine, Red pepper, wine, Black and red pepper, Chilly pepper,
garlic garlic garlic paprika garlic
Process conditions
Temp (°C)/HR (%) None None None 2–21/50–90a 18–20/85–89 >26/30–95
smoking
Time (days) smoking None None None 5–45a 2 Empirically
Temp (°C)/HR (%) 10–22/76–99 2–24/49–94 4–26/70–84 2–12 12–24/93–80 15–16/80
fermentation
Time (days) fermentation 2–8 <1–5 1–10 1–3 1–7 5–12
Temp (°C)/HR (%) 8–14/70–90 10–18/58–85 6–22/58–83 2–21/50–90a 12–17/76–78 15–25/82–90
maturation
Time (days) maturation 31–82 15–60 15–90 5–45a 14–60 12–21
a
In nine out of ten PUs the smoking and maturation are not independent phases; it occurs simultaneously.
180 180
160 160
120 120
100 100
80 80
60 60
40 40
20 20
0 0
FR E I FR E I
G P S G P S
Z
180 180
M
160 160
Cadaverine (mg/kgdm)
140 F
Histamine (mg/kgdm)
140
120 120
100 100
80 80
60 60
40 40
20 20
0 0
FR E I FR E I
G P S G P S
Fig. 1. Average contents (mg/kg dry matter) of biogenic amine contents in samples of just before stuffed products (Z), intermediate product after
fermentation (M) and final product after ripening (F) for each country (FR: France; E: Spain; I: Italy; P: Portugal; G: Greece; S: Slovakia).
high counts of enterococci (higher than four log cfu/g in consistent with the fact that these two amines are produced
average) and/or enterobacteria (higher than four log cfu/ mainly by enterobacteria (Bover-Cid, Izquierdo-Pulido, &
g in average). These microbial groups are frequently Vidal-Carou, 2000; Roig-Sagués, Hernández-Herrero,
reported to be strong producers of tyramine and cadaver- López-Sabater, Rodriguez Jerez, & Mora-Ventura, 1996).
ine, respectively (Suzzi & Gardini, 2003). The aromatic amine phenylethylamine was found in few
Regarding aminogenesis throughout manufacturing samples and always when high contents of tyramine were
(Fig. 1), biogenic amines were detected during fermentation present. This observation could be attributed to the fact
(the increase between Z and M samples) as well as during that microorganisms with strong tyrosine-decarboxylase
ripening (the increase between M and F samples). However activity also have moderate capacity for decarboxylate
the intensity of amine formation in these two steps differed phenylalanine (Bover-Cid, Hugas, Izquierdo-Pulido, &
depending on the country. Thus, in most of the French Vidal-Carou, 2001; Joosten, 1987). However, high cadaver-
products, aminogenesis occurred during ripening. In con- ine or tyramine content does not necessarily imply hista-
trast, the greatest biogenic amine accumulation in Greek mine and phenylethylamine accumulation respectively. In
products was registered during fermentation. general, biogenic amine contents of the sausages did not
In the final products (Table 2), tyramine was the domi- differ clearly from those usually reported for fermented
nant amine, accounting for one third to one half of the sausages, whether industrial or traditional (Hernández-
total amine content. Tyramine content followed a normal Jover et al., 1997; Montel et al., 1999).
distribution and the mean value was 145 mg/kg dm. Putres- To evaluate the effect of manufacturing customs of the
cine was the second amine followed by cadaverine. These country of origin on the biogenic amine content a principal
di-amines showed higher variability, with a non normal component analysis (PCA) was performed. The 67% of the
distribution. Most of the samples showed relatively low total variance was explained by the three principal compo-
di-amine contents (median values of 51 mg/kg dm for nents. The first component explain the 38% of the total var-
putrescine and 41 mg/kg dm for cadaverine). Occasionally iance and was referred to biogenic amines of microbial
di-amine, especially cadaverine, surpassed the levels of origin corresponded to tyramine (correlation coeffi-
tyramine. The occurrence of histamine was less frequent cient = 0.87), putrescine (0.85), cadaverine (0.55), hista-
(31 out of 54 final products) and at much lower concentra- mine (0.61), phenylethylamine (0.73) and tryptamine
tions (median of 0.66 mg/kg dm) than those of the amines (0.80). Second and the third principal component were
mentioned above. Histamine was always associated with influenced by the physiological polyamines, spermidine
the presence of di-amines, especially cadaverine, which is (0.78) and spermine (0.76), together with agmatine (0.66)
916 M.L. Latorre-Moratalla et al. / Food Chemistry 107 (2008) 912–921
Table 2
Biogenic amine content (mg/kg dry matter) in the ripened fermented sausages for all processing units (PUs) evaluated
Country PUs TYa PUa CAa HIa PHEa TRPa Cluster groupb
France 1 186.91 107.27 107.43 0.38 7.07 2.99 B
2 5.25 0.43 0.55 0.39 0.01 0.01 A
3 173.68 124.20 85.16 1.40 3.64 18.34 B
4 113.32 121.75 16.20 7.33 0.01 0.01 B
5 226.62 362.06 389.82 41.71 53.98 18.87 E
6 130.05 15.49 115.47 5.46 1.41 10.22 C
7 147.98 10.05 0.01 0.01 1.86 0.01 A
8 133.21 42.20 259.79 10.47 4.30 19.13 D
9 104.60 8.91 315.54 0.01 0.16 4.55 D
10 7.08 0.22 0.01 0.01 0.01 0.01 A
Spain 1 204.40 252.51 4.38 0.01 17.82 44.94 B
2 86.82 43.94 0.01 0.01 0.01 0.01 A
3 174.72 17.56 610.96 0.01 3.69 0.01 D
4 86.88 5.82 0.01 0.01 0.01 0.01 A
5 190.53 98.42 79.75 1.93 11.39 25.78 B
6 215.95 45.81 17.51 0.01 25.66 37.55 B
7 473.47 448.85 302.63 133.39 30.76 78.51 E
8 38.38 1.28 1.04 0.58 0.01 3.02 A
9 49.93 5.49 0.40 0.01 0.01 0.01 A
10 272.20 95.58 257.74 26.06 5.77 4.93 D
Italy 1 276.93 324.20 205.66 0.01 43.41 2.34 E
2 229.19 209.87 29.28 4.88 10.21 9.56 B
3 129.80 3.65 0.36 0.01 0.01 0.01 A
4 214.40 46.77 352.32 0.01 0.01 0.01 D
5 231.53 322.14 449.44 0.01 0.01 6.28 E
6 168.87 139.04 20.23 8.84 0.01 12.50 B
7 70.30 15.39 195.47 0.01 0.01 3.76 C
8 117.86 104.58 40.45 0.74 4.36 0.01 B
9 302.97 72.72 71.46 0.01 4.84 17.18 B
10 60.24 10.34 139.58 0.01 0.01 0.01 C
Greece 1 14.29 0.01 0.01 0.01 0.01 0.01 A
2 11.84 0.01 0.01 0.01 0.01 0.01 A
3 157.67 95.90 0.01 15.54 3.63 0.50 B
4 271.69 126.37 242.58 0.01 3.73 26.31 C
5 86.37 65.32 20.32 6.86 0.01 2.62 A
6 210.53 25.86 88.90 47.92 20.65 48.24 C
7 119.01 122.48 7.30 41.79 2.15 0.01 B
8 135.70 96.60 199.68 0.01 0.01 10.51 C
9 85.60 2.02 106.80 0.01 0.01 0.01 C
10 142.35 113.73 19.41 105.81 0.01 0.01 B
Portugal 1 12.95 4.26 2.74 3.11 0.01 0.01 A
2 9.71 7.28 4.91 6.22 0.01 0.01 A
3 259.04 257.40 484.65 0.01 45.47 33.74 E
4 8.60 10.26 10.76 3.60 0.01 0.01 A
5 104.83 117.09 262.46 14.34 2.18 6.38 D
6 266.83 53.51 41.41 3.42 5.58 2.26 B
7 154.76 20.19 198.41 0.01 0.01 6.91 C
8 138.65 36.35 244.76 6.54 0.01 0.01 C
9 208.64 180.42 25.43 2.19 0.01 0.01 B
10 268.61 352.18 342.67 94.66 20.01 36.10 E
11 82.03 83.69 121.35 4.13 0.01 0.68 C
Slovakia 1 117.94 49.29 2.51 2.19 4.52 1.89 A
2 110.98 61.71 1.40 15.29 1.05 0.90 A
3 0.01 0.01 0.01 0.01 0.01 0.01 A
TY: tyramine, PU: putrescine, CA: cadaverine, HI: histamine, PHE: phenylethylamine, TRP: tryptamine. Cluster group: (A) very low and low total
contents; (B) moderate total contents, tyramine as the major amine; (C) moderate total contents, cadaverine as the major amine; (D) high total contents;
(E) very high total contents.
a
Biogenic amines expressed in dry matter to compensate differences attributed to different water content.
b
Cluster groups were obtained taking the biogenic amine contents referred to fresh weight to better reproduce the conditions of consumption.
M.L. Latorre-Moratalla et al. / Food Chemistry 107 (2008) 912–921 917
explaining the 17% and 12% of the total variance, respec- (PC2) included the length of the process (time) and the
tively. This PCA did not let a separation of the samples changes of intrinsic factors: water activity, proteolysis
by countries which indicated that the overall amine content index, and pH values. Finally, the third principal compo-
was irrespective of the country of origin. The only compar- nent (PC3) was described by the technological conditions:
ative study about biogenic amines in fermented sausages relative humidity and temperature. Thus, the accumulation
produced in several European countries (Ansorena et al., of biogenic amines occurred irrespectively of physico-
2002) published to date reports quantitative and qualitative chemical changes (except for AAN) and the technological
differences between those manufactured in Southern and conditions applied for the sausage manufacture. In the
the Northern Europe. Southern Belgium and Italy showed bidimensional plot representation for the first two principal
greater levels than Northern Belgium and Norway. These components (Fig. 2, Graph a), two steps of the manufac-
differences were attributed to distinct processing methods turing process, fermentation and ripening, were distin-
and microbial characteristics. guished from PC2.
The relationship between the changes in microbial
3.2. Relationships between biogenic amines and processing counts and the biogenic amine accumulation was also
parameters studied through a PCA (Fig. 2, Graph b). The factorial
analysis extracted two principal components, which
Table 3 shows the results of physico-chemical (pH, aw, explained 60% of the total variance. The first principal
moisture) and proteolysis-related parameters (AAN con- component (PC1) included the changes in biogenic amines
tent and PI) during manufacturing. Sausages produced fol- and in the opposite direction those of spoilage microor-
lowing traditional methods generally have final pH values ganisms (enterobacteria and pseudomonads). The second
that are higher than those produced industrially (Ayme- component (PC2), in contrast, included the technological
rich, Martı́n, Garriga, & Hugas, 2003; Miguélez-Arrizado flora (LAB and staphylococci), enterococci as well as
et al., 2006). The pH values of the final products were quite yeasts and moulds. A relationship between technological
variable but two statistically different (p < 0.005) groups flora and the increase in biogenic amines could not be
were distinguished: those with relatively high pH values, demonstrated. The PC2, related mainly to technological
Italy (average pH of 6.07), Spain (5.98) and France flora, was less efficient in distinguishing the two parts of
(5.76); and those that were more acidic, corresponding to the manufacturing process than the PC2 related to phys-
Slovakia (mean 5.23), Greece (5.37) and Portugal (5.46). ico-chemical parameters.
In contrast, moisture and water activity parameters were The lack of correlation between biogenic amine increase
not statistically different (p > 0.05) between samples from and both microbial change and temperature and relative
the countries studied. This observation can probably be humidity is consistent with the data from Parente et al.
explained by variable degrees of drying. Similarly, statisti- (2001). Processing conditions are technological factors that
cal differences were not found in the proteolysis parame- depend on the country as well as the PU. These factors
ters, ANN and proteolysis index, either between determine the selection and competitiveness of microbial
countries or between sampling points. communities and modulate their metabolic activity (includ-
Biogenic amine accumulation is affected by a wide vari- ing decarboxylase) as well as the biochemical and physico-
ety of factors, including technological and physico-chemi- chemical changes that occur in the sausage during ripening.
cal ones, which in turn, interact and change throughout The occurrence of several possible interactions among all
the process, thereby influencing the growth and the activity the factors involved in amine production could be a reason
of aminogenic microorganisms (Suzzi & Gardini, 2003). A for the lack of any statistical relationship between most of
PCA was performed to establish whether or not there was a the individual factors and aminogenesis. Therefore, no gen-
relationship between technological and physico-chemical eral rule can be concluded to describe aminogenesis during
factors and biogenic amine accumulation during sausage the manufacture of traditional fermented sausages depend-
manufacture. For this statistical treatment, the variables ing on the country, nor among the PUs within the same
considered were the changes in biogenic amines, pH, water country.
activity, AAN and PI during fermentation and ripening,
and the technological conditions (time, temperature and 3.3. Biogenic amines in final products: hygienic and
relative humidity) applied in these two steps of the process. technological interest
Changes during fermentation were defined as the difference
between analytical data of the sampling points M and Z, Taking into account that biogenic amine contents in
whereas those during ripening were the difference between final products could be considered hygienic and technolog-
F and M. The factorial analysis extracted 3 principal com- ical quality indicators, a cluster analysis was carried out
ponents explaining 56% of the total variance. The first prin- using the total content of biogenic amines of microbial ori-
cipal component (PC1) was described by the increase in gin (tyramine, phenylethylamine, tryptamine, histamine,
biogenic amines and free amino acids (AAN), which is in putrescine and cadaverine). These results are referred to
agreement with the role of free amino acids as precursors fresh matter (mg/kg) to better reflect the conditions of
of decarboxylation. The second principal component consumption.
918 M.L. Latorre-Moratalla et al. / Food Chemistry 107 (2008) 912–921
Table 3
Physico-chemical parameters determined in sausages for all processing units (PUs): pH, water activity (aw) and water content
Country Step pH aw Moisture (%) AAN (mg/g) IP (NNP/NT%)
a
France (n = 10) Z 5.7 ± 0.2 0.95 ± 0.35 61.0 ± 4.6 1.2 ± 0.3 7.5 ± 3.1
(5.4–6.0)b (0.85–0.97) (53.0–66.0) (0.9–1.7) (3.0–12.4)
M 5.5 ± 0.3 0.95 ± 0.04 58.0 ± 3.4 1.6 ± 0.4 9.6 ± 5.8
(5.1–6.0) (0.82–0.97) (53.7–61.6) (1.1–2.2) (0.8–18.5)
F 5.8 ± 0.4 0.87 ± 0.02 32.0 ± 4.4 2.1 ± 0.5 6.8 ± 3.4
(5.2–6.5) (0.84–0.93) (26.2–38.9) (1.2–2.9) (0.6–11.2)
Spain (n = 10) Z 6.1 ± 0.2 0.97 ± 0.01 62.1 ± 2.7 1.5 ± 0.5 6.6 ± 4.2
(5.86–6.43) (0.96–0.98) (56.9–65.9) (1.0–2.2) (2.4–14.8)
M 5.7 ± 0.5 0.94 ± 0.02 47.1 ± 6.1 2.2 ± 0.7 10.5 ± 6.2
(4.8–6.5) (0.91–0.97) (36.6–55.5) (1.4–3.4) (3.8–21.5)
F 6.0 ± 0.4 0.88 ± 0.03 32.9 ± 5.0 2.3 ± 0.9 8.8 ± 4.1
(5.5–6.5) (0.83–0.92) (26.2–40.6) (1.3–4.4) (1.9–16.4)
Italy (n = 10) Z 5.9 ± 0.2 0.94 ± 0.06 58.2 ± 5.7 1.35 ± 0.38 11.1 ± 5.9
(5.6–6.3) (0.77–0.97) (48.4–65.4) (0.86–2.24) (5.6–25.1)
M 5.7 ± 0.3 0.96 ± 0.01 55.0 ± 4.9 2.0 ± 0.5 13.6 ± 3.9
(5.3–6.1) (0.95–0.97) (48.3–62.2) (1.6–3.2) (8.8–20.8)
F 6.1 ± 0.5 0.89 ± 0.05 33.0 ± 4.7 2.3 ± 0.5 10.7 ± 3.2
(5.5–6.9) (0.78–0.94) (25.2–39.1) (1.7–2.9) (6.0–15.8)
Greece (n = 10) Z 5.8 ± 0.6 0.96 ± 0.01 55.4 ± 6.0 1.3 ± 0.7 9.4 ± 11.2
(4.3–6.4) (0.95–0.97) (48.5–66.7) (0.6–2.9) (0.5–39.8)
M 5.6 ±0.6 0.95 ± 0.02 49.2 ± 10.3 1.8 ± 0.6 7.1 ± 5.9
(4.6–6.3) (0.93–0.97) (35.6–65.5) (1.3–2.8) (0.5–16.6)
F 5.4 ± 0.8 0.91 ± 0.07 41.8 ± 15.6 1.8 ± 0.6 11.9 ± 18.8
(4.4–6.6) (0.77–0.97) (19.1–65.6) (1.2–2.9) (1.1–63.3)
Portugal (n = 11) Z 5.9 ± 0.4 0.98 ± 0.01 59.5 ± 5.6 0.9 ± 0.3 8.3 ± 3.3
(5.4–6.6) (0.97–0.98) (48.9–66.4) (0.4–1.6) (3.8–12.5)
M 5.5 ± 0.4 0.95 ± 0.02 45.4 ± 9.0 1.9 ± 1.0 10.7 ± 3.4
(5.0–6.1) (0.93–0.98) (27.5–61.0) (0.6–3.7) (4.7–15.7)
F 5.5 ± 0.3 0.90 ± 0.03 30.5 ± 8.9 2.0 ± 0.8 10.4 ± 4.3
(5.0–6.1) (0.85–0.93) (17.7–48.3) (0.9–3.7) (3.9–18.6)
Slovakia (n = 3) Z 6.0 ± 0.1 0.96 ± 0.00 49.8 ± 3.3 1.0 ± 0.1 8.0 ± 0.4
(5.9–6.1) (0.96–0.97) (47.6–53.6) (0.9–1.1) (7.6–8.4)
M 5.4 ± 0.5 0.96 ± 0.01 47.9 ± 6.6 1.8 ± 0.3 10.9 ± 4.4
(5.0–6.0) (0.95–0.97) (43.3–55.5) (1.5–2.2) (6.9–15.5)
F 5.2 ± 0.56 0.93 ± 0.03 39.5 ± 8.6 1.9 ± 0.4 14.7 ± 10.2
(5.0–6.0) (0.90–0.95) (32.9–49.2) (1.7–2.3) (7.8–26.5)
Proteolytic parameters: a-amino nitrogen (AAN) and Proteolytic index (PI). Z: products just before stuffing, M: products after fermentation, F: products
after ripening (ready for consumption).
a
Mean ± standard deviation of all processing units (PUs) of each country.
b
Range (minimum–maximum) of all processing units (PUs) of each country.
Five groups, A–E, were distinguished (Table 2). Group ucts, and it is generally associated with the tyrosine-decar-
A included sausages showing very low or low amine con- boxylase activity of some lactobacilli and other microbial
tents (from not detected to 150 mg/kg of total of biogenic populations that usually participate in the fermentation
amines) and accounted for one third of the sausages exam- and ripening of sausages (i.e. some gram-positive cata-
ined. In this group, tyramine was practically the only bio- lase-positive cocci and most enterococci) (Suzzi & Gardini,
genic amine, except in few cases in which putrescine 2003). Therefore, moderate levels of tyramine, as in the
reached similar values to those of tyramine. Cadaverine, sausages of group B, would be acceptable. Nevertheless,
histamine and other minor amines were absent or the levels since some samples of group A showed low or even extre-
were extremely low. This group would be the most desir- mely low levels of tyramine, it seems that it could be feasi-
able option from the hygienic point of view. Up to 28% ble to elaborate nearly tyramine-free and biogenic amine-
of the products were included in group B and presented free sausages. Group C included 18% of the products and
moderate total biogenic amine content, with a range from these also showed moderate total biogenic amine content,
150 to 350 mg/kg, with tyramine as the major amine. but cadaverine was the main biogenic amine followed by
Putrescine was the second amine, followed by cadaverine, tyramine, while putrescine content remained low. Group
whereas histamine was practically absent. It is well known D included 11% of the products and was characterized by
that tyramine is the major amine in fermented meat prod- high total biogenic amine content (from 350 to 550 mg/
M.L. Latorre-Moratalla et al. / Food Chemistry 107 (2008) 912–921 919
a b
Fig. 2. Principal component analysis (PC1 and PC2) of the biogenic amine increase with technological conditions and physico-chemical changes (graph a),
or with microbial changes (graph b) during the fermentation (j) and maturation (s) of European traditional fermented sausages. Asterisks (*) show the
relative position of the variables. M: Change between two consecutive sampling points (M–Z, for fermentation and F–M for ripening). TY: tyramine, PU:
putrescine, CA: cadaverine, HI: histamine, PHE: phenylethylamine, TRP: tryptamine, AAN: a-amino nitrogen, Aw: water activity, IP: proteolytic index,
ENBA: enterobacteria, PSEU: pseudomanads, YM: yeast and moulds, LAB: lactic acid bacteria, SK: staphylococci, ENCC: enterococci.
kg). The qualitative amine profile of Group D was similar sausages could imply a health risk for their biogenic
to that of Group C, cadaverine being the most abundant amine contents. Several genetic, pharmacological and
amine, followed by tyramine. Finally, the products clus- dietary factors are responsible for the wide inter- and
tered into group E showed very high levels of biogenic
amines (total content higher than 550 mg/kg), especially Table 4
cadaverine, putrescine, tyramine and histamine. This group Biogenic amine content (mg/kg dry matter) of the fermented sausages
contained also the 11% of the products examined. Cadav- (end-product) of two different batches (a and b) manufactured within the
erine and also histamine are usually related to the activity processing units (PUs) of each country
of decarboxylase-positive contaminant microbiota, such Country PUs TY PU CA HI PHE TRY
as enterobacteria (Durlu-Özkaya, Ayhan, & Vural, 2001), France 2a 5.25 0.43 0.55 0.39 0.01 0.01
which may not be totally inhibited during fermentation. 2b 8.68 6.87 0.01 0.01 0.01 0.01
On the basis of the amount and type of amines, sausages 8a 133.21 42.20 259.79 10.47 4.30 19.13
8b 102.01 14.50 103.31 25.55 0.01 0.01
included in groups C, D and E could be considered less
desirable than the others. Indeed, the fermented sausages Spain 2a 86.82 43.94 0.01 0.01 0.01 0.01
2b 14.46 3.08 1.42 0.01 1.89 0.01
in which biogenic amine accumulation was already
3a 174.72 17.56 610.96 0.01 3.69 0.01
detected in Z samples were included in one of these three 3b 276.94 57.25 456.29 0.01 11.56 0.01
groups. Therefore, a relationship between the hygienic
Italy 2a 229.19 209.87 29.28 4.88 10.21 9.56
quality of raw materials and the final contents of biogenic 2b 188.96 95.08 318.75 23.20 2.61 5.41
amines could be suspected. In order to evaluate the influ- 7a 70.30 15.39 195.47 0.01 0.01 3.76
ence of hygienic conditions of raw materials on the accu- 7b 99.01 4.43 143.93 19.74 0.01 0.01
mulation of biogenic amines, additional batches from Greece 1a 14.29 0.01 0.01 0.01 0.01 0.01
some selected PUs of each country were analyzed. In most 1b 148.26 126.39 1.18 91.64 6.02 0.01
of the additional batches the amine profiles differed to 8a 135.70 96.60 199.68 0.01 0.01 10.51
those found in the first manufacture, both from quantita- 8b 14.96 0.01 0.01 1.74 0.01 0.01
tive and qualitative points of view (Table 4). These results Portugal 2a 9.71 7.28 4.91 6.22 0.01 0.01
indicate that the batch, mainly because of differences in 2b 72.77 84.90 30.65 0.73 0.09 0.32
hygienic quality of raw materials, would be a critical factor 11a 82.03 83.69 121.35 4.13 0.01 0.68
11b 93.03 111.30 52.80 8.98 0.01 13.21
in explaining the differences observed between batches
from the same PU. Slovakia 1a 117.94 49.29 2.51 2.19 4.52 1.89
1b 106.87 238.11 15.87 0.72 0.01 8.04
2a 110.98 61.71 1.40 15.29 1.05 0.90
2b 242.87 109.51 1.74 41.41 77.55 2.38
3.4. Biogenic amines in final products: toxicological interest 3a 0.01 0.01 0.01 0.01 0.01 0.01
3b 109.37 11.26 2.11 0.21 0.01 0.01
The other objective of this study was to assess TY: tyramine, PU: putrescine, CA: cadaverine, HI: histamine, PHE:
whether the consumption of the traditional fermented phenylethylamine, TRP: tryptamine.
920 M.L. Latorre-Moratalla et al. / Food Chemistry 107 (2008) 912–921
production during ripening and storage of dry fermented sausages. Mariné-Font, A., Vidal-Carou, M. C., Izquierdo-Pulido, M., Veciana-
Journal of Food Protection, 63(11), 1544–1550. Nogués, M. T., & Hernández-Jover, T. (1995). Les amines biogenes
Brink, B., Damink, C., Joosten, H. M. L. J., & Huis in’t Veld, J. H. J. dans les aliments: leur signification, leur analyse. Annales deus
(1990). Occurrence and formation of biologically active amines in Falsifications de l’Expertise Chimique et Toxicologique, 88, 119–140.
foods. International Journal of Food Microbiology, 11, 73–84. McCabe, B. J. (1986). Dietary tyramine and other pressor amines in
Dierick, N., Vandekerckhove, P., & Demeyer, D. (1974). Changes in MAOI regimens: A review. Journal of the American Dietetic Associ-
nonprotein nitrogen compounds during dry sausage ripening. Journal ation, 86(8), 1059–1064.
of Food Science, 39, 301–304. Miguélez-Arrizado, M. J., Bover-Cid, S., Latorre-Moratalla, M. L., &
Dingemanse, J., Wood, N., Guentert, T., Oie, S., Ouwerkerk, M., & Vidal-Carou, M. C. (2006). Biogenic amines in Spanish fermented
Amrein, R. (1998). Clinical pharmacology of moclobemide during sausages as a function of diameter and artisanal or industrial origin.
chronic administration of high doses to healthy subjects. Psychophar- Journal of the Science of Food and Agriculture, 86(4), 549–557.
macology, 140(2), 164–172. Montel, M. C., Masson, F., & Talon, R. (1999). Comparison of biogenic
Durlu-Özkaya, F., Ayhan, K., & Vural, N. (2001). Biogenic amines amine content in traditional and industrial French dry sausages.
produced by Enterobacteriaceae isolated from meat products. Meat Science des Aliments, 19, 247–254.
Science, 58(2), 163–166. Parente, E., Martuscelli, M., Gardini, F., Grieco, S., Crudele, M. A., &
EC (2005). Commission Regulation (EC) No 2073/2005 of 15 November Suzzi, G. (2001). Evolution of microbial populations and biogenic
2005 on microbiological criteria for foodstuffs. Official Journal of the amine production in dry sausages produced in southern italy. Journal
European Union, L338: pp. 1–26. of Applied Microbiology, 90, 882–891.
Halász, A., Baráth, A., Simon-Sarkadi, L., & Holzapfel, W. (1994). Roig-Sagués, A., Hernández-Herrero, M., López-Sabater, E., Rodriguez
Biogenic amine and their production by microorganism in food. Trend Jerez, J., & Mora-Ventura, M. (1996). Histidine decarboxilase activity
in Food Science and Technology, 5, 42–49. of bacteria isolated from raw and ripened salchichón, a Spanish cured
Hannington, E. (1980). Diet and migraine. Journal of Human Nutrition, sausage. Journal of Food Protection, 59(5), 516–520.
34, 842–845. Sattler, J., Hafner, D., Klotter, H. J., Lorenz, W., & Wagner, P. K. (1988).
Hernández-Jover, T., Izquierdo-Pulido, M., Veciana-Nogués, M. T., Food-induced histaminosis as an epidemiological problem: Plasma
Marine-Font, A., & Vidal-Carou, M. C. (1997). Biogenic amine and histamine elevation and haemodynamic alterations after oral histamine
polyamine contents in meat and meat products. Journal of Agricultural administration and blockade of diamine oxidase (DAO). Agents
and Food Chemistry, 45(6), 2098–2102. Actions, 23(3–4), 361–365.
Hernández-Jover, T., Izquierdo-Pulido, M., Veciana-Nogués, M. T., & Suzzi, G., & Gardini, F. (2003). Biogenic amines in dry fermented
Vidal-Carou, M. C. (1996). Ion-pair high-performance liquid chro- sausages: A review. International Journal of Food Microbiology, 88(1),
matographic determination of biogenic amines in meat and meat 41–54.
products. Journal of Agricultural and Food Chemistry, 44(9), Talon, R., Lebert, I., Lebert, A., Leroy, S., Garriga, M., Aymerich, et al.
2710–2715. (2007). Traditional dry fermented sausages produced in small-scale
Joosten, H. M. L. J. (1987). Conditions allowing the formation of biogenic processing units in Mediterranean countries and Slovakia. 1. Microbial
amines in cheese. III. Factors influencing the amounts formed. ecosystems of processing environments. Meat Science, in press,
Netherlands Milk and Dairy Journal, 41, 329–357. doi:10.1016/j.meatsci.2007.05.006.
RESULTADOS
Comunicación escrita2:
M.L. Latorre-Moratalla, S. Bover-Cid, T. Veciana-Nogués, A. Mariné-Font, M.C. Vidal-Carou.
Aminas biógenas en embutidos europeos de elaboración artesanal durante el
almacenamiento. II Reunión de la Sociedad Española de Seguridad Alimentaria (SESAL).
Valencia, 29-30 de septiembre de 2005.
Por tanto, dentro del marco del proyecto Tradisausage, el objetivo de este
estudio fue determinar la formación de aminas biógenas en productos cárnicos
fermentados artesanales europeos durante el almacenamiento, durante diferentes
temperaturas de conservación (ambiental o refrigeración).
2
Trabajo correspondiente a la tarea 2.5 del proyecto Europeo TRADISAUSAGE (QLK1 CT-2002-02240).
Los resultados se encuentran publicados en el informe final del proyecto, disponible en la URL:
http://www1.clermont.inra.fr/tradisausage/
105
AMINOGÉNESIS EN EMBUTIDOS FERMENTADOS DE ORIGEN ARTESANAL
6.2.3. Resultados
106
RESULTADOS
Tabla 6.1. Contenidos medios (desviación estándar) de aminas biógenas (mg/kg peso
seco) en productos cárnicos crudos-curados fermentados de elaboración artesanal
almacenados a diferentes temperaturas y periodos de tiempo, según los hábitos
de conservación y consumo de los diferentes países de procedencia.
nd: no detectado
107
AMINOGÉNESIS EN EMBUTIDOS FERMENTADOS DE ORIGEN ARTESANAL
108
RESULTADOS
TI PU CA HI
300
250
mg/kg peso seco
200
150
100
50
0
0 7 15 30 0 7 15 0 7 15 21 30 0 7 15 días
Planta A Planta B
300
250
mg/kg peso seco
200
150
100
50
0
0 7 15 21 30 0 7 15 0 7 15 21 30 0 7 15 días
Ref T amb Ref T amb
Planta C Planta D
Figura 6.1. Evolución de los contenidos de las aminas biógenas (mg/kg peso seco)
durante el almacenamiento de embutidos fermentados en plantas de
elaboración artesanal procedentes de Portugal. Producto conservado en
refrigeración (4ºC). T amb: producto conservado a temperatura ambiente (20-
25 ºC) TI: tiramina, PU: putrescina, CA: cadaverina, HI: Histamina
109
AMINOGÉNESIS EN EMBUTIDOS FERMENTADOS DE ORIGEN ARTESANAL
110
RESULTADOS
Comunicación escrita:
M.L. Latorre-Moratalla, S. Bover-Cid, T. Veciana-Nogués, A. Mariné-Font, M.C.
Vidal-Carou. Aminas biógenas en embutidos europeos de elaboración artesanal
durante el almacenamiento. II Reunión de la Sociedad Española de Seguridad
Alimentaria (SESAL). Valencia, 29-30 de septiembre de 2005.
111
RESULTADOS
113
RESULTADOS
7
ACTIVIDAD AMINOÁCIDO-DESCARBOXILASA
DE MICROORGANISMOS AISLADOS DE
PRODUCTOS CÁRNICOS CRUDOS-CURADOS
FERMENTADOS DE ELABORACIÓN
ARTESANAL
115
RESULTADOS
Artículo II.
M.L. Latorre-Moratalla,S.Bover-Cid, R.Talon, M. Garriga, T. Aymerich, E. Zanardi, A. Ianieri,
M.J. Fraqueza, M. Elias, E.H. Drosinos, A. Lauková, M.C. Vidal-Carou. (2010). Distribution of
aminogenic activity among potential autochthonous starter cultures. Journal of Food
protection, 73 (3): 524-528.
Índice de impacto (JCR 2008): 1,763
Posición en el área “Food and Science Technology”: 27/107
Artículo III.
M. Simonová, V. Strompfová, M.Marcinakova , A. Laukova,S.Vesterlund,
M.L. Latorre-Moratalla, S. Bover-Cid, M.C Vidal-Carou. (2006). Characterization of
Staphylococcus xylosus and Staphylococcus carnosus isolated from Slovak meat
products. Meat Science 73: 559-564.
Índice de impacto (JCR 2008): 2,183
Posición en el área “Food and Science Technology”: 17/107
117
ACTIVIDAD AMINOÁCIDO-DESCARBOXILASA DE MICROORGANISMOS
7.1.3 Resultados
118
RESULTADOS
119
ACTIVIDAD AMINOÁCIDO-DESCARBOXILASA DE MICROORGANISMOS
• Las cepas de L. curvatus junto con las de enterococos fueron las que presentaron
una actividad descarboxilasa más intensa, por lo que su uso en cultivos
iniciadores artesanales no estaría aconsejado.
120
RESULTADOS
Artículo II.
M.L. Latorre-Moratalla,S.Bover-Cid, R.Talon, M. Garriga, T. Aymerich, E. Zanardi, A.
Ianieri, M.J. Fraqueza, M. Elias, E.H. Drosinos, A. Lauková, M.C. Vidal-Carou. (2010).
Distribution of aminogenic activity among potential autochthonous starter cultures.
Journal of Food protection, 73 (3): 524-528.
Índice de impacto (JCR 2008): 1,763
Posición en el área “Food and Science Technology”: 27/107
121
524
1Departament de Nutrició i Bromatologia, Facultat de Farmàcia, Universitat de Barcelona, Avinguda Joan XXIII s/n, E-08028 Barcelona, Spain; 2Institut
National de la Recherche Agronomique, Centre de Recherches de Clermont-Ferrand-Theix, Microbiology Unit, 63 122 Saint-Genès Champanelle, France;
3Institute for Food and Agricultural Research and Technology, Finca Camps i Armet, E-17121 Monells, Spain; 4Dipartimento di Produzioni Animali,
Biotecnologie Veterinarie, Qualità e Sicurezza degli Alimenti, Università degli Studi di Parma, Via del Taglio 8, 43100 Parma, Italy; 5Dipartimento di
Scienze degli Alimenti, Università degli Studi di Teramo, Piazza Aldo Moro 45, 64100 Teramo, Italy; 6Facultade de Medicina Veterinária, Centro de
Investigação Interdisciplinar em Sanidade Animal, Av. da Universidade Técnica, Polo Universitário, Alto da Ajuda, 1300-477 Lisboa, Portugal;
7Department of Food Science and Technology, Agricultural University of Athens, 75 Iera Odos, Str., Votanikos GR-118 55, Greece; and 8Institute of Animal
ABSTRACT
Any bacterial strain to be used as starter culture should have suitable characteristics, including a lack of amino acid
decarboxylase activity. In this study, the decarboxylase activity of 76 bacterial strains, including lactic acid bacteria and gram-
positive, catalase-positive cocci, was investigated. These strains were previously isolated from European traditional fermented
sausages to develop autochthonous starter cultures. Of all the strains tested, 48% of the lactic acid bacteria strains and 13% of
gram-positive, catalase-positive cocci decarboxylated one or more amino acids. Aminogenic potential was strain dependent,
although some species had a higher proportion of aminogenic strains than did others. Thus, all Lactobacillus curvatus strains and
70% of Lactobacillus brevis strains had the capacity to produce tyramine and b-phenylethylamine. Some strains also produced
other aromatic amines, such as tryptamine and the diamines putrescine and cadaverine. All the enterococcal strains tested were
decarboxylase positive, producing high amounts of tyramine and considerable amounts of b-phenylethylamine. None of the
staphylococcal strains had tyrosine-decarboxylase activity, but some produced other amines. From the aminogenic point of view,
Lactobacillus plantarum, Lactobacillus sakei, and Staphylococcus xylosus strains would be the most suitable for use as
autochthonous starter cultures for traditional fermented sausages.
Fermentation of traditional meat products usually relies and development of flavor. Staphylococcus xylosus, Staph-
on indigenous microflora and reflects the diversity of ylococcus saprophyticus, and Staphylococcus equorum are
formulation and the manufacturing practices (39). Lactic the most common GCCz species identified (2, 36, 39). In
acid bacteria (LAB) and gram-positive, catalase-positive some traditional fermented sausages, GCCz levels, espe-
cocci (GCCz) are the two bacterial groups that are used cially those of staphylococci, can be similar to or even
most often as fermentative microbiota in traditional greater than those of LAB. This feature differentiates these
sausages. LAB are usually the main fermenters (107 to sausages from industrial products and may account for their
109 CFU/g) and are responsible for the typical acidification, appreciated sensory qualities (2). However, indigenous
with the consequent inhibition of spoilage and pathogenic microbiota and traditional manufacturing techniques do
bacteria (2, 39). The species most commonly identified in not always ensure acceptable hygienic quality of fermented
these fermented meat products are Lactobacillus sakei, sausages.
Lactobacillus curvatus, and Lactobacillus plantarum (4, 32, Biogenic amines are formed by the decarboxylation of
34). Enterococci, mainly Enterococcus faecium, also may their precursor amino acids by certain bacteria, including
constitute a large part of the microbiota of traditional enterobacteria and enterococci but also lactobacilli and
fermented sausages, with levels close to 106 CFU/g (2, 29, GCCz (38, 43). Large amounts of biogenic amines can
39), because these meat products have a relatively high pH accumulate in traditional fermented sausages (20). The
and provide ideal conditions for survival and growth of occurrence of large amounts of these substances is of
these organisms (18). concern in terms of the hygienic quality and safety of these
GCCz are the second major bacterial group (106 to 108 products (16, 38, 43). Therefore, control measures to
CFU/g) in these sausages and contribute mainly to the color minimize biogenic amine production are needed. Selected
starter cultures have been used in experimental (pilot plant)
* Author for correspondence. Tel: z34 93 402 45 08; Fax: z34 93 403 59
31; E-mail: [email protected].
and industrial production with variable success.
{ Present address: Institute for Food and Agricultural Research and Knowledge of the indigenous microbiota usually
Technology, Finca Camps i Armet, E-17121 Monells, Spain. present in traditional fermented sausages is essential for
J. Food Prot., Vol. 73, No. 3 AMINOGENIC ACTIVITY OF AUTOCHTHONOUS BACTERIA FROM FERMENTED SAUSAGES 525
TABLE 1. Occurrence of amino acid decarboxylase–positive tryptic soy broth (Oxoid) for staphylococci. Both media contained
strains among lactic acid bacteria and coagulase-negative 0.1% concentrations of the corresponding amino acid precursor (all
staphylococci tested from Merck, Darmstadt, Germany): L-tyrosine free base, L-histidine
monochlorohydrate, L-ornithine monochlorohydrate, L-tryptophan,
No. of strains No. of strains
L-lysine monochlorohydrate, and L-phenylalanine. Broth cultures
Species positive tested
of all bacterial strains were then placed in a decarboxylase medium
Lactobacillus brevis 7 10 containing the precursor amino acids (0.5%), pyridoxal-59-
L. curvatus 4 4 phosphate (Merck), and growing factors as previously described
L. fermentum 0 1 by Bover-Cid and Holzapfel (5) and incubated aerobically at 30uC
L. plantarum 0 3 for 4 days. The type and amount of biogenic amines produced were
L. sakei 0 15 determined by high-performance liquid chromatography with
Leuconostoc carnosum 2 2 postcolumn derivatization with ortho-phtaldialdehyde and fluori-
L. mesenteroides 1 2 metric detection following the procedure described by Hernández-
Weissella cibaria 0 1 Jover et al. (17).
Enterococcus faecium 7 7
E. hirae 1 1 RESULTS AND DISCUSSION
Staphylococcus carnosus 1 1 Table 1 shows the amino acid decarboxylase–positive
S. epidermidis 1 2
strains for all the species tested. Of the LAB strains, 48%
S. equorum 0 4
S. haemolyticus 0 1
produced one or more biogenic amines (11 Lactobacillus, 8
S. pasteuri 1 1 Enterococcus, and 3 Leuconostoc strains). Among lactoba-
S. saprophyticus 0 2 cilli, 100% of the L. curvatus strains and 70% of the L.
S. simulans 0 1 brevis strains were biogenic amine producers. In contrast,
S. succinus 0 1 none of the L. sakei, L. fermentum, or L. plantarum strains
S. xylosus 0 15 had amino acid decarboxylase activity. All Enterococcus
S. warneri 1 2 strains (seven E. faecium and one E. hirae) were amino acid
decarboxylase positive, as were three of the Leuconostoc
strains tested (two L. carnosum and one L. mesenteroides).
improving the hygienic quality and safety of these products.
Only 13% of the Staphylococcus strains tested were amino
Specific strains isolated from the traditional products and acid decarboxylase positive.
adapted to the ecology of traditional fermentation (i.e., low The amino acid decarboxylase activities of LAB
temperatures) could be used as autochthonous starter isolated from traditional fermented sausages are consistent
cultures, thereby maintaining the typical sensory qualities with the results reported for other LAB isolated from
of these sausages (4, 40, 44). To reduce biogenic amine various types of sausages (3, 6, 12, 25, 26, 35, 37).
accumulation, the autochthonous starter culture must not be Phenotypically, L. brevis and L. curvatus strains are usually
able to produce biogenic amines. associated with tyramine production in fermented meat
The main objective of the European project Tradisau- products and in some cases with production of phenyleth-
sage (42) was to improve the quality and safety of European ylamine, tryptamine, putrescine, and cadaverine (3, 5). In
traditional fermented sausages. In the frame of this project, contrast, L. plantarum and L. sakei strains are more
the present study was conducted (i) to determine the amino frequently reported as nonaminogenic (3, 6). Genes coding
acid decarboxylase activity of several strains of the for tyrosine decarboxylase (tdc genes) have been identified
dominant fermentative bacteria (LAB and GCCz) isolated in several strains of L. brevis (GenBank accession
from traditional dry fermented sausages and (ii) to identify no. EF371897.1, EF371896.1, and AF446085.5) and L.
the best candidates for possible further use as autochthonous curvatus (EF371895.1, AJ871286.1, AF354231.1, and
starter cultures to minimize the risk of biogenic amine AB086652.1). The partial sequence of tdc genes also has
accumulation in this type of food product. been described for an L. plantarum strain (EF178285.1). To
our knowledge, the presence of tdc genes has not been
MATERIALS AND METHODS described to date in any L. sakei strain. However, in L. sakei
Bacterial strains. Decarboxylase activity was assessed for 76 strain 23K, molecular techniques have confirmed that the
strains of LAB (including lactobacilli, enterococci, Leuconostoc, absence of the tdc gene in its genome (8).
and Weissella) and staphylococci, all isolated from several types of Some studies have confirmed the ability of some
traditional fermented sausages. Table 1 summarizes the number of Leuconostoc strains to form biogenic amines (9, 15, 27),
strains of each species studied. The strains examined were while other Leuconostoc strains did not (3, 5). In contrast,
provided by the partners involved in the Tradisausage project enterococci are extensively reported to have aminogenic
(France, Spain, Portugal, Italy, Greece, and Slovakia) (42), who
potential, mainly as tyramine and phenylethylamine pro-
isolated and identified these strains by molecular methods (2, 3, 14,
ducers (6, 25, 38). The tdc gene has been described in
33, 45).
several strains of Enterococcus faecalis (AF371893,
Determination of biogenic amine–forming capacity. To AE016830, and AF354231) (10), E. hirae (AY303667)
promote enzyme induction before the decarboxylase test (5), (11), and E. faecium (EF371894 and AJ83966) (21). In
strains were subcultured four times at 30uC for 24 h in de Man contrast to the tyrosine specificity of L. brevis decarboxyl-
Rogosa Sharpe broth (Oxoid, Cambridge, England) for LAB and in ase (28), enterococci are nonselective for tyrosine and can
526 LATORRE-MORATALLA ET AL. J. Food Prot., Vol. 73, No. 3
TABLE 2. Quantification of biogenic amine production by decarboxylase-positive lactic acid bacteria and coagulase-
negative staphylococci
Amine production (mg/liter)a
decarboxylate phenylalanine (21). This finding is in amine (up to 1,000 mg/liter). In contrast, all strains of L.
agreement with the high frequency of simultaneous brevis and some of L. curvatus produced at least 10-fold
production of tyramine and phenylethylamine by entero- lower amounts of tyramine and b-phenylethylamine.
coccal strains. Decarboxylase-positive species of staphylococci did not
Staphylococcus species usually are described as weak produce tyramine. Depending on the species, these strains
or negative for decarboxylase activity (6, 25, 36). Martı́n et produced b-phenylethylamine, tryptamine, putrescine, and
al. (23) found this activity in only 35 of 240 strains, cadaverine. Usually the production of b-phenylethylamine
including strains of S. xylosus, S. warneri, S. epidermidis, and tryptamine is associated with high occurrence of
and S. carnosus. Martuscelli et al. (24) reported that 50% of tyramine (36), but for S. carnosus the production of these
the S. xylosus strains tested were only weak producers of amines was not related to that of tyramine. Although there
biogenic amines. However, some researchers have described was not a general trend, other authors also found this
staphylococci as having a remarkable potential to form particular profile of amines produced by S. carnosus (1, 12).
biogenic amines (26, 35, 37). The genetic potential for E. faecium strains also produced low amounts of tryptamine,
the tyrosine decarboxylase enzyme has been partially but this finding is consistent with the presence of tryptamine
sequenced in an S. epidermidis strain (EF371899) and S. in fermented sausages when there are high amounts of
xylosus (41). tyramine. Putrescine and cadaverine production was less
In addition to determining whether various bacteria extensive; only two strains of L. curvatus and one of
produce biogenic amines, the level of such production is Staphylococcus pasteuri and S. warneri produced these
also of interest. Table 2 shows the quantitative results for diamines, especially putrescine (Table 2). In the present
biogenic amine accumulation in the fermenting broth by the study, none of the species tested produced histamine.
amine-positive strains. All LAB strains formed tyramine and Histidine decarboxylase activity seems to be limited to some
b-phenylethylamine; the strongest tyrosine decarboxylase specific strains of contaminant species (22, 30, 41). The
species were E. faecium, L. carnosum, and two strains of L. results of the present work agree with other published data
curvatus, all of which produced levels higher than 2,000 on decarboxylase activity of Lactobacillus (3, 6, 7, 12, 31),
mg/liter in most cases. All of these strains also showed the Leuconostoc (31), Enterococcus (6, 13, 21), and Staphylo-
capacity to produce moderate amounts of b-phenylethyl- coccus (23, 25) strains found in fermented sausages.
J. Food Prot., Vol. 73, No. 3 AMINOGENIC ACTIVITY OF AUTOCHTHONOUS BACTERIA FROM FERMENTED SAUSAGES 527
On the basis of these results regarding biogenic amine 10. Connil, N., Y. Le Breton, X. Douset, Y. Auffray, A. Rincé, and H.
production, enterococci and some strains of Lactobacillus Prévost. 2002. Identification of the Enterococcus faecalis tyrosine
decarboxylase operon involved in tyramine production. Appl.
usually found in dry fermented sausages (e.g., L. curvatus) Environ. Microbiol. 68:3537–3544.
would not be suitable candidates for starter cultures for 11. Coton, M., E. Coton, P. Lucas, and A. Lonvaud. 2004. Identification
traditional fermented sausages. In contrast, L. sakei and L. of the gene encoding a putative tyrosine decarboxylase of
plantarum strains (among the LAB) and S. xylosus and S. Carnobacterium divergens 508. Development of molecular tools for
equorum (among the GCCz) would be the most appropriate the detection of tyramine-producing bacteria. Food Microbiol. 21:
125–130.
candidates to be used as autochthonous starters. However, to
12. De las Rivas, B., C. Ruiz-Capillas, A. V. Carrascosa, J. A. Curiel, F.
maintain the sensory properties of traditional sausages, the Jiménez-Colmenero, and R. Muñoz. 2008. Biogenic amine produc-
use of more complex mixed starter cultures than those used tion by gram-positive bacteria isolated from Spanish dry cured
in industrial procedures would be desirable. For this ‘‘chorizo’’ sausage treated with high pressure and kept in chilled
purpose, the contribution of other weak amine-producing storage. Meat Sci. 80:272–277.
bacteria, such as L. brevis or some strains of staphylococci, 13. Gardini, F., M. Martuscelli, M. A. Crudele, A. Paparella, and G.
Suzzi. 2002. Use of Staphylococcus xylosus as a starter culture in
could be considered. L. curvatus also could be used, but the dried sausages: effect on the biogenic amine content. Meat Sci. 61:
heterogeneous distribution of aminogenic potential among 275–283.
strains of this species confirms that amino acid decarbox- 14. Giammarinaro, P., S. Leroy, J. P. Chacornac, J. Delmas, and R.
ylase activity is a strain-dependent property. Thus, the Talon. 2005. Development of a new oligonucleotide array to identify
amino acid decarboxylase activity of any strain intended to staphylococcal strains at species level. J. Clin. Microbiol. 43:3673–
3680.
be used as a starter culture must be tested case by case. The
15. Gonzalo de llano, D., P. Cuesta, and A. Rodriguez. 1998. Biogenic
behavior of the selected strain(s) also must be assessed in amine production by wild lactococcal and Leuconostoc strains. Lett.
the real product under the actual processing conditions. This Appl. Microbiol. 26:270–274.
was the aim of further studies carried out within the frame of 16. Halasz, A., A. Barath, L. Simon-Sarkadi, and W. H. Holzapfel. 1994.
the European Tradisausage project (19, 40, 42). Biogenic amines and their production by microorganisms in food.
Trends Food Sci. Technol. 5:42–49.
ACKNOWLEDGMENT 17. Hernández-Jover, T., M. Izquierdo-Pulido, M. T. Veciana-Nogués,
and M. C. Vidal-Carou. 1996. Ion-pair high-performance liquid
This study received financial support from the European Tradisausage chromatographic determination of biogenic amines in meat and meat
project. products. J. Agric. Food Chem. 44:2710–2715.
18. Hugas, M., M. Garriga, and T. Aymerich. 2003. Functionality of
REFERENCES enterococci in meat products. Int. J. Food Microbiol. 88:223–233.
19. Latorre-Moratalla, M. L., S. Bover-Cid, R. Talon, M. Garriga, E.
1. Ansorena, D., M. C. Montel, M. Rokka, R. Talon, S. Enrola, A.
Zanardi, A. Ianieri, M. J. Fraqueza, M. Elias, E. H. Drosinos, and M.
Rizzo, M. Raemaekers, and D. Demeyer. 2002. Analysis of biogenic
C. Vidal-Carou. 2009. Strategies to reduce biogenic amine accumu-
amines in northern and southern European sausages and role of flora
lation in traditional sausage manufacturing. LWT Food Sci. Technol.
in amine production. Meat Sci. 61:141–147.
43:20–25.
2. Aymerich, T., B. Martin, M. Garriga, and M. Hugas. 2003. Microbial
20. Latorre-Moratalla, M. L., M. T. Veciana-Nogués, S. Bover-Cid, M.
quality and direct PCR identification of lactic acid bacteria and non-
Garriga, T. Aymerich, E. Zanardi, A. Ianieri, M. J. Fraqueza, L.
pathogenic staphylococci from artisanal low-acid sausages. Appl.
Patarata, E. H. Drosinos, A. Laukova, R. Talon, and M. C. Vidal-
Environ. Microbiol. 69:4583–4594.
3. Aymerich, T., B. Martin, M. Garriga, M. C. Vidal-Carou, S. Bover- Carou. 2008. Biogenic amines in traditional fermented sausages
Cid, and M. Hugas. 2006. Safety properties and molecular strain produced in selected European countries. Food Chem. 107:912–
typing of lactic acid bacteria from slightly fermented sausages. J. 921.
Appl. Microbiol. 100:40–49. 21. Maijala, R., and S. Eerola. 1993. Contaminant lactic acid bacteria of
4. Benito, M. J., A. Martı́n, E. Aranda, F. Pérez-Nevado, S. Ruiz- dry sausages produces histamine and tyramine. Meat Sci. 35:387–
Moyano, and M. Córdoba. 2007. Characterization and selection of 395.
autochthonous lactic acid bacteria isolated from traditional Iberian 22. Marcobal, A., B. de las Rivas, and R. Muñoz. 2006. First genetic
dry-fermented Salchichón and chorizo sausages. J. Food Sci. 72:193– characterization of a bacterial b-phenylethylamine biosynthetic
201. enzyme in Enterococcus faecium RM58. FEMS Microbiol. Lett.
5. Bover-Cid, S., and W. H. Holzapfel. 1999. Improved screening 258:144–149.
procedure for biogenic amine production by lactic acid bacteria. Int. 23. Martı́n, B., M. Garriga, M. Hugas, S. Bover-Cid, M. T. Veciana-
J. Food Microbiol. 53:33–41. Nogues, and T. Aymerich. 2006. Molecular, technological and safety
6. Bover-Cid, S., M. Hugas, M. Izquierdo-Pulido, and M. C. Vidal- characterization of gram-positive catalase-positive cocci from slightly
Carou. 2001. Amino acid–decarboxylase activity of bacteria isolated fermented sausages. Int. J. Food Microbiol. 107:148–158.
from fermented pork sausages. Int. J. Food Microbiol. 66:185–189. 24. Martuscelli, M., M. A. Crudele, F. Gardini, and G. Suzzi. 2000.
7. Bover-Cid, S., M. J. Miguélez-Arrizado, S. Becker, W. H. Holzapfel, Biogenic amine formation and oxidation by Staphylococcus xylosus
and M. C. Vidal-Carou. 2008. Amino acid decarboxylation by strains from artisanal fermented sausages. Lett. Appl. Microbiol. 31:
Lactobacillus curvatus CTC273 affected by the pH and glucose 228–232.
availability. Food Microbiol. 25:269–277. 25. Masson, F., L. Eclache, T. Compte, R. Talon, and M. C. Montel.
8. Chaillou, S., M. C. Champomier-Vergès, M. Cornet, A. M. Crutz Le 1996. Qui produit des amines biogènes dans les produits carnés?
Coqu, A. M. Dudez, V. Martin, S. Beaufils, R. Bossy, E. Darbon- [What produces biogenic amines in meat products?] Viandes Prod.
Rongère, V. Loux, and M. Zagorec. 2005. Complete genome Carnes 17:287–289.
sequence of the meat born lactic acid bacterium Lactobacillus sakei 26. Montel, C., F. Masson, and R. Talon. 1999. Comparison of biogenic
23K. Nature Biotechnol. 23:1527–1533. amine content in traditional and industrial French dry sausages. Sci.
9. Choudhury, N. W., D. Hansen, D. Engesser, W. P. Hammes, and W. Aliments 19:247–254.
H. Holzapfel. 1990. Formation of histamine and tyramine by lactic 27. Moreno-Arribas, M. V., and A. Lonvaud-Funel. 2001. Purification
acid bacteria in decarboxylase assay medium. Lett. Appl. Microbiol. and characterization of tyrosine decarboxylase of Lactobacillus brevis
11:278–281. IOEB 9809 isolated from wine. FEMS Microbiol. Lett. 195:103–107.
528 LATORRE-MORATALLA ET AL. J. Food Prot., Vol. 73, No. 3
28. Moreno-Arribas, M. V., M. C. Polo, F. Jorganes, and R. Muñoz. 2003. 38. Suzzi, G., and F. Gardini. 2003. Biogenic amines in dry fermented
Screening of biogenic amine production by lactic acid bacteria isolated sausages: a review. Int. J. Food Microbiol. 88:41–54.
from grape must and wine. Int. J. Food Microbiol. 84:117–123. 39. Talon, R., S. Leroy, and I. Lebert. 2007. Microbial ecosystems of
29. Paramithiotis, S., D. Kagkli, V. Blana, G. Nychas, and E. Drosinos. traditional fermented meat products: the importance of indigenous
2008. Identification and characterization of Enterococcus spp. in Greek starters. Meat Sci. 77:55–62.
spontaneous sausage fermentation. J. Food Prot. 71:1244–1247. 40. Talon, R., S. Leroy, I. Lebert, P. Giammarinaro, J. P. Chacornac, M.
30. Paulsen, P., and F. Bauer. 1997. Biogenic amines in fermented L. Latorre-Moratalla, M. C. Vidal-Carou, E. Zanardi, M. Conter, and
sausages. II. Factors influencing the formation of biogenic amines in A. Lebecque. 2008. Safety improvement and preservation of typical
fermented sausages. Fleischwirtschaft Int. 77:32–34. sensory qualities of traditional dry fermented sausages using
31. Pircher, A., F. Bauer, and P. Paulsen. 2007. Formation of cadaverine, autochthonous starter cultures. Int. J. Food Microbiol. 126:227–234.
histamine, putrescine and tyramine by bacteria isolated from meat, 41. Torriani, S., V. Gatto, S. Sembeni, R. Tofalo, G. Suzzi, N. Belletti, F.
fermented sausages and cheese. Eur. Food Res. Technol. 226:225–231. Gardini, and S. Bover-Cid. 2008. Rapid detection and quantification
32. Rantsiou, K., E. Drosinos, M. Gialitaki, I. Metaxopoulos, G. Comi, of tyrosine decarboxylase gene (tdc) and its expression in gram-
and L. Cocolin. 2006. Use of molecular tools to characterize positive bacteria associated with fermented foods using PCR-based
Lactobacillus spp. isolated from Greek traditional fermented methods. J. Food Prot. 71:93–101.
sausages. Int. J. Food Microbiol. 112:215–222.
42. Tradisausage. 2003. Assessment and improvement of safety of
33. Rossi, F., R. Tofalo, S. Torriani, and G. Suzzi. 2001. Identification by
traditional dry sausages from producers to consumers. European
16S-23S rDNA intergenic region amplification, genotypic and
Commission research proposal QLK1 CT-2002-02240. Institut
phenotypic clustering of Staphylococcus xylosus strains from dry
National de la Recherche Agronomique, Saint-Genès Champanelle,
sausages. J. Appl. Microbiol. 90:365–371.
France. Available at: www.clermont.inra.fr/tradisausage/. Accessed
34. Santos, E. M., C. González-Fernández, I. Jaime, and J. Rovira. 1998.
19 October 2009.
Comparative study of lactic acid bacteria house flora isolated in
43. Vidal-Carou, M. C., T. Veciana-Nogués, M. L. Latorre-Moratalla,
different varieties of ‘‘chorizo.’’ Int. J. Food Microbiol. 39:123–128.
and S. Bover-Cid. 2007. Biogenic amines: risks and control, p. 455–
35. Silla-Santos, H. 1998. Amino acid decarboxylase capability of
468. In F. Toldrá (ed.), Handbook of fermented meat and poultry.
microorganisms isolated in Spanish fermented meat products. Int. J.
Blackwell Publishing Professional, Ames, IA.
Food Microbiol. 39:227–230.
36. Simonová, M., V. Strompfová, M. Marciňáková, A. Lauková, S. 44. Villani, F., A. Casaburi, C. Pennacchia, L. Filosa, F. Russo, and D.
Vesterlund, M. L. Latorre-Moratalla, S. Bover-Cid, and M. C. Vidal- Ercolini. 2007. Microbial ecology of the Soppressata of Vallo di
Carou. 2006. Characterization of Staphylococcus xylosus and Diano, a traditional dry fermented sausage from southern Italy, and in
Staphylococcus carnosus isolated from Slovak meat products. Meat vitro and in situ selection of autochthonous starter cultures. Appl.
Sci. 73:559–564. Environ. Microbiol. 73:5453–5463.
37. Straub, B. W., M. Kicherer, S. M. Schilcher, and W. P. Hammes. 45. Woodford, N., C. M. Egelton, and D. Morrison. 1997. Comparison of
1995. The formation of biogenic amines by fermentation organisms. PCR with phenotypic methods for the speciation of enterococci. Adv.
Z. Lebensm.-Unters. -Forsch. 201:79–82. Exp. Med. Biol. 418:405–408.
RESULTADOS
Artículo III.
M. Simonová, V. Strompfová, M.Marcinakova , A. Laukova,S.Vesterlund, M.L. Latorre-
Moratalla, S. Bover-Cid, M.C Vidal-Carou. (2006). Characterization of Staphylococcus
xylosus and Staphylococcus carnosus isolated from Slovak meat products. Meat Science
73: 559-564.
Índice de impacto (JCR 2008): 2,183
Posición en el área “Food and Science Technology”: 17/107
129
MEAT
SCIENCE
Meat Science 73 (2006) 559–564
www.elsevier.com/locate/meatsci
Received 18 September 2005; received in revised form 12 December 2005; accepted 8 February 2006
Abstract
The aims of this study were to isolate, identify and characterize the population of coagulase-negative staphylococci in different types
of Slovak traditional sausages and to determine the metabolic properties of selected Staphylococcus xylosus and S. carnosus strains for
the selection of potential starter cultures to use in the processing of sausages. The strains were tested for lactic acid production, survival in
the presence of bile and sensitivity to antibiotics. Bacteriocin production, adhesion ability as well as biogenic amine (BA) production by
isolates were also analysed. Most of the isolates were identified as S. xylosus and S. carnosus. Lactic acid values ranged from 0.40 to
1.03 mmol/l and strains survived in the presence of 1% bile. Most of the strains studied were sensitive to all antibiotics. Two strains,
S. xylosus SO3/1M/1/2 and S. carnosus SO2/F/2/5 inhibited Listeria innocua and Pseudomonas sp. S. xylosus strains did not produce
any BA, while S. carnosus SO2/F/2/5 did. S. xylosus SO3/1M/1/2 and S. carnosus SO2/F/2/5 appeared as the most adhesive strains.
S. xylosus SO3/1M/1/2 with antimicrobial activity against Enterococcus avium EA5, L. innocua LMG13568 and Pseudomonas sp.
SO1/1M/1/4, adhesion ability and free BA production could be used as starter culture in sausage manufacture.
Ó 2006 Elsevier Ltd. All rights reserved.
0309-1740/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved.
doi:10.1016/j.meatsci.2006.02.004
560 M. Simonová et al. / Meat Science 73 (2006) 559–564
Montel, 1997). S. xylosus and S. carnosus are commonly for 30 s, 58 °C for 30 s, 72 °C for 30 s, 72 °C for 5 min. A
used lipolytic starter cultures for fermented sausage (Jessen, Techgene KRD thermocycler (Techne, UK) was used for
1995). Organoleptic quality of meat products is also depen- all samples. The PCR products (10 lL of each) were sepa-
dent on the proteolytic activity of the starter cultures. Abil- rated by electrophoresis in 0.8% agarose gels (SIGMA,
ity of CNS to produce bacteriocins is also well known Germany) buffered with 1xTAE (Merck, Germany) con-
(Lauková & Mareková, 1993); this property may be impor- taining 1 lg/mL ethidium bromide (SIGMA). The molecu-
tant for the safety of sausages. On the other hand, safety of lar mass standard (Promega, USA) was used according to
these products for consumers also depends on the content the manufacturer‘s instructions.
of biogenic amines (BA), such as histamine, tyramine,
phenyletylamine and tryptamine, which might represent a 2.2. Sensitivity to oxgall bile, lactic acid production and
food poisoning hazard (Halász, Baráth, Simon-Sarkadi, & antibiotic profil
Holzapfel, 1994). The production of BA requires the pres-
ence of amino acid-decarboxylating microorganisms, which Resistance to bile was tested according to Gilliland and
are usually detected in dry fermented sausages during the Walker (1990). Brain Heart Infusion broth (BHI, Becton &
fermentation process (Bover-Cid, Schoppen, Izquierdo- Dickinson) was prepared by the addition of 1% (w/v)
Pulido, & Vidal-Carou, 1999). oxgall (Becton & Dickinson). The volume 50 ll of an
The purpose of this study was to isolate the strains of S. 18 h culture of each strain was added to 5 ml of BHI broth
xylosus and S. carnosus from Slovak traditional meat prod- with oxgall. After incubation at 37 °C for 24 h, the bacte-
ucts and characterize their metabolic properties: antibiotic rial growth of strains was measured using a spectropho-
sensitivity, tolerance to oxgall bile, lactic acid production, tometer (Spekol 11, Jena, Germany) at 600 nm. Numbers
adhesion and amino acid-decarboxylase activity as well of viable cells were estimated at 0 h and after 24 h of incu-
as their ability to produce bacteriocins with the aim to bation on MSA agar.
select a new optimal starter culture. The ability to produce lactic acid was measured accordig
to Pryce (1969) and expressed in mmol/l.
2. Materials and methods Antibiotic resistance of isolated staphylococci was tested
by the agar disc diffusion method on Columbia agar (Bec-
2.1. Isolation, bacterial counts and identification of bacteria ton & Dickinson) with 10% of defibrinated sheep blood.
The following antibiotic discs (Becton & Dickinson) were
Staphylococci were isolated from four traditional Slo- used: clindamycin (2 lg), erythromycin, methicilin, neomy-
vak meat products. The strains were selected by standard cin (5 lg), ampicillin, tobramycin, lincomycin (10 lg), gen-
microbiological methods using appropriate dilutions in tamycin, chloramphenicol, novobiocin, rifampicin,
Buffered Peptone Water (Biomark, India). Dilutions were tetracycline, vancomycin and amoxicillin (30 lg). After
plated onto Mannitol Salt agar plates (MSA, Becton & incubation at 37 °C for 18 h, the strains were classified as
Dickinson, Cockeysville, USA) and incubated at 37 °C resistant or sensitive (by comparing the size of the inhibi-
for 24 h. After incubation, the colony forming units (cfu) tory zones in mm).
were counted. Then, 187 colonies of staphylococci (includ-
ing all samples) were randomly picked and maintained on 2.3. Bacteriocin and amino acid-decarboxylase activity of
MSA agar for further identification and testing. For selected isolates
DNA preparation, the strains were cultivated on MSA
agar at 37 °C for 24 h and checked for purity. DNA from Bacteriocin activity was tested by the agar spot test (De
each strain was obtained by the following procedure: one Vuyst, Callevart, & Crabbe, 1996). A cell-free supernatant
loopfull of bacterial colony (10 ll) was resuspended in was prepared by centrifuging 1 mL of a 18 h culture (BHI,
30 ll H2O and vortexed for 10 min. Then, the supernatants Becton & Dickinson ) of tested strains (10,000g for 30 min).
were used as template DNA. One ll of the template was Generally, Brain Heart Infusion supplemented with 1.5%
added to 24 ll of the reagent mixture which contained agar (for Gram-positive indicator bacteria) and Trypticase
0.5 lM of each primer, 0.2 mM of each deoxynucleotide Soy agar (for Gram-negatives, Becton & Dickinson) were
(dATP, dTTP, dCTP, dGTP – dNTPs, Invitrogen), used for the bottom agar layer. For overlay, the same types
2.5 mM MgCl2 (Invitrogen), 10xPCR buffer (Invitrogen), of media (0.7% concentration) of soft agar were prepared.
1.25 U Taq polymerase (Invitrogen), and water to a total Plates were incubated overnight at 37 °C. Principal indica-
volume of 25 lL. The sequences of the primer pairs used tor bacteria Enterococcus avium EA5 (our isolate from pig-
for PCR-amplification of staphylococci were as follows: lets), S. aureus SA5 (our isolate from cow milk), Listeria
for S. xylosus 5 0 -AAGTCGGTTGAAAACCTAAA-3 0 innocua LMG13568 (supplied by Prof. L. DeVuyst, Uni-
and 5 0 -CATTGACATATTGTATTCAG-3 0 , for S. carno- versity of Brussel, Belgium), L. monocytogenes CCM4699
sus 5 0 -GAACCGCATGGTTCTGCAA-3 0 and 5 0 -CCGT- (Czech Collection of Microorganisms, Brno, Czech Repub-
CAAGGTGCGCATAGT-3 0 (Aymerich, Martı́n, Garriga, lic), Pseudomonas sp. SO1/1M/1/4 and Escherichia coli
& Hugas, 2003). The amplification protocol was as follows: (our isolates from fermented meat products) were
initial denaturation at 96 °C for 3 min, 35 cycles of 95 °C used for bacteriocin activity determination. Brain Heart
M. Simonová et al. / Meat Science 73 (2006) 559–564 561
Infusion and Trypticase Soy broth (Becton & Dickinson) 3.2. Metabolic properties of isolates
were used for the growth of the indicator strains. Bacterio-
cin activity was defined as the reciprocal of the highest two- Staphylococci were able to grow in the presence of 1%
fold dilution demonstrating complete inhibitory activity of oxgall (bile) reaching 106–107 cfu/ml in comparison with
the indicator strain and was expressed in arbitrary units per the control growth (108–109 cfu/ml) in oxgall-free broth.
millilitre (AU/ml) of culture medium. The ability of the tested strains to survive in broth with
Amino acid-decarboxylase activity of bacteria was 1% oxgall (bile) varied between 54% and 99%.
assessed by the presence of biogenic amines in a decarbox- Lactic acid (LA) production of S. xylosus isolates ran-
ylase broth as described by Bover-Cid and Holzapfel ged from 0.40 to 1.03 mmol/l. The lowest (0.40 mmol/l)
(1999). was found in SO3/Z/2/1 and the highest in SO1F/1/1.
The medium (pH 5.2) contained the precursor amino LA values of S. carnosus varied from 0.51 to 0.79 mmol/l.
acids (0.5% tyrosine di-sodium salt and 0.25% L-histidine Seventy-one percent (84 isolates) of all tested strains of
monohydrochloride, L-ornithine monohydrochloride, L- S. xylosus, were sensitive to all antibiotics tested. Staphylo-
lysine monohydrochloride, L-phenylalanine and L-trypto- coccal isolates showed sensitivities of 99% to novobiocin,
phan), pyridoxal-5-phosphate as a codecarboxylase factor, methicillin, ampicillin and rifampicin. Resistance of 4%
growing factors and buffer compounds. Biogenic amines, of the tested strains was found to lincomycin, amoxicillin,
tyramine (TY), phenyletylamine (PHE), putrescine (PU), clindamycin and tetracycline. Five percent of staphylococci
histamine (HI), cadaverine (CA) and tryptamine (TRY) were resistant to phosphomycin, 11% to tobramycin and
were determined by ion-pair high-performance liquid chro- 19% of isolates were resistant to neomycine. Among the
matography and post-coloumn derivatization with ortho- tested S. carnosus isolates all were sensitive, except S. car-
phtalaldehyde according to Hernández-Jover, Izquierdo- nosus SO2/F/2/5 which was resistant to chloramphenicol,
Pulido, Veciana-Nogués, and Vidal-Carou (1996). amoxicillin and neomycine.
Table 1
Adhesion, decarboxylase and bacteriocin activities of taphylococcus xylosus and S. carnosus strains
Activity S. xylosus S.carnosus
SO1/1M/2b SO2/2M/2a SO3/1M/1/2 SO2/F/2/5
Bacteriocin activity (AU/ml)
Enterococcus avium EA5a 100 100 100 100
S. aureus SA5b – – – –
Listeria monocytogenes CCM4699c – – – –
L. innocua LMG13568d – – 400 100
Pseudomonas sp. SO1/1M/1/4e (100)f (100) (100) (100)
Escherichia colie – – – –
Biogenic amines (mg/l)
Tyramine (TY) – – – +++
Phenyletylamine (PHE) – – – ++
Tryptamine (TRM) – – – ±g
Putrescine (PU) – – – –
Histamine (HI) – – – –
Cadaverine (CA) – – – –
Adhesion assay (%) 0.28 ± 0.15 0.24 ± 0.14 7.17 ± 0.48 10.87 ± 2.64
a
Our isolate from faeces of piglet.
b
Our isolate from cow milk.
c
Czech collection of microorganisms, Brno, Czech Republic.
d
Supplied by Prof. L. DeVuyst (University of Brussel), Belgium.
e
Our isolates from fermented meat products.
f
Unclear zone.
g
+++, 1000–2500 mg/l; ++, 100–1000 mg/l; ±, <50 mg/l; –, Not detected.
S. xylosus is the dominating CNS species in many Ital- (Neu, 1992; Perreten, Giamp, Schuler-Schmid, & Teuber,
ian and Spanish sausages (Blaiotta et al., 2004; Coppola, 1998). Moschetti, Mauriello, and Villani (1997) found no
Iorizzo, Saotta, Sorrentino, & Grazia, 1997; Garcı́a-Var- strain was resistant to vancomycin, chloramphenicol and
ona, Santos, Jaime, & Rovira, 2000), but in traditional rifampicin and only one strain (among 30) was resistant
Greek sausages, S. saprophyticus and S. carnosus are the to gentamycin, isolated from Italian sausages. These
most frequent bacterial strains (Papamanoli, Kotzekidou, authors also reported the low resistance of tested strains
Tzanetakis, & Litopolou-Tzanetaki, 2002). We achieved to gentamycin (3%), which is in agreement with our results.
similar results of genotypic identification to those presented Similarly, Maurellio, Moschetti, Villani, Blaiotta, and
by Blaiotta et al. (2004). Coppola (2000) described the sensitivity of CNS from arti-
Survival ability of isolates in the presence of oxgall bile sanal Naples-type salami to methicillin, vancomycin, chlor-
is important to select probiotic strains. Although, studies amphenicol and rifampicine and lower resistance was
about this property of enterococci and lactic acid bacteria observed to gentamycin and neomycin. In both studies,
of milk and meat origin have been published (Vinderola resistance to lincomycin, novobiocin (64%), neomycin,
& Reinheimer, 2003), information about staphylococci erythromycin (50%) and tetracycline (21%; 30%) was
are limited. On the one hand, in the case of staphylococci found; our isolates showed no or less resistance to these
attention is focused on their survival in salt and acidic envi- antibiotics. Surprisingly, commonly novobiocin-resistant
ronments; these conditions are required during fermenta- S. xylosus (especially from animal sources) was found to
tion, ripening and storing of meat products. Mauriello, be novobiocin-sensitive at 30 lg concentration. Unexpect-
Casaburi, Blaiotta, and Villani (2004) described good sur- edly, we found a different (low) percentage of resistance
viving ability of CNS isolated from Italian sausage at low to erythromycin, lincomycin and tetracycline, the presence
temperature, in the presence of 15% NaCl at several of tetracycline- and erythromycin-resistant genes is well
pH’s. Vinderola and Reinheimer (2003) reported the known (Milton, Hewitt, & Harwood, 1992; Schwartz &
growth of commercial and collection probiotic strains, such Noble, 1994). However, prevalence of antibiotic sensitivity
as Lactobacillus acidophilus A13, A14, LB, BRA, L. casei is a good criteria to select bacteria for their industrial (star-
CNRZ 1874 and L. rhamnosus A15, A16 and LS; results ter culture) use.
that are in agreement with those achieved by ourselves. It Lactic acid bacteria as well as staphylococci can inhibit
can be regarded as bile stable, but further studies are the growth of pathogens and spoilage organisms during
needed before these strains may be considered probiotic food fermentation by natural antimicrobial substances,
starter meat cultures. e.g., organic acids, diacetyl and bacteriocins (Klaenham-
CNS arises mainly from human and animal environ- mer, 1993; Villani et al., 1997). Lactic acid production leads
ments and several studies have reported the presence of to a decrease in pH, that can ensure the stability of prod-
antibiotic resistant genes in CNS isolated from food ucts. Values of lactic acid produced by CNS from Slovak
M. Simonová et al. / Meat Science 73 (2006) 559–564 563
traditional meat products correspond with our previous properties (antibiotic profile, oxgall, lactic acid production)
results for staphylococci from feed and animal sources of isolates was already reported in Proceedings of Lectures
(Lauková & Kmet’, 1992; Lauková, 1993). The presence and Posters, Hygiena Alimentorum XXVI, May 25-27,
of the most frequently found pathogens, e.g., S. aureus, 2005, Štrbské Pleso – Vysoké Tatry, Slovakia. We are
L. monocytogenes, E. coli and Salmonella can be controlled grateful to Mrs. Margita Bodnárová for her skilfull techni-
by a combination of low pH, competitive exclusion with cal assistance. We are also grateful to Mäso – Spiš, Ing. Jo-
starter cultures and/or bacteriocin production. The antimi- zef Teliška for providing traditional meat products.
crobial spectrum of bacteriocin-like substances produced
by rumen staphylococci was observed by Lauková and References
Mareková (1993). Villani et al. (1997) also described the
inhibitory activity of an antagonistic substance produced Aymerich, T., Martı́n, B., Garriga, M., & Hugas, M. (2003). Microbial
by S. xylosus 1E against L. monocytogenes and other quality and direct PCR identification of lactic acid bacteria and
Gram-positive bacteria; these results correspond to ours, nonpathogenic staphylococci from artisanal low-acid sausages. Journal
of Applied and Environmental Microbiology, 69(8), 4583–4594.
although the authors reported higher inhibitory activity
Barriére, C., Centeno, D., Lebert, A., Leroy-Sétrin, S., Berdagué, J. L., &
for their isolate. The growth inhibition of L. monocytogenes Talon, R. (2001). Roles of superoxide dismutase and catalase of
by the bacteriocin-like substance produced by staphylo- Staphylococcus xylosus in the inhibition of linoleic acid oxidation.
cocci in this study may provide added control against FEMS Microbiology Letters, 201, 181–185.
pathogens in traditional sausages. Blaiotta, G., Pennacchia, C., Villani, F., Ricciardi, A., Tofalo, R., &
Parente, E. (2004). Diversity and dynamics of communities of
Adhesion to the intestinal mucus is one of the main
coagulase-negative staphylococci in traditional fermented sausages.
selection criteria for probiotics (Ouwehand, Tuomola, Journal of Applied Microbiology, 97, 271–284.
Tölkkö, & Salminen, 2001). The adhesive properties of Bover-Cid, S., & Holzapfel, W. H. (1999). Improved screening procedure
staphylococci have received little attention. Therefore, this for biogenic amine production by lactic acid bacteria. International
study investigated the adhesive capacity of selected S. xylo- Journal of Food Microbiology, 53, 33–41.
sus and S. carnosus isolates from traditional sausages to Bover-Cid, S., Schoppen, S., Izquierdo-Pulido, M., & Vidal-Carou, M. C.
(1999). Relationship between biogenic amine contents and the size of
human intestinal mucus. As found for enterococci by Lau- dry fermented sausages. Meat Science, 51, 305–311.
ková, Strompfová, and Ouwehand (2004), our isolates, Bover-Cid, S., Hugas, M., Izquierdo-Polido, M., & Vidal-Carou, M.
tested for adhesion ability to mucus were found to be (2001). Amino acid decarboxylase activity of bacteria isolated from
strain-dependent; that is, among the same species, different fermented pork sausages. International Journal of Food Microbiology,
66, 185–189.
adhesive capabilities were detected.
Casaburi, A., Blaiotta, G., Mauriello, G., Pepe, O., & Villani, F. (2005).
The amount and type of biogenic amines (BA) depends Technological activities of Staphylococcus carnosus and Staphylococcus
on the nature of the food and the microorganisms. In the simulans strains isolated from fermented sausages. Meat Science, 71,
present work, no BA formation was found in the S. xylosus 643–650.
strains, but S. carnosus SO2/F/2/5 produced TY, PHE and Coppola, R., Iorizzo, M., Saotta, R., Sorrentino, E., & Grazia, L. (1997).
small amounts of TRY. Similar results of BA production by Characterization of micrococci and staphylococci isolated from
Soppressata molisana, a Southern Italy fermented sausage. Food
S. xylosus strains were recorded by several authors (Bover- Microbiology, 14, 47–53.
Cid, Hugas, Izquierdo-Polido, & Vidal-Carou, 2001; Casa- De Vuyst, L., Callevart, R., & Crabbe, K. (1996). De Primary metabolite
buri, Blaiotta, Mauriello, Pepe, & Villani, 2005). On the kinetics of bacteriocin biosynthesis by Lactobacillus amylovorus and
other hand, Casaburi et al. (2005) did not find BA produc- evidence for stimulation of bacteriocin production under unfavourable
tion for S. carnosus strains. However, in our study only one growth conditions. Microbiology, 142, 817–827.
Garcı́a-Varona, M., Santos, E. M., Jaime, I., & Rovira, J. (2000).
strain of S. carnosus selected according to its beneficial pur- Characterization of Micrococcaceae from different varieties of chorizo.
poses was tested for decarboxylase activity. International Journal of Food Microbiology, 54, 189–195.
In conclusion, selected strains of S. xylosus and S. car- Gilliland, S. E., & Walker, D. K. (1990). Factors to consider when
nosus possessed sufficient growth characteristics on ox-bile, selecting a culture of Lactobacillus acidophilus as a dietary adjunct to
produce a hypocholesterolemic effect in humans. Journal of Dairy
bacteriocin activity, adhesive capacity and S. xylosus iso-
Science, 73, 905–911.
lates also did not form BA. On the basis of these results, Halász, A., Baráth, A., Simon-Sarkadi, L., & Holzapfel, W. (1994).
especially its antimicrobial activity, decarboxylase-negativ- Biogenic amines and their production by microorganisms in food.
ity as well as its adaptability to different technological con- Trends in Food Science and Technology, 5, 42–44.
ditions, strain S. xylosus SO3/1M/1/2 can be utilized as a Hernández-Jover, T., Izquierdo-Pulido, M., Veciana-Nogués, M. T., &
starter culture for sausage manufacture. However, addi- Vidal-Carou, M. C. (1996). Ion-pair high-performance liquid chro-
matographic determination of biogenic amines in meat and meat
tional studies are necessary to evaluate its performance products. Journal of Agriculture and Food Chemistry, 44, 2710–2715.
directly in sausage production. Jessen, B. (1995). Starter cultures for meat fermentation. In G. Campbell-
Platt & P. E. Cook (Eds.), Fermented Meats (pp. 130–154). Glasgow
Acknowledgements Blakie Academic & Professional.
Klaenhammer, T. R. (1993). Genetics of bacteriocins produced by lactic
acid bacteria. FEMS Microbiology Review, 12, 39–86.
This work was supported by the EU Project with acro- Lauková, A., & Kmet’, V. (1992). The biochemical and physiological traits
nym TRADISAUSAGE QLK1-CT-2002-02240. The part of the coagulase negative rumen staphylococci and of those producing
of the results concerning the identification and metabolic bacteriocin. Animal Production, 37(2), 103–108.
564 M. Simonová et al. / Meat Science 73 (2006) 559–564
Lauková, A. (1993). The properties of adherent staphylococci isolated Ouwehand, A. C., Tuomola, E. M., Tölkkö, S., & Salminen, S. (2001).
from the rumen wall of lambs. Veterinary Medicine – Czech, 38(2), Assessment of adhesion properties of novel probiotic strains to human
107–113. intestinal mucus. International Journal of Food Microbiology, 64,
Lauková, A., & Mareková, M. (1993). Antimicrobial spectrum of 119–126.
bacteriocin-like substances produced by rumen staphylococci. Folia Ouwehand, A. C., Salminen, S., Tölkkö, S., Roberts, P., Ovaska, J., &
Microbiologica, 38(1), 74–76. Salminen, E. (2002). Resected human colonic tissue: a new model for
Lauková, A., Strompfová, V., & Ouwehand, A. C. (2004). Adhesion characterizing adhesion on lactic acid bacteria. Clinical Diagnosis and
properties of enterococci to intestinal mucus of different hosts. Laboratory Immunology, 9, 184–186.
Veterinary Research Communications, 28, 647–655. Papamanoli, E., Kotzekidou, P., Tzanetakis, N., & Litopolou-Tzanetaki,
Lücke, F.-K. (1986). Microbiological processes in the manufacture of dry E. (2002). Characterization of Micrococcaceae isolated from dry
sausage and raw ham. Fleischwirtschaft, 66, 1505–1509. fermented sausages. Food Microbiology, 19, 441–449.
Lücke, F.-K. (1998). Fermented sausages. In B. J. B. Wood (Ed.), Perreten, V., Giamp, N., Schuler-Schmid, U., & Teuber, M. (1998).
Microbiology of fermented foods (pp. 441–483). London, UK: Blakie Antibiotic resistance genes in coagulase-negative staphylococci iso-
Academic & Professional. lated from food. Systematic and Applied Microbiology, 21, 113–120.
Maurellio, G., Moschetti, G., Villani, F., Blaiotta, G., & Coppola, S. Pryce, J. D. (1969). Modification of the Barker–Summerson method for
(2000). Antibiotic resistance of coagulase-negative staphylococci iso- the determination of lactic acid. Analyst, 94, 1151–1152.
lated from artisanal Naples-type salami. International Journal of Food Skibsted, L. H. (1992). Cured meat products and their oxidative stability.
Sciences and Nutrition, 51, 19–24. In D. E. Johnston, M. K. Knight, & D. A. Ledward (Eds.), The
Mauriello, G., Casaburi, A., Blaiotta, G., & Villani, F. (2004). Isolation chemistry of muscle-based foods (pp. 266–286). Cambridge, UK: The
and technological properties of coagulase negative staphylococci from Royal Society of Chemistry.
fermented sausages of Southern Italy. Meat Science, 67, 149–158. Schwartz, S., & Noble, W. C. (1994). Tetracycline resistance in staphy-
Milton, I. D., Hewitt, C. L., & Harwood, C. R. (1992). Cloning and lococci from the skin of pigs. Journal of Applied Bacteriology, 76,
sequencing of a plasmid mediated erythromycin resistance determinant 320–326.
from Staphylococcus xylosus. FEMS Microbiology Letters, 97, Talon, R., & Montel, M. C. (1997). Hydrolysis of esters by staphylococci.
141–148. International Journal of Food Microbiology, 36, 207–214.
Moschetti, G., Mauriello, G., & Villani, F. (1997). Differentiation of Villani, F., Sannino, L., Moschetti, G., Mauriello, G., Pepe, O., Amodio-
Staphylococcus xylosus strains from Italian sausages by antibiotyping Cocchieri, R., et al. (1997). Partial characterization of an antagonistic
and low frequency restriction fragment analysis of genomic DNA. substance produced by Staphylococcus xylosus 1E and determination
Systematic and Applied Microbiology, 20, 432–438. of the effectiveness of the producer strain to inhibit Listeria monocyt-
Neu, H. C. (1992). The crisis in antibiotic resistance. Science, 257, ogenes in Italian sausages. Food Microbiology, 14, 555–566.
1064–1073. Vinderola, C. G., & Reinheimer, J. A. (2003). Lactic acid strater and
Nychas, G. J. E., & Arkoudelos, J. S. (1990). Staphylococci: their role in probiotic bacteria: a comparative ‘‘in vitro’’ study of probiotic
fermented sausages. Journal of Applied Bacteriology Symposium characteristics and biological barrier resistance. Food Research Inter-
Supplement, 69, 167–188. national, 36, 895–904.
RESULTADOS
8
INFLUENCIA DE LOS FACTORES
TECNOLÓGICOS EN LA FORMACIÓN DE
AMINAS BIÓGENAS DURANTE LA
ELABORACIÓN Y ALMACENAMIENTO DE
PRODUCTOS CÁRNICOS CRUDOS-CURADOS
FERMENTADOS
La formación de aminas biógenas en los productos cárnicos fermentados
depende, además de la presencia de microorganismos aminogénicos y de aminoácidos
libres, de múltiples y complejos factores tecnológicos (formulación, características del
producto, las condiciones del proceso de elaboración, etc). Todos estos factores
influyen, en mayor o menor medida, el crecimiento microbiano, las interacciones
existentes entre las diferentes comunidades microbianas, la acidificación, la
anaerobiosis, y los procesos de proteólisis, entre otros. Estas variables interactúan
entre sí y no siempre en el mismo sentido, lo cual en muchas ocasiones hace difícil
precisar el efecto que pueden ejercer sobre la formación de aminas.
137
RESULTADOS
Artículo IV.
M.J. Miguelez-Arrizado, S. Bover-Cid, M.L. Latorre-Moratalla, M.C. Vidal-Carou. (2006).
Biogenic amines in Spanish fermented sausage as a function of diameter and artisanal or
industrial origin. Journal of Science of Food and Agriculture, 88: 549-557.
Índice de impacto (JCR 2008): 1,333
Posición en el área “Food and Science Technology”: 41/107
139
FACTORES TECNOLÓGICOS DE LA AMINOGÉNESIS EN EMBUTIDOS FERMENTADOS ARTESANALES
8.1.3. Resultados
La tiramina fue la amina principal presente en todos los embutidos, aunque con
una amplia variabilidad. Los embutidos más ácidos son a priori más intensamente
fermentados que los poco ácidos y, por tanto, cabría esperar contenidos más altos de
esta amina principalmente asociada a la actividad de las bacterias fermentativas. Sin
140
RESULTADOS
embargo, esta hipótesis sólo se confirmó en el caso del chorizo. Por lo que se refiere a
los contenidos de putrescina, aunque no se encontraron diferencias significativas
dependiendo del pH del producto, los valores medios mostraron un patrón similar al
observado para la tiramina. Contrariamente a las aminas anteriores, los contenidos de
cadaverina en los embutidos más ácidos fueron casi el doble que en los embutidos de
baja acidez, presentando el chorizo los niveles más altos. El contenido de histamina fue
relativamente bajo, a pesar de que fue detectada en un número considerable de
muestras. Debido a la amplia variabilidad en las concentraciones de histamina, no se
detectaron diferencias significativas entre los diversos grupos de embutidos. Sin
embargo, el contenido de histamina en los embutidos industriales (más ácidos) dobló
al observado en los artesanales, siendo el chorizo, el producto que mostró los
contenidos de histamina más altos.
141
FACTORES TECNOLÓGICOS DE LA AMINOGÉNESIS EN EMBUTIDOS FERMENTADOS ARTESANALES
• Los resultados de este estudio preliminar sobre la influencia del pH indican que el
contenido total de aminas biógenas tiende a ser más elevado en productos
cárnicos crudos-curados fermentados más ácidos (como en los de origen
industrial) que en los poco ácidos (de elaboración más artesanales).
142
RESULTADOS
Artículo IV.
M.J. Miguelez-Arrizado, S. Bover-Cid, M.L. Latorre-Moratalla, M.C. Vidal-Carou.
(2006). Biogenic amines in Spanish fermented sausage as a function of diameter and
artisanal or industrial origin. Journal of Science of Food and Agriculture, 88: 549-557.
Índice de impacto (JCR 2008): 1,333
Posición en el área “Food and Science Technology”: 41/107
143
Journal of the Science of Food and Agriculture J Sci Food Agric 86:549–557 (2006)
DOI: 10.1002/jsfa.2385
Abstract: The distribution of biogenic amines in three types of fermented meat sausages (chorizo, fuet
and salchichón) was examined with respect to the degree of acidification. The aim was to determine
whether low-acid sausages (artisanal/traditional) have a different biogenic amine profile than more acidic
products (industrial). Despite wide variability, tyramine was always found and was generally the major
amine, followed by putrescine. Their contents in both industrial and artisanal sausages were similar, but
correlated with the diameter of the product. In contrast, industrial sausages showed a higher average
content of cadaverine and histamine, especially in chorizo, which also showed the highest content of
free amino acids. Moreover, a multiple analysis of variance confirmed that the processing plant had a
significant influence on the overall biogenic amine composition of products, histamine being the most
important amine accounting for this effect.
2005 Society of Chemical Industry
∗ Correspondence to: M Carmen Vidal-Carou, Departament de Nutrició i Bromatologia, Facultat de Farmàcia, Universitat de Barcelona,
decarboxylase-positive bacteria may not be sufficiently paprika or hot red pepper.22,23 After checking the
inhibited.14 pH, two groups were distinguished: acid sausages
In addition to the effect of starter cultures, with pH > 5.5 and low-acid sausages with pH < 5.5,
aminogenesis in fermented sausages is due to a the latter corresponding to traditionally manufactured
complex interaction between microbial activities products.4,24 Each sample was analysed in duplicate
and several modulating factors. The distribution of for pH, moisture, total nitrogen, non-protein nitrogen,
biogenic amines in industrial fuet and salchichón free α-amine nitrogen and biogenic amine content.
was examined in a previous study,15 where it was
concluded that the diameter of the sausage could be Analytical determinations
a technological factor modulating the accumulation The pH was measured by inserting an electrode
of biogenic amines. Sausage formulation is another connected to a pH meter (Crison 507, Spain) into
parameter reported to be of importance in relation to the mass of each sausage. Moisture was determined by
biogenic amine accumulation,16 – 18 since it may also drying the sample at 100–105 ◦ C until constant weight
affect microbial growth and metabolism during meat was reached.25 Total nitrogen (TN) was determined
fermentation. Acidification has often been reported to by the Kjeldahl method. Non-protein nitrogen (NPN)
affect biogenic amine formation, although the effect was determined by the Kjeldahl method from a
of pH on aminogenesis is controversial. A rapid and perchloric extract and the proteolysis index (PI) was
sharp decrease in pH seems to inhibit contaminant calculated as (NPN/TN) × 100. Determination of the
bacteria and the consequent formation of biogenic free α-amino nitrogen (AAN) fraction was carried
amines.14,16,19 In contrast, an acidic pH may favour out on a neutralized 0.6 mol L−1 perchloric extract by
decarboxylation reactions and amine formation as titration of protons released after the reaction with
a protective mechanism of microorganisms against formaldehyde.25 Biogenic amines were determined by
unfavourable growth conditions. Some studies have high-performance liquid chromatography (HPLC).26
reported a relationship between acidic pH and Briefly, the HPLC method is based on the formation of
biogenic amine accumulation, since the maximum ion pairs between amines, extracted with 0.6 mol L−1
rate of amine production usually occurs when the pH perchloric acid and octanesulfonic acid present in
falls.8,20,21 the mobile phase. The separation was carried out
Given these findings, the distribution of biogenic using a reversed-phase column (Nova-Pack C18 ).
amine content was evaluated with respect to the degree Post-column derivatisation with o-phthalaldehyde was
of acidification, focusing on three types of fermented followed by spectrofluorimetric detection.
products—chorizo, fuet and salchichón—which are
widely consumed in Spain. The aim was to determine Statistical analysis
whether sausages of low acidity, a property related Statistical tests were performed using SPSS 11.0 for
to artisanal/traditional fermented products, have a Windows. Data were examined to check the nor-
different biogenic amine profile to industrial and more mality of distributions and homogeneity of variances.
acidic fermented sausages. In addition, we examined Analysis of variance (ANOVA) and post hoc compar-
how other parameters (mainly diameter but also isons [Tukey’s Honest Significant Difference (HSD)]
formulation) may affect the amine content depending were performed to examine the differences between
on the degree of acidification. Other variables, such acid and low-acid sausages, and also among the three
as proteolysis and water activity, were also studied as types of products (chorizo, fuet and salchichón). When
complementary data that may help in interpretation. data were not normal or symmetrically distributed,
the corresponding non-parametric test was applied.
Regression analysis was used to calculate the cor-
MATERIALS AND METHODS relation coefficients and significance of relationships
Samples between variables. Multivariate analysis of variance
A total of 100 fermented sausages, including chorizo, (MANOVA) was applied to investigate whether the
fuet and salchichón, all widely consumed in Spain, processing plant (manufacturer) influences the overall
were obtained from the commercial network in biogenic amine profile of fermented sausages.
Catalonia (north-eastern Spain). These types of
traditional Spanish sausages are manufactured from
a mixture of minced pork meat and fat (occasionally RESULTS AND DISCUSSION
beef), with the addition of salt, spices, condiments Physico-chemical and proteolysis
and additives; these ingredients are mixed and stuffed characterisation
into either natural or artificial casings, which then The pH value was used to classify samples in acid
undergo a ripening–drying process. Salchichón is (pH < 5.5) and low-acid (pH > 5.5) sausages, the
a salami-like sausage containing black pepper and latter corresponding to traditionally manufactured
has a diameter of up to 4–6 cm; fuet is a smaller products fermented spontaneously without a starter
diameter (<4 cm) sausage, originally from Catalonia, culture.4,8,17,24 In both groups, significant differences
and chorizo differs from the latter in the addition were found depending on the type of sausages
of other condiments and spices, such as garlic and (Table 1). Fuet sausages showed higher pH values
Acid Low-acid
than both chorizo and salchichón, which can be sausages owing to the larger diameter. However, in the
explained by the typical growth of moulds on the group of acid sausages a significantly lower (P < 0.01)
sausage surface, a process that occurs generally in fuet, protein content was detected in chorizo than fuet
only occasionally in salchichón and never in chorizo.1 and salchichón. Although the proportion of fat and
A statistically significant correlation (P < 0.001) was lean meat may vary widely in these types of Spanish
found between pH values and the diameter of sausages, chorizos are usually fattier than the others.
products, which can be explained by the more intense In terms of proteolysis, the various parameter values
fermentation that usually occurs in sausages of bigger showed relatively wide variability, although some
calibre.15 differences were detected depending on the parameter
The chemical determinations of moisture, protein and the sausage group or type considered. Thus, PI
and proteolytic-related parameters with respect to the was significantly higher (P < 0.05) in the group of acid
degree of acidification and product type are also sausages (average value 6.44%) than low-acid sausages
summarized in Table 1. When comparing acid and (5.34%). However, such a difference was not found for
low-acid products overall, acid sausages (industrial) the NPN values. This apparent disagreement is due to
showed greater moisture (P < 0.01) and lower protein the fact that total nitrogen content (protein) was lower
content (P < 0.001), which would indicate the use in acid sausages, which increases the ratio between
of a smaller quantity of lean meat as raw material in NPN and total nitrogen content. None of these
comparison with the low-acid products (traditional). proteolytic parameters differed among the three types
Anyway, most of the samples (84%) fell within the of sausages compared. During sausage fermentation,
‘Extra’ commercial category according to the values of a wide variety of nitrogenous compounds of low
moisture and protein content established by Spanish molecular weight (such as peptides, free amino acids
regulations.22 Among the different types of products, and ammonia) may be formed as a result of proteolytic
salchichón showed slightly greater moisture than other events catalysed by both endogenous and microbial
enzymes. Overall proteolysis can be affected by several polyamines) was higher in acid (industrial) than in
factors23,27 but, according to our results, acidification low-acid sausages (artisanal). Figure 1 shows the
would have a stronger influence than product type. content of tyramine and putrescine according to
Indeed, an overall statistically significant correlation both the degree of acidification and the type of
(P < 0.05) between pH and PI values was found. fermented meat product. Tyramine was found in all
Different behaviour was observed in relation to free the sausages and was generally the major amine,
amino acid content (AAN values), as here the type accounting for, on average, 54 and 61% of the
of product proved much more important than the biogenic amine pool in acid and low-acid sausages,
degree of acidification. Chorizo sausages showed much respectively. Putrescine was generally the second
higher average AAN contents (P < 0.001) than fuet major amine, although it occasionally surpassed the
and salchichón sausages in both the acid and low-acid levels of tyramine. This occurred more frequently in
groups. The increase in free amino acids may favour the group of acid sausages (up to 18% of samples) than
decarboxylase reactions and hence chorizo sausages in low-acid sausages (13%). Despite tyramine levels
may show a priori a higher risk of biogenic amine showing a relatively wide variability [relative standard
accumulation than other types of sausages. deviation (RSD) = 73%], the average value was about
140 mg kg−1 , irrespective of the sausage group. Acid
Biogenic amine content sausages are, a priori, more intensively fermented than
The potential influence of the degree of acidification low-acid sausages and therefore higher tyramine levels
on the biogenic amine content in Spanish fermented could be expected. However, this hypothesis was only
sausages varied according to both the amine and the confirmed in chorizo sausages. Indeed, product type,
type of product. A two-way ANOVA test was applied mainly due to the different diameter, proved to have
in order to analyse the effects of two factors (acidity a greater influence (P < 0.001) than the degree of
and type of product) on the amine contents. However, acidification, salchichón being the product with the
no statistical significance was found for the interaction highest tyramine content, especially in the group of
between the two factors and therefore a one-way acid sausages.
ANOVA test was used to calculate further the post Putrescine content was more variable than that of
hoc contrasts for each amine and factor. Overall, the tyramine (RSD = 134%) and there were no significant
total biogenic amine content (excluding endogenous differences between the two groups with respect
S A
600
Tyramine (mg kg-1)
500
A
400 A A
A A
A A
300
200
100
0
Acid Low-acid C F S C F S
sausages sausages Acid sausages Low-acid sausages
600
Putrescine (mg kg-1)
S S
500
A
400
A S
A
300
A
200
100
0
Acid Low-acid C F S C F S
sausages sausages Acid sausages Low-acid sausages
Figure 1. Box-plot representation of tyramine (TY) and putrescine (PU) content in Spanish fermented sausages as a function of the degree of
acidity (left) and product type (right). C, chorizo; F, fuet; S, salchichón.
to pH or product type. Nevertheless, the average highest average content was observed in chorizo,
values of the compared groups showed a similar especially in the group of acid sausages. When
pattern to that observed for tyramine, since salchichón comparing the groups according to pH, nearly one-
showed a higher putrescine content than did the third of the sausages (27%) contained more cadaverine
other products. Moreover, a significant correlation than putrescine, especially in the case of fuet. The ratio
(P < 0.005) between both tyramine and putrescine between diamines (putrescine > cadaverine) has also
and the diameter of the sausages was also observed, been reported in Spanish,15,18,8 Finnish,29 French3
this being consistent with the findings of Parente et al.4 and Italian products.4 However, a recent study of fuet
for industrial and artisanal Italian fermented sausages; sausages showed that cadaverine appeared in greater
these authors reported a higher tyramine content in quantities than putrescine when meat raw materials
soppressata (diameter 45–60 mm) than in salsiccia are not frozen before sausage manufacture; otherwise,
(diameter 20–25 mm). putrescine was the main diamine.30 Only in a few
Tyramine is the biogenic amine most closely samples of chorizo and fuet (a total of 6%) was
related to lactic fermentation, since many lactic cadaverine the major amine, its content even being
acid bacteria have the potential to decarboxylate higher than that of tyramine. High cadaverine content
tyrosine. In contrast, the origin of putrescine is more would be of concern in terms of hygiene, since it has
controversial as it can be partially formed through the been associated with the presence of undesirable loads
ornithine–decarboxylase activity of some lactic acid of contaminant enterobacteria, which are known to
bacteria but also by many enterobacteria. decarboxylate lysine.31
Cadaverine is the other diamine usually found in The average histamine content was relatively low.
fermented sausages, usually in smaller amounts than Although it was detected in a considerable number
the other two compounds. Levels of this diamine of samples, the majority showed either no histamine
(Fig. 2) were even more variable (RSD = 185%) than or very low amounts: below 10 mg kg−1 in 75% of
the former two and therefore no significant differences the samples and below 1.5 mg kg−1 in 50%. Owing
were detected among the compared groups. However, to the wide variability (RSD = 225%), there were
the average value in acid sausages (47 mg kg−1 ) was no significant differences between sausage groups
almost twice that in low-acid sausages (26 mg kg−1 ). (Fig. 2). However, as in the case of cadaverine, the
When comparing the different product types, the average value for acid sausages (28 mg kg−1 ) was
200
Cadaverine (mg kg-1)
S S
150 S
S
S S
S
S
S S
S
A S
A A
A S A
A
100 A A
A A
A A
50
0
Acid Low-acid C F S C F S
sausages sausages Acid sausages Low-acid sausages
S S
200
Histamine (mg kg-1)
S S
150
A A
S S
100
S S
S S
S S
50 S S
A S
A
A
0
Acid Low-acid C F S C F S
sausages sausages Acid sausages Low-acid sausages
Figure 2. Box-plot representation of cadaverine (CA) and histamine (HI) content in Spanish fermented sausages as a function of the degree of
acidity (left) and product type (right). C, chorizo; F, fuet; S, salchichón.
twice that of low-acid sausages (14 mg kg−1 ). Likewise, 51.0) and 31.0 mg kg−1 (SD = 53.5) for phenylethy-
among acid (industrial) sausages, chorizo showed the lamine and tryptamine, respectively. They were not
highest average histamine value, with two samples widely distributed in all samples, the highest levels
having higher levels of histamine than tyramine. of both amines being found in salchichón (of the
Histamine is the only biogenic amine whose levels acid sausage group). A strong correlation (P < 0.001)
are subject to legal regulations, although this only was found between both these amines and tyramine,
refers to some fish species. The upper allowable and also between both amines and product diameter.
limit of histamine has been set at 100 mg kg−1 by These findings are in agreement with the appearance
the European Union32 and 50 mg kg−1 by the US of these amines during the later phases of sausage
Food and Drug Administration33 on the basis of the manufacture, when tyramine has already accumulated
potential health risk and hygiene considerations. The in high amounts, and also with the fact that salchichón
value of 100 mg kg−1 has been used as a reference for has a larger diameter and hence may need a longer
other products such as fermented sausages.3,11 This ripening period.15,28
value was reached by 9% of samples in the acid group As expected, the physiological polyamines spermi-
dine and spermine were detected in all the sausages,
(up to 300 mg kg−1 ) and 4% of low-acid sausages.
the amounts of spermidine (6.1 mg kg−1 ) being lower
The accumulation of histamine in fermented sausages
than those of spermine (23.4 mg kg−1 ), as is usually
has been related to an inadequate pH decrease during
reported for animal products. They showed much less
the first days of the ripening process, as this could
variability (RSD = 73 and 55%, respectively) than
allow histaminogenic contaminating microorganisms
biogenic amines. Although differences were not signif-
to grow.8,14 Proteolytic microorganisms or proteases icant, the average values for acidic sausages were lower
from meat have also been suggested to play a than those of low-acid sausages (Table 2), as was the
role in excessive formation of histamine.34 In this case for average protein content, which was higher in
respect, a significant (P = 0.009) correlation was artisanal than in industrial sausages. This is in agree-
found between histamine content and the AAN ment with the endogenous origin of polyamines.28
values of sausages analysed in the present study, this
being consistent with the higher histamine content The role of the manufacturer in the biogenic
of chorizo. However, several studies concerning the amine profile
manufacture of fermented sausages have failed to The biogenic amine profile in fermented sausages was
detect histamine, even if pH does not fall sharply or characterised by wide variability in both industrial
proteolysis is high.4,18,28,35,36 In contrast, significant and artisanal products. Such variability is usually
amounts of histamine do accumulate if low-quality reported in fermented products and is generally
raw material is used for sausage manufacture.13,34 attributed to the important influence of raw material
Indeed, histamine levels above those of tyramine are quality, which makes the biogenic amine profile
rarely observed in Spanish fermented sausages.15,18,28 differ from batch to batch.28 Indeed, as shown
Therefore, the occurrence of histamine in fermented in Fig. 3, there was quite a wide variation in the
sausages, even at relatively low levels, could be of qualitative and quantitative composition of biogenic
critical significance from a hygienic point of view. amines of fermented products both among and within
Phenylethylamine and tryptamine were minor manufacturers. The case of manufacturer I was,
amines, detected in only small amounts. The average however, an exception since a certain degree of
values were 23.6 mg kg−1 (standard deviation, SD = reliability was found in the qualitative distribution
Acid Low-acid
80 80
60 60
40 40
20 20
0 0
a b c d e a b c d e
Manufacturer I Manufacturer II
80 80
60 60
40 40
20 20
0 0
a b c d e a b c d e f g
Manufacturer III Manufacturer IV
80 80
TRP
60 60 PHE
HI
40 40 CA
PU
20 20 TY
0 0
a b c d e a b c d
Manufacturer V Manufacturer VI
Figure 3. Distribution of the biogenic amine profile (% of the total biogenic amine content) within products of the same manufacturer.
of amines within its products. Other manufacturers composition of sausages. When assessing the particular
(e.g. manufacturer II) showed two different qualitative contribution of each biogenic amine to this effect,
profiles: one for samples with high total biogenic histamine proved to be the most important amine in
amine content (samples a, b and d) and another for this regard. Other authors also reported a relationship
samples with low total amine content (samples c and between histamine and product brand, suggesting
e). On the basis of these results, a MANOVA was that environmental processing conditions play a role
performed to evaluate the importance of manufacturer in the manufacturer-specific variation.34,37 Moreover,
on the aminogenesis of fermented meat products. The the capability to decarboxylate histidine does not seem
analysis of variance confirmed that the processing to be a widely distributed property among meat-
plant, including both technological factors and its related microorganisms. Rather, the histaminogenic
characteristic in-house microbiota, had a significant potential seems to be related to specific strains of some
(P < 0.001) influence on the overall biogenic amine enterobacteria and lactic acid bacteria species.34,38,39
This is in agreement with the relatively low occurrence 14 Maijala R, Eerola S, Aho M and Him J, The effect of GDL-
of fermented sausages with high histamine content in induced pH decrease on the formation of biogenic amines in
meat. J Food Protect 56:125–129 (1993).
comparison with tyramine and diamines. 15 Bover-Cid S, Schoppen S, Izquierdo-Pulido M and Vidal-
To sum up, the present results show that levels Carou MC, Relationship between biogenic amine contents
of tyramine (the biogenic amine most closely linked and the size of dry fermented sausages. Meat Sci 51:305–311
to fermentation processes) were similar in Spanish (1999).
fermented sausages of either artisanal or industrial 16 Bover-Cid S, Izquierdo-Pulido M and Vidal-Carou MC,
Changes in biogenic amine and polyamine contents in slightly
origin. In contrast, other biogenic amines usually
fermented sausages manufactured with and without sugar.
associated with the hygienic quality of raw materials Meat Sci 57:215–221 (2001).
(such as cadaverine and histamine) occurred in higher 17 Bozkurt H and Erkmen O, Effects of starter cultures and
amounts in industrial than artisanal products. additives on the quality of Turkish style sausage (sucuk).
Meat Sci 61:149–156 (2002).
18 González-Fernández C, Santos EM, Jaime I and Rovira J,
Influence of starter cultures and sugar concentrations on
ACKNOWLEDGEMENTS biogenic amine contents in chorizo dry sausage. Food Microbiol,
This research was funded by the Generalitat de 20:275–284 (2003).
Catalunya (2001SGR 00132), the Spanish Comision 19 Maijala R, Eerola S, Lievonen S, Hill P and Hirvi T, Formation
Interministerial de Ciencia y Tecnologı́a (CICYT) of biogenic amines during ripening of dry sausages as affected
(ALI99-0308) and the EU project TRADISAUSAGE by starter cultures and thawing time of raw materials. J Food
Sci 69:1187–1190 (1995).
(QLK1-CT-2002-02240). Sara Bover-Cid acknowl- 20 Santos-Buelga C, Peña-Egido MJ and Rivas-Gonzalo JC,
edges funding support from the Spanish Ministry of Changes in tyramine during Chorizo-sausages ripening. J Food
Science and Technology (Ramón y Cajal Program). Sci 51:518–527 (1986).
21 Bover-Cid S, Izquierdo-Pulido M and Vidal-Carou MC, Effec-
tiveness of Lactobacillus sakei starter culture in the reduction of
REFERENCES biogenic amine accumulation as a function of the raw material
1 Flores J, Mediterranean vs. northern European meat products. quality. J Food Protect 64:367–373 (2001).
Processing technologies and main differences. Food Chem 22 MSC, Ministerio de Sanidad y Consumo Orden de 7 de febrero
59:505–510 (1997). de 1980, por la que se aprueba la norma de calidad para
2 Aymerich T, Martı́n B, Garriga M and Hugas M, Microbial productos cárnicos embutidos crudos-curados en el mercado
quality and direct PCR identification of lactic acid bacteria interior. Boletı́n Oficial del Estado 70:6280–6284 (1980).
and non-pathogenic staphylococci from artisanal low-acid 23 Ordóñez JA, Hierro EM, Bruna JM and de la Hoz L, Changes
sausages. Appl Environ Microbiol 69:4583–4594 (2003). in the components of dry-fermented sausages during ripening.
3 Montel MC, Masson F and Talon R, Comparison of biogenic Crit Rev Food Sci 39:329–367 (1999).
amine content in traditional and industrial French dry 24 Barbuti S and Parolari G, Validation of manufacturing process
sausages. Sci Aliment 19:247–254 (1999). to control pathogenic bacteria in typical dry fermented
4 Parente E, Martuscelli M, Gardini F, Grieco S, Crudele MA products. Meat Sci 62:323–329 (2002).
and Suzzi G, Evolution of microbial populations and biogenic 25 AOAC, Official Methods of Analysis of the Association of
amine production in dry sausages produced in Southern Italy. Official Analytical Chemists, 16th edn. Association of Official
J Appl Microbiol 90:882–891 (2001). Analytical Chemists, Washington, DC (1995).
5 Santos EM, Gonzalez-Fernández C, Jaime I and Rovira J, 26 Hernández-Jover T, Izquierdo-Pulido M, Veciana-Nogués MT
Comparative study of lactic acid bacteria house flora isolated and Vidal-Carou MC, Ion-pair high-performance liquid
in different varieties of ‘chorizo’. Int J Food Microbiol chromatographic determination of biogenic amines in meat
39:123–128 (1998). and meat products. J Agric Food Chem 44:2710–2715 (1996).
6 Garcı́a-Varona M, Santos EM, Jaime I and Rovira J, Charac- 27 Demeyer D, Raemaekers M, Rizzo A, Holck A, De Smedt A,
terisation of Micrococcaceae isolated from different varieties of ten Brink B, Hagen B, Montel C, Zanardi E, Murbrekk E,
chorizo. Int J Food Microbiol 54:189–195 (2000). Leroy F, Vandendriessche F, Lorentsen K, Venema K, Sune-
7 Hugas M, Garriga M and Aymerich MT, Functionality of sen L, Stahnke L, De Vuyst L, Talon R, Chizzolini R and
enterococci in meat products. Int J Food Microbiol 88:223–233 Eerola S, Control of bioflavour and safety in fermented
(2003). sausages: first results of a European project. Food Res Int
8 Buncic S, Paunovic L, Radisic D, Vojinovic G, Smiljanic D and 33:171–180 (2000).
Baltic M, Effects of gluconodeltalactone and Lactobacillus 28 Hernández-Jover T, Izquierdo-Pulido M, Veciana-Nogués MT,
plantarum on the production of histamine and tyramine in Mariné-Font A and Vidal-Carou MC, Biogenic amine and
fermented sausages. Int J Food Microbiol 17:303–309 (1993). polyamine contents in meat and meat products. J Agric Food
9 Mariné-Font A, Vidal-Carou MC, Izquierdo-Pulido M, Chem 45:2098–2102 (1997).
Veciana-Nogués MT and Hernández-Jover T, Les amines 29 Eerola S, Roig-Sagués AX and Hirvi TK, Biogenic amines in
biògenes dans les aliments: leur signification, leur analyse. Finnish dry sausages. J Food Safety 18:127–138 (1998).
Ann Fals Exp Chim 88:119–140 (1995). 30 Bover-Cid S, Miguélez-Arrizado MJ, Latorre-Moratalla ML
10 Suzzi G and Gardini F, Biogenic amines in dry fermented and Vidal-Carou MC, Freezing of raw materials affects tyra-
sausages: a review. Int J Food Microbiol 88:41–54 (2003). mine and diamine accumulation in spontaneously fermented
11 Brink B, Damink C, Joosten H and Huis in’t Veld J, Occurrence sausages. Meat Sci 72:62–68 (2006).
and formation of biologically active amines in foods. Int J Food 31 Bover Cid S, Hernández-Jover T, Miguélez-Arrizado MJ and
Microbiol 11:73–84 (1990). Vidal Carou MC, Contribution of contaminant enterobacte-
12 Maijala R, Nurmi E and Fischer A, Influence of processing ria and lactic acid bacteria to biogenic amine accumulation
temperature on the formation of biogenic-amines in dry in spontaneous fermentation of pork sausages. Eur Food Res
sausages. Meat Sci 39:9–22 (1995). Technol 216:477–482 (2003).
13 Bover-Cid S, Izquierdo-Pulido M and Vidal-Carou MC, Influ- 32 EEC, European Economic Community, European Community,
ence of hygienic quality of raw materials on biogenic amine 91/493/EEC, Directive of July 22, concerning the normative
production during ripening and storage of dry fermented for production and merchandising of fishery products. Diario
sausages. J Food Protect 63:1544–1550 (2000). Oficial de las Comunidades Europeas L286:15–34 (1991).
33 FDA, Food and Drug Administration, Decomposition and events during the elaboration of ‘fuet’, a Spanish ripened
histamine-raw, frozen tuna and mahi-mahi, canned tuna and sausage. Eur Food Res Technol 209:108–112 (1999).
related species, revised compliance policy guide, availability. 37 Ekici K, Sekeroglu R, Sancak C and Noyan T, A note on
Fed Regist 149:39 754–39 756 (1995). histamine levels in Turkish style fermented sausages. Meat
34 Paulsen P and Bauer F, Biogenic amines in fermented sausages: Sci 68:123–125 (2004).
2. Factors influencing the formation of biogenic amines in 38 Maijala R, Formation of histamine and tyramine by some lactic
fermented sausages. Fleischswirtsch Int 77:32–34 (1997). acid bacteria in MRS-broth and modified decarboxylation
35 Bover-Cid S, Izquierdo-Pulido M and Vidal-Carou MC, Effect agar. Lett Appl Microbiol 17:40–43 (1993).
of proteolytic starter cultures of Staphylococcus spp. on 39 Bover-Cid S, Hugas M, Izquierdo-Pulido M and Vidal-
biogenic amine formation during the ripening of dry Carou MC, Amino acid-decarboxylase activity of bacteria
fermented sausages. Int J Food Microbiol 46:95–104 (1999). isolated from fermented pork sausages. Int J Food Microbiol
36 Roig-Sagués AX, Hernández-Herrero MM, López-Sabater EI, 66:185–189 (2001).
Rodrı́guez-Jerez JJ and Mora-Ventura MT, Microbiological
Artículo V.
M.L. Latorre- Moratalla, S. Bover-Cid, M.C. Vidal-Carou. (2010). Technological conditions
influence aminogenesis during spontaneous sausage fermentation. Meat Science, 85: 537-
541.
Índice de impacto (JCR 2008): 2,183
Posición en el área “Food and Science Technology”: 17/107
Artículo VI.
M.L. Latorre-Moratalla, S. Bover-Cid, M.C. Vidal-Carou. Effect of technological conditions
on the aminogenic activity of the amino acid positive stain L. curvatus CTC273. Food
Microbiology. En revisión.
Índice de impacto (JCR 2008): 2,847
Posición en el área “Food and Science Technology”: 7/107
Comunicación escrita:
M.L. Latorre-Moratalla, S. Bover-Cid, T. Veciana-Nogués, M.C. Vidal-Carou. Influence of
Traditional and Industrial Processing Conditions on the Aminogenic Activity of a
Lactobacilus curvatus Strain during the Ripening of Fermented Sausages of Different
Diameter. Food Micro 2006. “Food Safety and Food biotechnology: diversity and global
impact” .Bolonya, 29 de Agosto - 2 de Septiembre de 2006.
155
FACTORES TECNOLÓGICOS DE LA AMINOGÉNESIS EN EMBUTIDOS FERMENTADOS ARTESANALES
156
RESULTADOS
diámetro mayor (4,5 cm). Para cada tipo de producto, se aplicaron dos condiciones de
elaboración diferentes:
8.2.3. Resultados
157
FACTORES TECNOLÓGICOS DE LA AMINOGÉNESIS EN EMBUTIDOS FERMENTADOS ARTESANALES
158
RESULTADOS
159
FACTORES TECNOLÓGICOS DE LA AMINOGÉNESIS EN EMBUTIDOS FERMENTADOS ARTESANALES
160
RESULTADOS
Artículo V.
M.L. Latorre- Moratalla, S. Bover-Cid, M.C. Vidal-Carou. (2010). Technological
conditions influence aminogenesis during spontaneous sausage fermentation. Meat
Science, 85: 537-541.
Índice de impacto (JCR 2008): 2,183
Posición en el área “Food and Science Technology”: 17/107
161
Meat Science 85 (2010) 537–541
Meat Science
journal homepage: www.elsevier.com/locate/meatsci
a r t i c l e i n f o a b s t r a c t
Article history: The influence of two manufacturing processes on biogenic amine formation during the manufacture of
Received 11 December 2009 Spanish dry fermented sausages of different diameters (fuet and llonganissa) was evaluated to elucidate
Received in revised form 24 February 2010 which conditions allow better control of the aminogenic activity of spontaneous microbiota. Technolog-
Accepted 2 March 2010
ical conditions affected both the amounts and the qualitative profile of biogenic amine accumulated. The
higher processing temperature and relative humidity in process A (simulating those applied in industrial
manufacture) favoured aminogenesis, since biogenic amine accumulation was faster and higher than in
Keywords:
sausages manufactured under the process B (close to those used in traditional practices). The major
Dry fermented sausages
Biogenic amines
amine differed depending on the diameter of the sausages, tyramine being the major amine in fuet
Processing conditions (2.5 cm diameter sausage), and putrescine in llonganissa (4.5 cm). Moreover, sausages of higher diameter
Diameter (llonganissa) had higher biogenic amine contents compared with the thinnest sausages (fuet). Conditions
would modulate biogenic amine accumulation not only due to its influence on development of the bac-
terial population but also on its aminogenic activity. From the biogenic amine point of view, when sau-
sages are spontaneously fermented, traditional lower temperatures and relative humidities are more
appropriate than those usually applied in industrial processes.
Ó 2010 Elsevier Ltd. All rights reserved.
0309-1740/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.meatsci.2010.03.002
538 M.L. Latorre-Moratalla et al. / Meat Science 85 (2010) 537–541
(Miguélez-Arrizado et al., 2006). A significant correlation between titration with formaldehyde (AOAC, 2005), was used to determine
biogenic amine contents and the diameter of the sausage was ob- free amino acids as a-amino nitrogen (AAN).
served. However, it was difficult to establish a relationship be-
tween traditional and industrial processes due to several factors 2.4. Determination of biogenic amines
affecting the amine contents of the sausages (e.g. different formu-
lation, raw materials and processing conditions). Biogenic amines (tyramine, phenylethylamine, histamine,
The overall aim of the present work was to elucidate the effect tryptamine, putrescine and cadaverine) were analysed by ion-pair
of each technological factor (i.e. temperature and relative humid- reverse-phase high performance liquid chromatography, as de-
ity, and the diameter of the sausage) on aminogenesis during spon- scribed in Hernández-Jover, Izquierdo-Pulido, Veciana-Nogués,
taneous sausage fermentation. The influence on biogenic amine and Vidal-Carou (1996). This method is based on the formation
accumulation of (i) two different manufacturing possesses (based of ion-pairs between biogenic amines, previously extracted with
on the temperature and relative humidity program) and (ii) the 0.6 M perchloric acid from 5 to 10 g of sausage without casings,
diameter of the product, were studied to determine the conditions and octanesulphonic acid present in the mobile phase. Amine sep-
that reduce the aminogenic activity of the spontaneous microbiota. aration was performed through a C18 reverse-phase column
(Waters Corp., Milford, MA, USA), followed by a post-column deriv-
atization with o-phthalaldehyde (OPA, Merck, Darmstadt, Ger-
2. Materials and methods
many) and spectrofluorimetric detection (k ex: 340 nm and k em:
445 nm).
2.1. Samples and sampling
Due to the loss of water during the manufacturing process and
to compare results from different sampling times and batches, data
Four batches of dry fermented sausages were manufactured in
for nitrogenous fractions and biogenic amine contents were re-
parallel from a common meat batter consisting of 80% lean pork
ferred to dry matter (dm).
meat and 20% pork fat, minced and mixed with salt (2.8%), pepper
(0.26%), dextrose (0.5%), lactose (2.5%), sodium nitrite (0.015%) and
sodium ascorbate (0.05%). The batter was stuffed into natural cas- 2.5. Statistical analysis
ings of different diameter: fuet with a smaller diameter (2.5 cm)
and llonganissa with a larger diameter (4.5 cm). For each type of Two-way ANOVA and t-test were performed using the software
product, two different processes were applied: ‘‘Process A” con- package SPSS v.15.0 for Windows (SPSS Inc., Chicago, IL, USA).
sisted of 3 days at 20–23 °C and 90–95% RH followed by 20 days
at 12–14 °C and 70% RH; ‘‘Process B” consisted of 23 days at 12– 3. Results and discussion
13 °C and 70–90% RH.
Three sausages from each batch were sampled during the pro- Fig. 1 shows the changes in biogenic amine contents during the
cess: just after stuffing (time 0) and after 2, 3, 7, 14 and 23 days. manufacture of two different dry fermented sausages (fuet and
Samples were analysed in duplicate for microbial counts, physico- llonganissa) spontaneously fermented following two processes.
chemical parameters, nitrogen fractions and biogenic amine The biogenic amine content in the four batches was relatively
contents. low, ranging from 13 to 91 mg/kg, compared to levels usually re-
ported for dry fermented sausages (Ruiz-Capillas & Jimenez-Col-
menero, 2004; Suzzi & Gardini, 2003). The major amine produced
2.2. Microbial enumeration
by the spontaneous microbiota was tyramine in fuet, whereas
putrescine was the main amine found in llonganissa. Cadaverine
After aseptically removing the casing, between 10 and 20 g of
was only present in llonganissa products, though in very low
sausage was diluted 10-fold in buffered peptone water and homog-
amounts (below 10 mg/kg dm). Histamine, phenylethylamine and
enized in a Stomacher (model 400, Blender, Cooke Laboratories,
tryptamine were not detected in any samples, irrespective of the
Alexandria, VA, USA) for 2 min. Serial decimal dilutions were made
batch.
and lactic acid bacteria (LAB) were enumerated by pour plating in
Technological conditions affected both the amounts and the
Man, Rogosa and Sharpe (MRS) agar (Oxoid, Basingstoke, Hamp-
qualitative profile of biogenic amine accumulated. Higher process-
shire, England) at 30 °C for 72 h in anaerobiosis (anaerobic jars
ing temperatures and relative humidity favoured aminogenesis,
with Anaero-Gen, Oxoid), enterococci were enumerated by pour
since overall biogenic amine accumulation was faster and higher
plating in kanamycin-esculin-azide agar (Oxoid) at 37 °C for 24 h,
(p < 0.05) in sausages manufactured following process A. The small
and Enterobacteriaceae were enumerated by pour plating in violet
diameter sausage (fuet) manufactured with process B had more
red bile glucose agar (Oxoid) with a double layer at 30 °C for 24 h.
than 3-fold lower tyramine and 5-fold lower putrescine contents
than found in batches manufactured with process A (p < 0.05). In
2.3. Determination of physicochemical and proteolytic parameters the case of llonganissa sausage, the putrescine contents were at
least 35% lower in batches manufactured with process B
The pH was measured using a microcomputerized pH meter (p < 0.05), whereas the content of tyramine was similar under both
Crison 2001 (Crison Barcelona, Spain) inserting the electrode di- processing conditions. According to the two-way ANOVA, the
rectly into the sausage. Water activity (aw) values were obtained interaction term between both technological conditions (process
at 25 °C by means of AqualabÒ equipment (Decagon Devices Inc., parameters and diameter) showed a significant effect (p < 0.05)
Pullman, Washington). Moisture was determined by drying the on the overall biogenic amine content, putrescine being the amine
sample at 100–105 °C until constant weight (AOAC, 2005). Total responsible for this statistical significance.
nitrogen (TN) and non-protein nitrogen (NPN) contents were Overall, LAB and enterococci increased in number throughout
determined by the Kjeldahl method (AOAC, 2005). The NPN frac- the manufacturing process (Table 1). Enterobacteriaceae counts de-
tion was previously extracted from 5 to 10 g of sample with creased to levels less than 2 log cfu/g, irrespective of the condi-
0.6 M perchloric acid (Dierick, Vandekerckhove, & Demeyer, tions, which could be related to the low cadaverine contents
1974). The proteolysis index (PI) was calculated as the ratio be- observed in all batches (Bover-Cid, Hernández-Jover, Miguélez-
tween NPN and TN multiplied by 100. The Sörensen method of Arrizado, & Vidal-Carou, 2003; Latorre-Moratalla et al., 2008). It
M.L. Latorre-Moratalla et al. / Meat Science 85 (2010) 537–541 539
Fig. 1. Evolution of biogenic amine (mg/kg dm) during the manufacture of fuet (2.5 cm diameter) and llonganissa (4.5 cm diameter) spontaneously fermented as: process A
(3 days at 20–23 °C and 90–95% HR followed by 20 days at 12–14 °C and 70% HR) and process B (23 days at 12–13 °C and 70–90% HR).
Table 1
Microbial counts as log (CFU/g) during the manufacture of fuet (diameter 2.5 cm) and llonganissa (diameter 4.5 cm) spontaneously fermented as: process A (3 days at 20–23 °C
and 90–95% HR followed by 20 days at 12–14 °C and 70% HR) and process B (23 days at 12–13 °C and 70–90% HR). Mean in bold and standard deviation in italics.
should be noted that the growth of LAB, but not of enterococci, was biogenic amine formation, chiefly by favouring proteolytic en-
significantly (p < 0.05) affected by the processing temperature and zymes and decarboxylase reactions (Joosten, 1997; Suzzi & Gardini,
relative humidity, being faster with process A than with B. The 2003).
population of LAB and enterococci at the end of the manufacturing All products showed relatively weak acidification (Table 2), as
process was affected by process type and the diameter of the sau- usually occurs in the spontaneous fermentation of Spanish fer-
sages. Fuet sausages had significantly (p < 0.05) higher final counts mented sausages (Aymerich, Martín, Garriga, & Hugas, 2003; Mi-
of LAB and enterococci when were manufactured with process A. In guélez-Arrizado et al., 2006). The different temperature and
llonganissa, no significant differences were found between pro- relative humidity during the first 3 days of the processes did not af-
cesses, though differences in biogenic amine contents due to the fect (p < 0.05) pH and aw values. Despite the fast growth of LAB in
manufacturing process were considerable. The higher biogenic process A, the pH values of samples from process A were very sim-
amine production associated with the use of relatively high pro- ilar to those from process B during the 23 days of sampling. How-
cessing temperatures could be explained by the more favourable ever, the diameter of the sausage influenced the pH and aw of the
conditions for microbial growth (in case of small diameter sau- products during the second part of the manufacturing process
sages) and/or for the decarboxylase activity of the aminogenic (from day 14). Sausages with larger diameters (llonganissa) had
spontaneous microbiota (mainly in products of a wide diameter). lower pH and higher aw values than sausages with smaller diame-
It has been reported that high processing temperatures stimulate ter (fuet). It is recognized that the pH promotes the activity of
540 M.L. Latorre-Moratalla et al. / Meat Science 85 (2010) 537–541
Table 2
Physicochemical and proteolytic related parameters (alpha-amino nitrogen, AAN; proteolysis index, IP) during the manufacture of fuet (diameter of 2.5 cm) and llonganissa
(diameter 4.5 cm) spontaneously fermented as: process A (3 days at 20–23 °C and 90–95% HR followed by 20 days at 12–14 °C and 70% HR) and process B (23 days at 12–13 °C
and 70–90% HR). Mean in bold and standard deviation in italics.
amino acid decarboxylases as a system to neutralize an unfavour- In conclusion, high temperature and high relative humidity dur-
able acidic environment. A relationship between pH and biogenic ing fermentation and larger diameter sausages are important tech-
amine content has been reported by Miguélez-Arrizado et al. nological parameters that may stimulate the aminogenic activity of
(2006), who found higher biogenic amine contents in acid than the spontaneous microorganisms present during fermented sau-
in low acid sausages. However, although the more acidic environ- sage manufacture. Therefore, the higher temperatures and relative
ment could partially account for the higher amine accumulation humidities usually applied in industrial processing to ensure rapid
detected in llonganissa, the differences in biogenic amine contents acidification may not be the best procedure to control or reduce
between the two processing conditions can not be exclusively biogenic amine formation. In this case, it will be critical to use star-
attributed to these physicochemical factors. ter cultures without the ability to form biogenic amines (Bover-Cid,
Regarding proteolytic parameters, the values of ANN and IP Hugas, Izquierdo-Pulido, & Vidal-Carou, 2000). However, keeping
were quite variable during the manufacture of the four different the relatively low temperature and relative humidity usually used
batches and a clear trend could not be established. Although prote- for the manufacture of traditional dry fermented sausages would
olysis has been described as a potential factor favouring the accu- be best to control the aminogenic activity of spontaneous fermen-
mulation of biogenic amines (Vidal-Carou et al., 2007), in the tative microbiota, especially when the diameter of sausages is rel-
present work, it was not possible to find any relationship between atively large.
the proteolytic parameters and the extent of aminogenesis.
The results, dealing with fermented sausages manufactured un-
Acknowledgements
der controlled conditions (from the same raw materials and ingre-
dients), show that even if counts of microorganisms, which could
The authors thank Casademont S.A. and their staff (especially to
potentially be amine producers, were similar during fermentation,
Jordi Bernardo and Anna Julià) for the sausage manufacture and for
a large variability in type and quantity of biogenic amines, indi-
the technical assistance in the microbiological analysis. The
cates that their formation is dependent on a complex interaction
authors are grateful to the following institutions for financial sup-
of factors that determine aminogenic activity. For instance, it is
port: Comissió Interdepartamental de Recerca i Innovació Tec-
recognized that the diameter of the sausages affects different phys-
nològica (CIRIT, 2009 SGR-00668) of the Generalitat de Catalunya
icochemical properties: the greater the diameter the higher the aw
(Spain); XaRTA (Xarxa de Referència en Tecnologia dels Aliments)
due to a lower drying, which also yields a lower salt concentration
of the Generalitat de Catalunya (Spain).
(Demeyer et al., 2000). Moreover, the increase in diameter confers
a greater degree of anaerobiosis, which can be related to a lower
redox potential. These characteristics may favor growth but they References
may especially stimulate the metabolic activity of fermentative
AOAC (2005). Official methods of analysis. Chemist (19th ed.). Washington DC, USA:
LAB, especially if the processing parameters (temperature and rel- Association of Official Analytical.
ative humidity) are close to optimal for LAB growth and activity. As Aymerich, T., Martín, B., Garriga, M., & Hugas, M. (2003). Microbial quality and
a consequence, the pH decreases, due to the production of organic direct PCR identification of lactic acid bacteria and non-pathogenic
staphylococci from artisanal low-acid sausages. Applied Environment
acids (lactic acid) are usually lower in sausages of bigger diameter
Microbiology, 69, 4583–4594.
(e.g. lloganissa) fermented at higher temperatures (e.g. process A). Bover-Cid, S., Hernández-Jover, T., Miguélez-Arrizado, M. J., & Vidal-Carou, M. C.
Similarly, biogenic amine production by aminogenic bacteria (2003). Contribution of contaminant enterobacteria and lactic acid bacteria to
would be enhanced by the same factors: larger diameter and high- biogenic amine accumulation in spontaneous fermentation of pork sausages.
European Food Research and Technology, 216(6), 477–482.
er fermentation temperatures (Ruiz-Capillas & Jimenez-Colmen- Bover-Cid, S., Hugas, M., Izquierdo-Pulido, M., & Vidal-Carou, M. C. (2000).
ero, 2004; Vidal-Carou, Izquierdo-Pulido, Martín, & Mariné, 1990). Reduction of biogenic amine formation using a negative amino acid-
M.L. Latorre-Moratalla et al. / Meat Science 85 (2010) 537–541 541
decarboxylase starter culture for fermentation of fuet sausages. Journal of Food Latorre-Moratalla, M. L., Veciana-Nogués, T., Bover-Cid, S., Garriga, M., Aymerich,
Protection, 63, 237–243. T., Zanardi, E., et al. (2008). Biogenic amines in traditional fermented
Bover-Cid, S., Hugas, M., Izquierdo-Pulido, M., & Vidal-Carou, M. C. (2001). Amino sausages produced in selected European countries. Food Chemistry, 107,
acid-decarboxylase activity of bacteria isolated from fermented pork sausages. 912–921.
International Journal of Food Microbiology, 66, 185–189. Miguélez-Arrizado, M. J., Bover-Cid, S., Latorre-Moratalla, M. L., & Vidal-Carou, M. C.
Bover-Cid, S., Schoppen, S., Izquierdo-Pulido, M., & Vidal-Carou, M. C. (1999). (2006). Biogenic amines in Spanish fermented sausages as a function of
Relationship between biogenic amine contents and the size of dry fermented diameter and artisanal or industrial origin. Journal of the Science of Food and
sausages. Meat Science, 51, 305–311. Agriculture, 86(4), 549–557.
Demeyer, D., Raemaekers, M., Rizzo, A., Holck, A., De Smedt, A., ten Brink, B., et al. Roseiro, L. C., Gomes, A., Gonçalves, H., Sol, M., Cercas, R., & Santos, C. (2010). Effect
(2000). Control of bioflavour and safety in fermented sausages: First results of a of processing on proteolysis and biogenic amines formation in a Portuguese
European project. Food Research International, 33, 171–180. traditional dry-fermented ripened sausage ‘‘chouriço Grosso de estremoz e
Dierick, N., Vandekerckhove, P., & Demeyer, D. (1974). Changes in nonprotein Borda PGI”. Meat Science, 84, 172–179.
nitrogen compounds during dry sausage ripening. Journal of Food Science, 39, Ruiz-Capillas, C., & Jimenez-Colmenero, F. (2004). Biogenic amines in meat and
301–304. meat products. Critical Reviews in Food Science and Nutrition, 44, 489–499.
Hernández-Jover, T., Izquierdo-Pulido, M., Veciana-Nogués, M. T., & Vidal-Carou, M. Suzzi, G., & Gardini, F. (2003). Biogenic amines in dry fermented sausages: A review.
C. (1996). Ion-pair high-performance liquid chromatographic determination of International Journal of Food Microbiology, 88(1), 41–54.
biogenic amines in meat and meat products. Journal of Agricultural and Food Talon, R., Leroy, S., & Lebert, I. (2007). Microbial ecosystems of traditional fermented
Chemistry, 44(9), 2710–2715. meat products: The importance of indigenous starters. Meat Science, 77(1),
Joosten, H. M. L. J. (1997). Conditions allowing the formation of biogenic amines in 55–62.
cheese. III. Factors influencing the amounts formed. Netherlands Milk and Dairy Vidal-Carou, M. C., Izquierdo-Pulido, M., Martín, M. C., & Mariné, A. (1990).
Journal, 41, 329–357. Histamina y Tiramina en derivados cárnicos. Revista Agroquímica de Tecnología
Komprda, T., Sládková, P., & Dohnal, V. (2009). Biogenic amine content in dry Alimentaria, 30, 102–108.
fermented sausage as influenced by a producer, spice mix, starter culture, Vidal-Carou, M. C., Veciana-Nogués, T., Latorre-Moratalla, M. L., & Bover-Cid, S.
sausages diameter and time of ripening. Meat Science, 83, 534–542. (2007). Biogenic amines: Risks and control. In Handbook of fermented meat and
Latorre-Moratalla, M. L., Bover-Cid, S., Talon, R., Aymerich, T., Garriga, M., Zanardi, poultry. Blackwell Publishing.
E., et al. (2010). Distribution of aminogenic activity among potential
autochthonous starter cultures. Journal of Food Protection, 73(3), 524–528.
Artículo VI.
M.L. Latorre-Moratalla, J. Bosch-Fusté, S. Bover-Cid, M.C. Vidal-Carou.
(2012). Influence of technological conditions of sausage fermentation
on the aminogenic activity of L. curvatus CTC273. Food Microbiology,
29: 43-48.
Índice de impacto (JCR 2012): 3,407 2,847
Posición en el área “Food and Science Technology”: 9/124
Food Microbiology
journal homepage: www.elsevier.com/locate/fm
a r t i c l e i n f o a b s t r a c t
Article history: The influence of technological factors (temperature and relative humidity of the manufacturing process
Received 13 April 2011 and the diameter of the sausage) on the aminogenic activity of the strain Lactobacillus curvatus CTC273
Received in revised form was evaluated. Inoculation of sausages with L. curvatus CTC273 resulted in the accumulation of large
29 July 2011
amounts of biogenic amines (higher than 1000 mg/kg dry matter in some samples) during the manu-
Accepted 7 August 2011
facture of fuet and llonganissa sausages. Sausages produced via process ‘A’ (3 days at 20e23 C and 90
Available online 26 August 2011
e95% RH followed by 20 days at 12e14 C and 70% RH) contained significantly higher amounts (p < 0.05)
of biogenic amines than those manufactured via process ‘B’ (23 days at 12e13 C and 70e90% RH),
Keywords:
Dry fermented sausages
specifically tyramine, cadaverine and phenylethylamine in llonganissa and phenylethylamine in fuet. The
Biogenic amines higher fermentation temperature and relative humidity during the fermentation stage in process ‘A’
Temperature promoted decarboxylase activity in L. curvatus CTC273 and thus favoured amine accumulation. The
Relative humidity diameter of the sausages also influenced biogenic amine production. Higher amine levels were found
Diameter (p < 0.05) in llonganissa than in fuet, regardless of the manufacturing conditions. The effect of the factors
considered on the modulation of aminogenic activity is not necessarily linked to the effect of strain
growth, but chiefly favouring proteolytic and decarboxylase reactions.
Ó 2011 Elsevier Ltd. All rights reserved.
0740-0020/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.fm.2011.08.004
44 M.L. Latorre-Moratalla et al. / Food Microbiology 29 (2012) 43e48
evaluated the possible influence of various technological parame- 12e14 C and 70% RH; and process ‘B’ consisted of 23 days at
ters on the aminogenic activity of the microorganisms involved in 12e13 C and 70e90% RH. Process ‘A’ simulated industrial prac-
the fermentation of sausages. However, the type and amount of tices, in which relatively high temperatures and RH (above 20 C
biogenic amines formed depend on multiple and complex vari- and RH over 90%) are applied during the fermentation step with the
ables, all of which can interact, making it difficult to characterise aim of promoting the correct and rapid development of fermen-
the real effect of each factor on aminogenesis. Research focused on tative microbiota (usually using an inoculated starter culture).
each factor is required in order to elucidate when and why ami- Process ‘B’ simulated artisanal manufacturing practices, in which
nogenesis occurs and to enable the implementation of the best temperatures and RH tend be lower than industrial ones (12e15 C
control measures. and 70e90% RH) and constant throughout fermentation and
The strain L. curvatus CTC273, which was isolated from fer- ripening.
mented sausages and is well adapted to meat fermentation condi- Three sausages from each batch were sampled at selected times:
tions, is a strong positive amino acid decarboxylase strain that is able immediately after stuffing (time 0), after 2, 3, 7 and 14 days and the
to simultaneously produce high amounts of tyramine, putrescine, end product (day 23). Samples were examined in duplicate for
cadaverine and phenylethylamine under in vitro conditions (Bover- microbial counts, physico-chemical parameters, nitrogen fractions
Cid et al., 2008). and biogenic amine contents.
Bover-Cid et al. (2008) studied the amino acid decarboxylase
activity of L. curvatus CTC273 in laboratory media in relation to 2.3. Microbial counts
various factors, such as pH, glucose availability and presence of
oxygen. These environmental factors affected the decarboxylase After aseptically removing the casing, 10e20 g of sausage was
enzymes in different ways. For instance, aromatic amines (tyramine diluted 10-fold in buffered peptone water and homogenised in
and phenylethylamine) play a role in neutralisation in non-optimal a Stomacher (model 400, Blender, Cooke Laboratories, Alexandria,
acidic media, whereas putrescine is involved in other processes VA, USA) for 2 min. Serial decimal dilutions were made and LAB
such as the generation of metabolic energy. However, it is generally were enumerated by plating on Man, Rogosa and Sharpe (MRS)
recognised that aminogenic bacterial activity in vitro does not imply agar (Oxoid, Basingstoke, Hampshire, England) at 30 C for 72 h in
the same behaviour in a real fermentation process, since the actual anaerobiosis (anaerobic jars supplied by Anaero-Gen, Oxoid);
environmental conditions of such a process are not reproducible in enterococci were enumerated by plating in kanamycin-esculin-
laboratory media. Studies dealing with the aminogenic behaviour azide agar (Oxoid) at 37 C for 24 h: and Enterobacteriaceae by
of amine-producing bacteria in a real fermentation environment plating in violet red bile glucose agar (Oxoid) with a double layer at
are scarce. 30 C for 24 h.
The present work aimed to study the influence of various In order to check the dominance of the inoculated strain along
technological factors on the aminogenic activity of amino acid manufacturing, the carbohydrate fermentation profile (of the API
decarboxylase positive strain L. curvatus CTC273 under real sausage 50CHL strips, BioMérieux, France) of 10 randomly selected colonies
fermentation conditions. Two different processing conditions from MRS plates was compared with that of L. curvatus CTC273.
(temperature and relative humidity programmes) were used to
manufacture two typical Spanish fermented sausages of different
diameters (fuet and llonganissa). 2.4. Determination of physico-chemical and proteolytic parameters
2. Material and methods The pH was measured using a microcomputerised Crison 2001
pH meter (Crison Barcelona, Spain), inserting the electrode directly
2.1. Bacterial strain into the sausage. Water activity (aw) values were obtained at 25 C
using an AqualabÒ device (Decagon Devices Inc., Pullman, Wash-
The strain L. curvatus CTC273 was obtained from the culture ington). Moisture was determined by drying the sample at
collection of the Institute for Food and Agricultural Research and 100e105 C until constant weight (AOAC, 2005). Total nitrogen (TN)
Technology (IRTA, Monells, Spain). This strain was originally iso- and non-protein nitrogen (NPN) contents were determined using
lated from a fermented pork sausage and showed remarkable the Kjeldahl method (AOAC, 2005). The NPN fraction was extracted
decarboxylase activity under in vitro conditions, producing up to from 5 to 10 g of sample using 0.6 M perchloric acid (Panreac,
2500 mg/l tyramine, 900 mg/l putrescine, 130 mg/l phenylethyl- Barcelona, Spain). The proteolysis index (PI) was calculated as the
amine and 18 mg/l cadaverine after 5 days of aerobic growth in quotient between NPN and TN multiplied by 100 (Astiasarán et al.,
decarboxylase broth at 30 C (Bover-Cid et al., 2008). 1990). The Sörensen method of titration with formaldehyde (AOAC,
2005) was used to determine free amino acids as a-amino nitrogen
2.2. Samples and sampling (AAN).
Four batches of dry fermented sausages were manufactured in 2.5. Determination of biogenic amines
parallel from a common meat batter as those reported in Latorre-
Moratalla et al. (2010b), consisting of 80% lean pork meat and Biogenic amines (tyramine, histamine, putrescine, cadaverine,
20% pork fat, minced and mixed with salt (2.8%, w/w), pepper phenylethylamine and tryptamine) were obtained from Sigma (St.
(0.26%, w/w), dextrose (0.5%, w/w), lactose (2.5%, w/w), sodium Louis, MO, USA) and were analysed by ion-pair reverse-phase high
nitrite (0.015%, w/w) and sodium ascorbate (0.05%, w/w). In the performance liquid chromatography, as described in Hernández-
present batches, the strain L. curvatus CTC273 was inoculated into Jover et al. (1996). Briefly, this method is based on the formation
the meat batter at a level of w106 cfu/g. The meat batter was stuffed of ion-pairs between biogenic amines, previously extracted with
into natural casings of different diameters: fuet with a smaller 0.6 M perchloric acid from 5 to 10 g of sausage sample without
diameter (2.5 cm) and llonganissa with a larger diameter (4.5 cm). casings, and octanesulphonic acid (Romil Chemicals, Cambridge,
Two different processing programmes were used to manufacture UK), which is present in the mobile phase. Amine separation was
each type of product: process ‘A’ consisted of 3 days at 20e23 C performed through a C-18 reverse phase column (Waters Corp.,
and 90e95% relative humidity (RH) followed by 20 days at Milford, MA, USA), followed by a post-column derivatisation with
M.L. Latorre-Moratalla et al. / Food Microbiology 29 (2012) 43e48 45
o-phthalaldehyde (OPA, Merck, Darmstadt, Germany) and spec- differences in the AAN fraction were between sausages of different
trofluorimetric detection (l ex: 340 nm and l em: 445 nm). diameter, with a higher AAN in llonganissa than in fuet (p < 0.05).
In order to allow comparison of the results from different Fig. 2 shows the accumulation of tyramine, putrescine, cadav-
sampling times and batches, the data on nitrogenous fractions and erine, histamine and phenylethylamine during the manufacture of
biogenic amine contents were referred to dry matter (dm). fuet and llonganissa under the processing conditions ‘A’ and ‘B’.
Tyramine was the earliest biogenic amine to appear in all batches
studied. Considerable amounts of tyramine (approximately
2.6. Statistical analysis
100 mg/kg dm) were produced during the first 3 days, coinciding
with the highest drop in pH (Fig. 1). The rate of tyramine accu-
Two-way and one-way ANOVA and t-tests were performed
mulation slowed down after the second week, achieving levels in
using the software package SPSS v.15.0 for Windows (SPSS Inc.,
the final product of between 300 and 500 mg/kg dm, depending on
Chicago, IL, USA).
the batch. Cadaverine and phenylethylamine did not appear until
the 3rd and 7th day of fermentation, respectively. However, the
3. Results & discussion cadaverine content in the end product was similar to that of tyra-
mine, and in the case of llonganissa even slightly higher. Cadaverine
Table 1 shows the microbial counts (LAB, enterococci and in dry fermented sausages is usually associated with the presence
enterobacteria) found at different times throughout the manufac- of relatively high loads of spoilage Gram-negative microbiota,
ture of fuet (2.5 cm diameter) and llonganissa (4.5 cm diameter) which was not the case of the sausages of the present study. The
under the two processing conditions ‘A’ and ‘B’. The LAB counts accumulation of putrescine and histamine in all batches was low
were higher than 9 log (cfu/g) in all batches, from the third day of and the final values did not exceed 16 mg/kg dm in either case.
fermentation until the end of the manufacturing process. Entero- Biogenic amine production during sausage fermentation was
cocci and enterobacteria counts decreased in all samples mainly attributed to the inoculated L. curvatus CTC273. Sausages
throughout the process to low or undetectable levels, respectively. simultaneously manufactured made (in parallel) from a common
No statistically significant differences (p < 0.05) of microbial counts meat batter (with the same raw materials and ingredient), but
were found between processing conditions (‘A’ and ‘B’) or types of fermented by spontaneous microbiota were considered as control
sausage (fuet and llonganissa) for any of the monitored microbial samples. In these control sausages, much lower levels of biogenic
group. amines (below 100 mg/g dm) were accumulated in comparison
The results of the main physico-chemical parameters (pH and with inoculated ones of the present paper. These results were
aw) associated with the fermentation of sausages are shown in previously published in Latorre-Moratalla et al. (2010b). In addi-
Fig. 1. pH showed a strong decrease during the first few days, tion, the sugar profile of the randomly isolated LAB colonies from
coinciding with the growth of LAB, reaching values below 5 in all the MRS plates coincided with that of L. curvatus CTC273, which is
batches. It then remained virtually constant until the end of the in agreement with the dominance (95e99%) of the inoculated
manufacturing process (between 4.80 and 5.20 depending on the strain in the fermented sausages. Thus, L. curvatus CTC273 was
batch). There were no significant differences (p > 0.05) in pH values responsible for the production of large amounts of biogenic amines
between the two processing conditions, except for the pH of day 3 during sausage manufacture, achieving total amine contents of
which was higher in sausages of process B (fermented at higher more than 1000 mg/kg dm in some end products.
temperature and RH). Sausages with a larger diameter were more The aminogenic behaviour of L. curvatus CTC273 in a real
acid (p < 0.05) than smaller sausages following the first week of the fermentation model system followed a similar qualitative profile as
manufacturing process. The decrease in aw was rapid and constant in vitro, during which the strain produced tyramine, putrescine,
in all batches studied, being similar in ‘A’ and ‘B’. In contrast, the aw phenylethylamine and cadaverine (Bover-Cid et al., 2008).
values differed significantly (p < 0.05) in the two types of sausage, However, it should be noted that little putrescine was found in the
with final values of 0.82 in fuet and 0.88 in llonganisa. With regards inoculated sausages, despite the strong in vitro ornithine-
the proteolytic parameters (Table 2), the values of AAN and IP were decarboxylase activity of the L. curvatus CTC273 strain. This could
relatively variable and a clear trend was not apparent. The only be explained by the possible absence or low availability of free
ornithine, which could have been the limiting factor in putrescine
Table 1 production. Putrescine is mainly formed by the decarboxylation of
Microbial counts, as log (cfu/g), during the manufacture of fuet (2.5 cm diameter) ornithine, an amino acid that is detected at low levels or is even
and llonganissa (4.5 cm diameter) inoculated with L. curvatus CTC273. Process A (3
days at 20e23 C and 90e95% RH followed by 20 days at 12e14 C and 70% RH) and
undetectable in fermented or cured meat products (Beriain et al.,
Process B (23 days at 12e13 C and 70e90% RH). Mean (standard deviation). 2000; Alfaia et al., 2004). In contrast, high cadaverine formation
by L. curvatus CTC273 (weak cadaverine producer in vitro) could be
Day Process A Process B
the result of lysine-decarboxylase and ornithine-decarboxylase
Fuet Llonganissa Fuet Llonganissa activity on lysine, as these two amino acids have a similar chem-
LAB 0 6.11 (0.07) 6.11 (0.07) 6.11 (0.07) 6.11 (0.07) ical structure (Bardocz, 1995). The availability of amino acids, as
3 9.31 (0.01) 9.25 (0.02) 9.02 (0.04) 9.15 (0.05) precursors of biogenic amines, is currently under study in order to
7 9.54 (0.1) 9.3 (0.03) 9.15 (0.27) 9.32 (0.06)
14 9.37 (0.12) 9.28 (0.05) 9.34 (0.03) 9.32 (0.06)
elucidate their relationship with the amino acid decarboxylase
23 9.35 (0.08) 9.34 (0.01) 9.33 (0.03) 9.27 (0.06) activity of this aminogenic L. curvatus CTC273 strain.
Enterococci 0 3.12 (0.13) 3.12 (0.13) 3.12 (0.13) 3.12 (0.13) The different technological factors studied (‘A’ and ‘B’ processing
3 1.72 (0.83) 1.55 (0.1) 2.42 (0.16) 2.32 (0.11) conditions and diameter) had a significant effect (p < 0.05) on the
7 1.96 (0.07) 0.98 (0.71) 0.59 (0.07) 1.42 (1.52)
global biogenic amine profile according to the factorial ANOVA.
14 2.54 (0.02) 3.08 (0.22) 2.38 (0.01) 1.99 (0.52)
23 2.24 (0.09) 2.6 (1.19) 1.91 (0.24) 1.86 (0.19) However, the post hoc analysis revealed that this influence varied
Enterobacteria 0 4.03 (0.04) 4.03 (0.04) 4.03 (0.04) 4.03 (0.04) according to the amine, processing condition and type of sausage.
3 2.90 (0.93) 3.22 (0.08) 3.59 (0.07) 3.37 (0.6) Sausages produced using process ‘A’ contained statistically higher
7 3.09 (0.14) 3.09 (0.01) 3.06 (0.05) 3.15 (0.36) amounts (p < 0.05) of biogenic amines than those manufactured
14 1.67 (0.16) 1.88 (0.9) 2.06 (0.45) 2.18 (0.29)
23 <1 <1 <1 <1
using process ‘B’, specifically tyramine, cadaverine and phenyleth-
ylamine in llonganissa and phenylethylamine in fuet (Fig. 2).
46 M.L. Latorre-Moratalla et al. / Food Microbiology 29 (2012) 43e48
Fig. 1. Fate of physico-chemical parameters (pH and aw values) during the manufacture of fuet (2.5 cm diameter) and llonganissa (4.5 cm diameter) inoculated with L. curvatus
CTC273. Process A (3 days at 20e23 C and 90e95% RH followed by 20 days at 12e14 C and 70% RH) and Process B (23 days at 12e13 C and 70e90% RH).
Moreover, biogenic amines formed more rapidly in products proteolytic and decarboxylase reactions. The relatively high pro-
manufactured using process ‘A’ than those manufactured using cessing temperatures and RH during fermentation in process ‘A’,
process ‘B’, in which the increase was more gradual. Although simulating the industrial manufacture of dry fermented sausages,
fermentation temperatures higher than 20 C and elevated RH seemed to promote the decarboxylase activity of L. curvatus CTC273
clearly favoured the growth of aminogenic fermentative microbiota and hence, favoured amine accumulation. Although the levels of
(Maijala and Nurmi, 1995; Suzzi and Gardini, 2003), in this study no biogenic amines found in the spontaneously fermented control
differences in microbial counts were found between the processing products were approximately 10-fold lower, differences were also
conditions, even though there were notable differences in the found according to the processing conditions used (Latorre-
biogenic amine content. Therefore, the effect of the factors Moratalla et al., 2010b). The results were in agreement with those
considered on the modulation of aminogenic activity was not obtained by Masson et al. (1999) who demonstrated that a strain of
necessarily linked to the bacterial growth, but chiefly favouring Carnobacterium divergens produced more tyramine at 25 C than at
15 C. Most of the studies on this issue considered temperature to
Table 2 be the only variable that could affect the aminogenic process.
Proteolytic related parameters (alpha-amino nitrogen, NAA; proteolysis index, IP) Joosten and van Boekel (1988) reported that the histidine decar-
during the manufacture of fuet (2.5 cm diameter) and llonganissa (4.5 cm diameter) boxylase activity of Lactobacillus buchneri increased as fermenta-
inoculated with L. curvatus CTC273. Process A (3 days at 20e23 C and 90e95% RH
tion temperature increased from 15 C to 30 C. Likewise, Kranner
followed by 20 days at 12e14 C and 70% RH) and Process B (23 days at 12e13 C and
70e90% RH). Mean (standard deviation). et al. (1991) reported more histamine formation at a higher
ripening temperature (18 C) compared with a lower one (7 C),
Day Process A Process B
especially with the addition of histidine-producing microorgan-
Fuet Llonganissa Fuet Llonganissa isms. However, RH may also modulate amine formation in dry
AAN (mg/g) 0 0.99 (0.01) 0.99 (0.01) 0.99 (0.01) 0.99 (0.01) fermented sausages.
3 1.31 (0.25) 1.68 (0.22) 0.77 (0.18) 1.68 (0.13) The diameter of the sausages directly affects the conditions (salt
7 1.66 (0.24) 1.29 (0.20) 2.34 (0.71) 1.26 (0.35)
concentration, pH, humidity and degree of proteolysis) that favour
14 1.91 (0.30) 1.76 (0.17) 1.31 (0.23) 1.87 (0.53)
23 1.52 (0.25) 2.15 (0.26) 1.24 (0.28) 2.52 (0.16) the growth and/or metabolic and enzymatic activity of fermenta-
IP (%) 0 5.77 (7.80) 6.78 (1.43) 6.78 (1.43) 6.78 (1.43) tive LAB. In the present study, the diameter of the dry sausages also
3 0.64 (1.25) 1.35 (1.77) e 2.77 (1.17) influenced biogenic amine production. Higher amine levels
7 3.69 (0.33) 0.55 (0.95) 0.45 (0.71) 0.90 (0.80) (p < 0.05) were accumulated in llonganissa than in fuet, both
14 2.38 (0.71) 5.78 (2.40) 3.70 (1.07) 5.64 (2.74)
23 7.82 (1.51) 2.11 (2.16) 9.21 (2.04) 4.23 (1.91)
manufactured from the same raw materials, irrespective of the
processing conditions (Fig. 2). The lower pH values recorded for
M.L. Latorre-Moratalla et al. / Food Microbiology 29 (2012) 43e48 47
mg/kg dm
mg/kg dm
500 500
400 400
300 300
200 200
100 100
0 0
0 5 10 15 20 25 0 5 10 15 20 25
days days
mg/kg dm
500 500
400 400
300 300
200 200
100 100
0 0
0 5 10 15 20 25 0 5 10 15 20 25
days days
TY PU CA HI PHE
Fig. 2. Biogenic amine contents (mg/kg dm) during the manufacture of fuet (2.5 cm diameter) and llonganissa (4.5 cm diameter) inoculated with L. curvatus CTC273. Process A (3
days at 20e23 C and 90e95% RH followed by 20 days at 12e14 C and 70% RH) and Process B (23 days at 12e13 C and 70e90% RH).
llonganissa could favour the aminogenic activity of L. curvatus AOAC, 2005. Official methods of analysis. In: Chemist, nineteenth ed. Association of
Official Analytical, Washington DC, USA.
CTC273. The pH regulates the activity of amino acid decarboxylases,
Astiasarán, I., Villanueva, R., Bello, J., 1990. Analysis of proteolysis and protein
which act as a physiological system in bacteria to neutralise insolubility during the manufacture of some varieties of dry sausage. Meat Sci.
unfavourable acidic environments (Bover-Cid et al., 2008). On the 28, 111e117.
other hand, other intrinsic conditions such as the higher aw value Bardocz, S., 1995. Polyamines in food and their consequences for food quality and
human health. Trends Food Sci. Technol. 6, 341e346.
and free amino acid availability in llonganissa could also explain the Beriain, M.J., Lizaso, G., Chasco, J., 2000. Free amino acids and proteolysis involved
higher levels of biogenic amines found in this type of sausage. Other in “salchichon” processing. Food Control 11, 41e47.
authors have also reported that diameter may affect aminogenesis Bover-Cid, S., Hugas, M., Izquierdo-Pulido, M., Vidal-Carou, M.C., 2000. Amino
acid-decarboxylase activity of bacteria isolated from fermented pork sausages.
in dry fermented sausages (Parente et al., 2001; Komprda et al., Int. J. Food Microbiol. 66, 185e189.
2004, 2009; Miguélez-Arrizado et al., 2006). Bover-Cid, S., Hernández-Jover, T., Miguélez-Arrizado, M.J., Vidal-Carou, M.C., 2003.
Based on these results, the control of fermentation temperatures Contribution of contaminant enterobacteria and lactic acid bacteria to biogenic
amine accumulation in spontaneous fermentation of pork sausages. Eur. J. Food
and RH together with a small diameter can contribute in preventing Res. Technol. 216, 477e482.
the formation of high levels of biogenic amines in fermented Bover-Cid, S., Miguélez-Arrizado, M.J., Becker, B., Holzapfel, W.H., Vidal-Carou, M.C.,
sausages. Traditional processing conditions, characterised by 2008. Amino acid decarboxylation by Lactobacillus curvatus CTC273 affected by
the pH and glucose availability. Food Microbiol. 25, 269e277.
a lower temperature and RH, would be more suitable than indus- Durlu-Özkaya, F., Ayhan, K., Vural, N., 2001. Biogenic amines produced by Enter-
trial processing for controlling or reducing biogenic amine forma- obacteriaceae isolated from meat products. Meat Sci. 58, 163e166.
tion by aminogenic fermentative microbiota. However, to prevent Hernández-Jover, T., Izquierdo-Pulido, M., Veciana-Nogués, M.T., Vidal-Carou, M.C.,
1996. Ion-pair high-performance liquid chromatographic determination of
the growth of potential aminogenic organisms, such as L. curvatus
biogenic amines in meat and meat products. J. Agric. Food Chem. 44,
strain, the use of other control measures, such as the addition of 2710e2715.
autochthonous starter cultures without aminogenic capability, Joosten, H.M.L.J., van Boekel, M.A.J.S., 1988. Conditions allowing the formation of
could be an effective complementary approach for reducing levels biogenic amines in cheese. III. Factors influencing the amounts formed. Neth.
Milk Dairy J. 42, 3.
of biogenic amines (Latorre-Moratalla et al., 2010c). Komprda, T., Smela, D., Pechova, P., Kalhotka, L., Stencl, J., Klejdus, B., 2004. Effect of
starter culture, spice mix and storage time and temperature on biogenic amine
content of dry fermented sausages. Meat Sci. 67, 607e616.
Acknowledgements Komprda, T., Sládková, P., Dohnal, V., 2009. Biogenic amine content in dry fer-
mented sausage as influenced by a producer, spice mix, starter culture, sausages
diameter and time of ripening. Meat Sci. 83, 534e542.
The strain L. curvatus CTC273 was kindly provided by Dr. Marta Kranner, P., Bauer, F., Hellwing, E., 1991. 37th Int. Cong. Meat Sci. Techno. Kulmm-
Hugas (IRTA, Monells, Spain). The authors thank Casademont S.A. bach, Div. 6,12, 889.
Latorre-Moratalla, M.L., Bover-Cid, S., Talon, R., Aymerich, T., Garriga, M., Zanardi, E.,
and their staff (especially Jordi Bernardo and Anna Julià) for Ianieri, A., Fraqueza, M.J., Elias, M., Drosinos, E.H., Lauková, A., Vidal-Carou, M.C.,
manufacturing the sausages and Eva Tolosa for their technical 2010a. Distribution of aminogenic activity among potential autochthonous
assistance in the microbiological and chemical analyses. starter cultures. J. Food Protec. 73, 524e528.
Latorre-Moratalla, M.L., Bover-Cid, S., Vidal-Carou, M.C., 2010b. Technological
conditions influence aminogenesis during spontaneous sausage fermentation.
Meat Sci. 85, 537e541.
References Latorre-Moratalla, M.L., Bover-Cid, S., Talon, R., Garriga, M., Zanardi, E., Ianieri, A.,
Fraqueza, M.J., Elias, M., Drosinos, E.H., Vidal-Carou, M.C., 2010c. Strategies to
Alfaia, C.M., castro, M.F., Reis, V.A., Prates, J.M., Almeida, I.T., Correira, A.D., reduce biogenic amine accumulation in traditional sausage manufacturing.
Dias, M.A., 2004. Changes in the profile of free amino acids and biogenic amines LWT-Food Sci. Technol. 43, 20e25.
during the extended short ripening of Portuguese dry-cured ham. Food Sci. Maijala, R., Nurmi, E., 1995. Influence of processing temperature on the formation of
Tech. Int. 10 (5), 297e304. biogenic amine in dry sausages. Meat Sci. 39, 9e22.
48 M.L. Latorre-Moratalla et al. / Food Microbiology 29 (2012) 43e48
Masson, F., Johanson, G., Montel, M., 1999. Tyramine production by a strain of traditional dry-fermented ripened sausage “chouriço Grosso de estremoz e
carnobacterium divergens inoculated in meat-fat mixture. Meat Sci. 52, Borda PGI”. Meat Sci. 84, 172e179.
65e69. Ruiz-Capillas, C., Jimenez-Colmenero, F., 2004. Biogenic amines in meat and meat
Miguélez-Arrizado, M.J., Bover-Cid, S., Latorre-Moratalla, M.L., Vidal-Carou, M.C., products. Crit. Rev. Food Sci. Nutr. 44, 489e499.
2006. Biogenic amines in Spanish fermented sausages as a function of diameter Straub, B.W., Kicherer, M., Schilcher, S.M., Hammes, W.P., 1995. The formation of
and artisanal or industrial origin. J. Sci. Food Agric. 86, 549e557. biogenic amines by fermentation organisms. Z. Lebensmittel-Untersuchung-
Parente, E., Martuscelli, M., Gardini, F., Grieco, S., Crudele, M.A., Suzzi, G., Forschung 201 (1), 79e82.
2001. Evolution of microbial populations and biogenic amine production Suzzi, G., Gardini, F., 2003. Biogenic amines in dry fermented sausages: a review. Int.
in dry sausages produced in southern Italy. J. Appl. Microbiol. 90, J. Food Microbiol. 88, 41e54.
882e891. Vidal-Carou, M.C., Veciana-Nogués, T., Latorre-Moratalla, M.L., Bover-Cid, S., 2007.
Roseiro, L.C., Gomes, A., Gonçalves, H., Sol, M., Cercas, R., Santos, C., 2010. Effect of Biogenic amines: risks and control. In: Handbook of Fermented meat and
processing on proteolysis and biogenic amines formation in a Portuguese Poultry. Blackwell Publishing.
RESULTADOS
9
ESTRATÉGIAS PARA REDUCIR LA
ACUMULACIÓN DE AMINAS EN PRODUCTOS
CÁRNICOS CRUDOS-CURADOS
FERMENTADOS DE ELABORACIÓN
ARTESANAL
La reducción de los contenidos de aminas biógenas es un aspecto importante
para la obtención de alimentos que cumplan con las premisas actuales sobre calidad
higiénica y seguridad alimentaria.
En esta línea, uno de los objetivos de esta tesis fue la evaluación de posibles
medidas de control para la obtención de embutidos fermentados de elaboración
artesanal libres o con bajos niveles de aminas biógenas, sin que se vean alteradas las
características sensoriales típicas de estos productos.
Este capítulo recoge dos trabajos que evalúan la eficacia de diferentes medidas
de control destinadas a la reducción de la aminogénesis en productos cárnicos
fermentados artesanales. Para este fin, se plantearon estrategias de forma individual o
combinada a nivel de:
189
RESULTADOS
Artículo VII.
M.L. Latorre-Moratalla, S. Bover-Cid, T. Aymerich, B. Marcos, M.C. Vidal-Carou, M.
Garriga. (2007). Aminogenesis control in fermented sausages manufactured with
pressurized meat batter and starter culture. Meat Science, 75 (3):460-469.
Índice de impacto (JCR 2008): 2,183
Posición en el área “Food and Science Technology”: 17/107
191
ESTRATEGIAS PARA REDUCIR LA ACUMULACIÓN DE AMINAS EN EMBUTIDOS ARTESANALES
El objetivo del presente trabajo fue evaluar la posible aplicación de las APH
sobre las materias primas para intentar reducir la acumulación de aminas biógenas
durante el proceso de fermentación y contribuir a la mejora de la seguridad y la calidad
del producto final. Además, se utilizó un cultivo iniciador autóctono compuesto por
diversas cepas de lactobacilos y estafilococos descarboxilasa negativos in vitro, con el
objetivo de evaluar su resistencia al tratamiento de presurización y su habilidad para
inhibir la aminogénesis en dos tipos de productos cárnicos fermentados.
192
RESULTADOS
Para cada lote se tomaron muestras durante diferentes puntos del proceso de
elaboración: a tiempo 0 y después de 7, 14 y 21 días.
9.1.3 Resultados
193
ESTRATEGIAS PARA REDUCIR LA ACUMULACIÓN DE AMINAS EN EMBUTIDOS ARTESANALES
194
RESULTADOS
195
ESTRATEGIAS PARA REDUCIR LA ACUMULACIÓN DE AMINAS EN EMBUTIDOS ARTESANALES
196
RESULTADOS
Artículo VII.
197
MEAT
SCIENCE
Meat Science 75 (2007) 460–469
www.elsevier.com/locate/meatsci
Received 11 January 2006; received in revised form 21 July 2006; accepted 24 July 2006
Abstract
The application of high hydrostatic pressure (200 MPa) to meat batter just before sausage fermentation and the inoculation of starter
culture were studied to improve the safety and quality of traditional Spanish fermented sausages (fuet and chorizo). Higher amounts of
biogenic amines were formed in chorizo than in fuet. Without interfering with the ripening performance in terms of acidification, drying
and proteolysis, hydrostatic pressure prevented enterobacteria growth but did not affect Gram-positive bacteria significantly. Subse-
quently, a strong inhibition of diamine (putrescine and cadaverine) accumulation was observed, but that of tyramine was not affected.
The inoculated decarboxylase-negative strains, selected from indigenous bacteria of traditional sausages, were resistant to the HHP treat-
ment, being able to lead the fermentation process, prevent enterococci development and significantly reduce enterobacteria counts. In
sausages manufactured with either non-pressurized or pressurized meat batter, starter culture was the most protective measure against
the accumulation of tyramine and both diamines.
Ó 2006 Elsevier Ltd. All rights reserved.
Keywords: Fermented sausages; High hydrostatic pressure; Starter culture; Biogenic amines; Enterococci; Enterobacteria
0309-1740/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved.
doi:10.1016/j.meatsci.2006.07.020
M.L. Latorre-Moratalla et al. / Meat Science 75 (2007) 460–469 461
of hygienic conditions of both raw materials and process- gate their resistance to HHP and their ability to inhibit
ing is one of the key measures that enable the control of aminogenesis in two different types of traditional Spanish
the aminogenesis during food processing and storage fermented sausages: fuet and chorizo.
(Bover-Cid & Holzapfel, 1999; Bover-Cid, Izquierdo-
Pulido, & Vidal-Carou, 2001; Halász, Báráth, Simon-Sark-
adi, & Holzapfel, 1994). 2. Materials and methods
The hygienic quality of raw materials may be improved
by decreasing microbial loads through sterilization or pas- 2.1. Sausage manufacture and sampling
teurization, which is a common practice in the cheese mak-
ing industry. However, in the case of fermented meat The experiment was carried out with two types of tradi-
products, high temperatures cause detrimental changes in tional low-acid fermented sausages: fuet and chorizo. A
the raw materials, and thus, it is not possible to apply con- total of eight batches of fermented sausages were manufac-
ventional heat treatments. Alternative non-thermal tech- tured in parallel (following the experimental design of
nologies show challenging possibilities in this connection. Fig. 1) from the same lot of raw materials consisting of
For instance, high hydrostatic pressure (HHP) is getting 50% of lean pork meat and 50% pork back fat. Meat raw
popularity especially in relation to the so-called hurdle materials were minced at ÿ1 °C in a meat cutter (Tecmap,
technology. Thanks to its advantages in comparison to Barcelona, Spain), with an adjustable plate set at a hole
thermal treatments to inactivate microorganisms with min- diameter of 6 mm, and then mixed with other ingredients
imal sensory changes to the product, HHP has promising in a mixer machine (model 35P, Tecnotrip S.A., Terrassa,
applications to satisfy consumer demand for high quality Spain). For fuet sausages the ingredients were 20 g/kg
and safe meat products (Hugas, Garriga, & Monfort, sodium chloride, 2.5 g/kg black pepper, 1.0 g/kg dextrose,
2002). Some works have been published dealing with the 0.5 g/kg sodium ascorbate 0.1 g/kg potassium nitrate and
effect of HHP on the stability of meat products and its bio- 0.1 g/kg sodium nitrite. Chorizo sausages contained 20 g/
genic amine content during storage (Garriga et al., 2005; kg sodium chloride, 15 g/kg cayenne pepper, 15 g/kg
Ruı́z-Capillas & Jiménez-Colmenero, 2004). To the best paprika, 3.0 g/kg powdered garlic and 1.0 g/kg dextrose.
of our knowledge, within the field of biogenic amines, the Cayenne pepper and paprika supplied 0.05 g/kg nitrate
effect of HHP applied to raw materials has only been stud- and 0.04 g/kg nitrite as curing agents for chorizo sausage
ied in milk used for cheese production as an alternative to (Garriga et al., 2005).
pasteurization, with equivalent effects on aminogenesis The mixture for each type of product was divided in two
(Novella-Rodrı́guez, Veciana-Nogués, Trujillo-Mesa, & further parts. To one of them a mixture of bacteria consist-
Vidal-Carou, 2002). However, no research has been carried ing of two strains of Lactobacillus sakei (CTC6469 and
out in relation to fermented sausages. CTC6626) and two strains of Staphylococcus xylosus
Traditional Spanish low-acid ripened sausages are man- (CTC6013 and CTC6169) was inoculated to achieve
ufactured following traditional procedures, which are 4 · 105 CFU/g of sausage for each specie. These strains
based on a spontaneous fermentation process at a relatively had previously been isolated from traditional low-acid fer-
low temperature of approximately 10–15 °C. The ripening mented sausages and had demonstrated a proper perfor-
and drying process ensures low water activity values, but mance as starter cultures for both fuet and chorizo
these slightly fermented products are characterized by a rel- (Garriga et al., 2005). The other part was not inoculated
atively high pH (over 5.3). Microflora contaminating raw in order to proceed with a spontaneous fermentation. Sau-
materials (Gram-negative bacteria) may not be totally sages were stuffed into collagen casings (4 cm diameter;
inhibited during the manufacture, compromising the safety Colex 32 mm, Fibra S.A., Girona, Spain). For each type
and stability of the final product. The inoculation of com- of product, either without or with starter culture, half of
petitive and decarboxylase-negative starter culture has the stuffed sausages were vacuum packaged in polyamide-
been shown to be a useful tool to inhibit spontaneous polyethylene bags (Sacoliva, Castellar del Vallès, Spain)
aminogenic microflora and thus considerably reduce and submitted to a high hydrostatic pressure treatment of
aminogenesis (Bover-Cid, Hugas, Izquierdo-Pulido, & 200MPa for 10 min at 17 °C, using an industrial high
Vidal-Carou, 2000). However, the selection of appropriate hydrostatic pressurization unit (Alstom, Nantes, France);
strains is needed to keep the typical sensory characteristics whereas the other half were not pressurized. Packaging
of particular artisanal products (Di Maria, Basso, Santoro, was removed after the high pressure processing. All sau-
Grazia, & Coppola, 2002). sages were hung in a climate chamber MLR.350 H (Sanyo
In this frame, the present work deals with the study of Electric Co., Ora-Gun, Japan) at 12 °C and with a relative
the potential application of mild HHP treatments on meat humidity of >95% for 10 days and reduced to 80% till the
batter just before fermentation to improve the safety and end of the ripening process (21 days). Three sausages from
quality of the final product. Moreover, decarboxylase-neg- each batch were sampled during the ripening process at
ative starter cultures, accurately selected from the indige- selected times: just after stuffing (time 0) and after 1, 2
nous microflora of traditional sausages showing optimal and 3 weeks. The analytical determinations were per-
technological properties, were assessed in order to investi- formed in triplicate.
462 M.L. Latorre-Moratalla et al. / Meat Science 75 (2007) 460–469
Pork meat
and fat
Fuet1 Chorizo2
(F) (C)
Fig. 1. Experimental design for the study of aminogenesis in fuet and chorizo sausages manufactured through spontaneously and starter mediated
fermentation, without and with high hydrostatic pressure treatment.
2.2. Microbial analysis 1995). To evaluate the proteolysis, total nitrogen was deter-
mined following the official Kjeldahl method in 2000 Kjel-
After aseptically removing the casing, approximately tecÒ equipment (Tecator, Foss España S.A., Barcelona,
20 g of sausage were 10-fold diluted in buffered peptone Spain). From a 0.6 N perchloric extract of the sample with-
water (AES Laboratories, Combourg, France) and homog- out casing, the non-protein nitrogen was also determined
enized in a Masticator (model 400, Cooke Laboratories, by Kjeldahl and the free amino acid fraction (as a-amino
Alexandria, VA, USA) for 1 min. Serial decimal dilutions nitrogen) by the Sorensen method through volumetric
were made and lactic acid bacteria (LAB) were enumerated titration with 0.01 N sodium hydroxide after reaction with
by pour plating in Man, Rogosa and Sharpe (MRS) agar formaldehyde (AOAC, 1995). The proteolysis index was
(Difco Laboratories, Detroit, MI, USA) at 30 °C for 72 h calculated as the quotient between NPN and TN multiplied
in anaerobiosis (Oxoid jars with Anaero-Gen; Oxoid, by 100 as described by Astiasarán, Villanueva, and Bello
Basingstoke, Hampshire, England), Gram-positive catalase (1990).
positive cocci (GCC+) by spread plating on mannitol salt Biogenic amines (tyramine, histamine, putrescine,
agar (Difco Laboratories) at 30 °C for 48 h, enterococci cadaverine, phenylethylamine, tryptamine, agmatine, sper-
by pour plating in kanamycin-esculin-azide agar (Oxoid midine and spermine) were extracted with 0.6 N perchloric
LTD) at 37 °C for 24 h, Enterobacteriaceae by pour plating acid from spices (black pepper, cayenne pepper, paprika
in violet red bile glucose agar (Merck, Darmstadt, Ger- and powdered garlic), raw meat batter and sausages with-
many) with a double layer at 30 °C for 24 h. out casings during ripening. Thereafter, they were deter-
The implantation of the inoculated strains and their mined by ion-pair reverse-phase column high
dominance over the spontaneous flora were monitored by performance liquid chromatography with post-column
plasmid and RAPD profiling analysis as previously derivatization with ortho-phthalaldehyde according to the
reported by Garriga et al. (2005). procedure described by Hernández-Jover, Izquierdo-
Pulido, Veciana-Nogués, and Vidal-Carou (1996).
2.3. Physico-chemical, nitrogenous fraction and biogenic Due to the typical loss of water content during the man-
amine analysis ufacturing process, the results of nitrogenous fractions and
biogenic amine contents of samples, except for raw materi-
Values of pH were determined using a Crison Basic 20 als, were referred to dry matter (dm).
pH-meter by directly inserting an electrode into the sausage
(model 52-32, Crison Instruments, S.A., Barcelona, Spain). 2.4. Statistical analysis
Water activity was measured with the AquaLabÒ Series 3
Aw-meter (Decagon Devices Inc., Pullman, Washington, Data was statistically treated using the SPSS 11.0 for
USA). Water content was measured gravimetrically, drying Windows software (SPSS Inc., Chicago, IL, USA) in
a sample aliquot to a constant weight at 102 °C (AOAC, order to determine the significance of the effect of starter
M.L. Latorre-Moratalla et al. / Meat Science 75 (2007) 460–469 463
inoculation as well as the hydrostatic pressure treatment. A starter culture strains was confirmed by plasmid and
two-way ANOVA was applied to rule out an interactive RAPD profile (data not shown). Maximum LAB counts
effect of starter culture and high hydrostatic pressure treat- were reached after one and two weeks of ripening in starter
ment, then a one-way analysis of the variance (ANOVA) (S) and spontaneously (nS) fermented batches, respectively.
together with the post hoc contrasts of Tuckey’s HSD test GCC+ grew to a lesser extent than LAB, even in batches
was applied to examine the differences between products where S. xylosus strains had been inoculated as starters.
(fuet and chorizo) and among batches. After ripening (21 days), irrespective of the type and starter
inoculation, LAB counts were over 8 logarithmic units,
3. Results and discussion whereas GCC+ did not surpass 7.5 logs. Overall, the high
pressure processing of the sausages just after stuffing did
3.1. Microbial results not influence the initial LAB and GCC+ counts signifi-
cantly or their progression during the manufacture in any
Raw meat materials and spices used to manufacture the of the products without or with starter culture inoculation.
fuet and chorizo sausages were examined for their microbi- The behaviour of enterococci during fermentation and
ological quality. Bacterial counts corresponding to meat ripening was similar in fuet and chorizo batches. Thus,
batter (as the mixture of lean meat and back fat) were rel- spontaneously fermented products showed increasing loads
atively low, in log(CFU/g): 3.38 for LAB, 4.38 for GCC+, of enterococci during the first week and then remained
2.68 log for enterococci and <2 for enterobacteria, indicat- around 104 CFU/g. No effect by the HHP processing was
ing a good hygienic quality of meat raw materials. Spices observed. By contrast, the starter inoculation prevented
were examined for the total mesophilic aerobic counts; high enterococci development significantly remaining around
loads up to 7.4 log(CFU/g) were found in black pepper and 102 CFU/g throughout the ripening.
cayenne pepper, 6.2 log(CFU/g) in paprika and 4.6 log More important and significant differences in relation to
(CFU/g) in powdered garlic. the occurrence of enterobacteria were found among all the
Changes in bacterial counts during sausage fermentation batches. On the one hand, non-pressurized spontaneously
and ripening are shown in Table 1. Due to starter inocula- fermented sausages showed a notable increase of entero-
tion, initial LAB and GCC+ counts were higher in batches bacteria loads during the first week of fermentation, in fuet
FS and CS than FnS and CnS. The implantation of the (FnS-nP) being slightly lower than in chorizo (CnS-nP).
Table 1
Microbial countsa, log(CFU/g), during the manufacture of fuet and chorizo through spontaneously and starter mediated fermentation, without and with
high hydrostatic pressure treatment
Day Fuet (F) Chorizo (C)
Control – spontaneous Starter (S) Control – spontaneous Starter (S)
fermentation (nS) fermentation (nS)
Not pressurized Pressurized (P) Not pressurized Pressurized (P) Not pressurized Pressurized (P) Not pressurized Pressurized (P)
FnS-nP FnS-P FS-nP FS-P CnS-nP CnS-P CS-nP CS-P
LAB
0 3.47 (0.13) 3.47 (0.13) 5.70 (0.13) 5.70 (0.13) 3.65 (0.41) 3.65 (0.41) 5.65 (0.14) 5.65 (1.38)
7 8.29 (0.03) 8.27 (0.02) 9.39 (0.45) 8.96 (0.04) 8.26 (0.07) 8.41 (0.03) 9.54 (0.05) 8.98 (1.45)
13 8.81 (0.09) 8.80 (0.04) 9.14 (0.14) 9.16 (0.07) 9.03 (0.16) 9.12 (0.10) 9.59 (0.05) 9.74 (0.03)
21 8.18 (0.23) 8.74 (0.15) 8.78 (0.15) 8.70 (0.07) 8.66 (0.11) 8.95 (0.14) 9.31 (0.11) 9.51 (0.13)
GCC+
0 4.04 (0.64) 4.09 (0.64) 5.55 (0.10) 5.60 (0.10) 3.16 (0.28) 3.68 (0.28) 6.58 (0.08) 5.73 (1.16)
7 5.49 (0.29) 5.49 (0.64) 6.05 (0.31) 5.53 (0.15) 5.79 (0.55) 6.75 (0.22) 7.04 (0.26) 6.51 (0.33)
13 6.21 (0.07) 6.99 (0.42) 7.30 (0.46) 6.84 (0.79) 6.99 (0.13) 7.37 (0.24) 7.32 (0.37) 6.44 (0.70)
21 6.15 (0.26) 7.41 (0.81) 7.40 (0.29) 6.86 (0.19) 6.68 (0.06) 7.42 (0.14) 7.13 (0.47) 6.67 (0.39)
Enterococci
0 2.64 (0.06) 2.66 (0.06) 2.48 (0.13) 2.29 (0.13) 2.66 (0.47) 4.62 (0.47) 2.90 (0.39) 2.59 (0.26)
7 4.62 (0.24) 4.75 (0.16) 2.06 (0.21) 2.20 (0.17) 4.73 (0.21) 4.57 (0.30) 2.37 (0.17) 2.33 (0.43)
13 4.78 (0.76) 4.26 (0.20) 2.13 (0.35) 2.28 (0.20) 4.62 (0.49) 4.63 (0.31) 2.22 (0.17) 2.16 (0.28)
21 3.79 (0.28) 4.32 (0.17) 2.14 (0.08) 1.88 (0.25) 4.19 (0.41) 4.79 (0.18) 2.50 (0.05) 2.33 (0.05)
Enterobacteria
0 <2 <2 <2 <2 <2 <2 <2 <2
7 5.60 (1.10) <2 <2 <2 6.62 (0.44) 3.60 (0.59) <2 <2
13 4.51 (1.24) <2 <2 <2 5.67 (1.10) 3.63 (0.95) <2 <2
21 <2 <2 <2 <2 3.52 (0.66) 2.48 (1.36) <2 <2
a
Data are expressed as the mean and in italics the standard deviation of the three sausage replicates.
464 M.L. Latorre-Moratalla et al. / Meat Science 75 (2007) 460–469
Thereafter, a decrease was observed to <102 CFU/g in fuet in a much stronger acidification during the first week of
and to 5 · 103 CFU/g in chorizo at the end of the ripening. production, again to lower pH values in chorizo than in
HHP treatment inhibited enterobacteria growth in fuet fuet. Then, a pH increase of 0.35–0.42 U occurred and as
(FnS-P), in which they were below the detection limit a consequence final pH values were not significantly differ-
throughout the ripening, and significantly reduced its ent from the corresponding spontaneously fermented
development in chorizo (CnS-P). Nevertheless, starter cul- batches. The HHP treatment did not seem to affect the fer-
tures were much more effective in inhibiting enterobacteria mentative activity of either the spontaneous microflora or
growth, since they quickly decreased not only in fuet (FS- the starter culture, and the course of acidification was the
nP and FS-P) but also in chorizo (CS-nP and CS-P) same between non-pressurized and pressurized sausages.
sausages. Values of Aw decreased gradually during the first two
weeks and more intensively during the last week of the rip-
3.2. Physico-chemical and proteolysis related parameters ening, reaching final values lower than 0.85 in all products.
No significant differences were found between products
Fig. 2 shows the pH and Aw values of sausages during (fuet and chorizo), by the inoculation of starters or by
the production process. Initial pH values were within the HHP treatment. The same can be said regarding water con-
normal range (Ordóñez, Hierro, Bruna, & de la Hoz, tent decrease (from 62.5% to 36.7% on average). Since all
1999). Spontaneously fermented batches showed a weak samples were hung in the same climatic chamber under
acidification without statistically significant effect due to the same environmental conditions, it can be concluded
HHP application. Chorizo sausages showed slightly lower that the drying process was not affected by the different for-
pH values than fuet, which could be related to an extra mulation (type of product), the inoculation of starter cul-
amount of fermentable carbohydrates coming from tures or the high pressure processing.
paprika added to chorizo (Lois, Gutiérrez, Zumalacárre- The evolution of the proteolysis related parameters was
gui, & López, 1987). The inoculation of the starter resulted affected by the type of product, the inoculation of starter
6.0 6.0
5.8 5.8
5.6 5.6
5.4 5.4
pH
pH
5.2 5.2
5.0 5.0
4.8 4.8
4.6 4.6
0 FnS-nP 7 FnS-P 14 FS-nP 21 FS-P 0 CnS-nP 7 CnS-P 14 CS-nP 21 CS-P
Days Days
0.98 0.98
0.94 0.94
0.90 0.90
Aw
Aw
0.86 0.86
0.82 0.82
0.78 0.78
0.74 0.74
0 7 14 21 0 7 14 21
Days Days
Fig. 2. Changes in pH (top) and water activity (bottom) during the manufacture of fuet (F, left column) and chorizo (C, right column) through
spontaneously (nS) and starter (S) mediated fermentation, without (nP) and with (P) high hydrostatic pressure treatment.
M.L. Latorre-Moratalla et al. / Meat Science 75 (2007) 460–469 465
culture as well as the application of HHP, but in a different although the PI values show a tendency to be higher in
manner depending on the parameter (Table 2). The PI, as pressurized batches when compared to non-treated ones,
the percentage of NPN among total nitrogen, did not nothing can be stated about the effect of HHP (200 MPa)
increase significantly during manufacture, and the starter on the proteolytic changes during the ripening of fuet
culture had little influence. By contrast, HHP treatment and chorizo.
resulted in higher values of PI, which was especially evident The high pressure processing of the meat batter did not
for chorizo sausages. However, differences in the overall PI significantly affect the ripening performance, since no sig-
among the four batches of each product were not statisti- nificant differences were observed in the pH, Aw and pro-
cally significant according to the post hoc contrasts of teolysis. Moreover, the colour of the sausages was not
the ANOVA test (HSD of Tuckey). Concerning the con- visually affected by the pressure treatment applied.
tent of free amino acids, values of AAN increased gradu-
ally throughout the ripening, at a higher rate in chorizo 3.3. Aminogenesis
sausages in comparison with fuet. Although batches with
starter cultures tended to show higher AAN values than Contents of biogenic amines of raw materials are shown
those spontaneously fermented, differences were never sta- in Table 3. In meat batter, the only amines present in sig-
tistically significant. Neither did the HHP seem to exert any nificant amounts were the physiological polyamines sper-
effect on AAN release. The proteolysis occurring during midine and spermine, which conforms with the high
meat fermentation is a rather complicated phenomenon hygienic quality of meat used for sausage elaboration, as
involving several types of endogenous and microbial do the microbial counts. Other biogenic amines were found
enzymes (Ordóñez et al., 1999). The respective roles have in the spices. In the particular case of powdered garlic,
been a source of controversy, but numerous studies over added in chorizo manufacture, considerable levels of tyra-
the last decade have concluded that muscle proteinases mine and lower levels of phenylethylamine were detected.
(particularly cathepsin D) are activated by the drop of However, the final quantitative contribution of these spices
pH and seem primarily responsible for proteolysis during to the total biogenic amine pool in the stuffed sausage was
the early fermentation, while bacterial enzymes are more insignificant (always below 0.05 mg/kg to the final mix-
important during the latter stages of ripening (Hughes ture), since they are incorporated in low concentrations
et al., 2002). It has been reported that high pressure up from 2.5 g/kg to 15 g/kg. On the other hand, the aerobic
to 400 MPa may induce proteolysis due to lysosomal mem- counts in spices ranged from 4.6 to 7.4 log(CFU/g), and
brane breakdown with the consequent release of proteases thus their contribution to total bacterial load of the meat
into the cytosol and, in turn, the activation of some cathep- batter might be calculated to range from 2 to 5 log(CFU/
sins (Homma, Ikeuchi, & Suzuki, 1994; Jung, Lamballerie- g) depending on the spices. The occurrence of biogenic
Anton, Taylor, & Ghoul, 2000). In the present study, amines (especially aromatic amines and cadaverine) in
Table 2
Resultsa on proteolytic related parameters (a-amino nitrogen, NAA; non-protein nitrogen, NPN; proteolysis index, PI) during the manufacture of fuet and
chorizo through spontaneously and starter mediated fermentation, without and with high hydrostatic pressure treatment
Day Fuet (F) Chorizo (C)
Spontaneous fermentation (nS) Starter (S) Spontaneous fermentation (nS) Starter (S)
Not pressurized Pressurized Not pressurized Pressurized Not pressurized Pressurized Not pressurized Pressurized
(nP) (P) (P) (nP) (P) (nP) (P)
FnS-nP FnS-P FS-nP FS-P CnS-nP CnS-P CS-nP CS-P
AAN (mg/g dw)
0 1.10 (0.11) 1.41 (0.10) 1.23 (0.05) 1.41 (0.12) 1.28 (0.17) 1.58 (0.28) 1.37 (0.09) 1.66 (0.19)
7 1.74 (0.27) 1.60 (0.10) 2.56 (0.69) 2.02 (0.20) 2.06 (0.06) 2.19 (0.22) 2.40 (0.07) 2.46 (0.14)
13 2.99 (0.62) 1.64 (0.04) 2.32 (0.19) 2.41 (0.20) 2.64 (0.06) 2.64 (0.03) 3.11 (0.18) 2.90 (0.11)
21 1.97 (0.26) 2.08 (0.10) 1.92 (0.15) 2.51 (0.02) 3.12 (0.32) 3.07 (0.18) 2.83 (0.09) 3.42 (0.18)
NPN (mg/g dw)
0 1.20 (0.75) 1.83 (0.45) 1.44 (0.28) 2.74 (0.88) 3.23 (0.50) 4.01 (2.26) 4.06 (0.58) 4.60 (1.08)
7 1.14 (0.68) 1.60 (0.10) 3.64 (2.94) 2.28 (1.21) 7.10 (3.48) 5.66 (0.27) 6.05 (1.15) 4.22 (1.31)
13 0.86 (0.56) 2.25 (0.21) 1.61 (1.01) 2.70 (0.58) 2.92 (1.01) 3.73 (0.41) 0.72 (0.21) 2.91 (0.63)
21 2.17 (1.18) 3.55 (0.68) 1.86 (0.47) 3.76 (0.54) 4.07 (1.30) 4.56 (1.98) 3.73 (1.64) 5.28 (0.06)
PI (%)
0 1.54 (0.14) 2.54 (0.60) 1.48 (0.09) 3.31 (1.12) 1.84 (0.16) 5.68 (2.91) 2.14 (0.11) 7.16 (1.43)
7 2.36 (0.37) 2.12 (0.05) 3.16 (0.85) 2.86 (1.58) 2.77 (0.02) 7.66 (0.43) 3.41 (0.28) 5.73 (1.57)
13 4.06 (0.69) 2.99 (0.22) 2.88 (0.28) 3.27 (0.67) 3.31 (0.01) 4.77 (0.53) 4.23 (0.14) 4.06 (0.96)
21 2.62 (0.13) 4.45 (0.75) 2.37 (0.10) 5.07 (1.11) 3.65 (0.31) 5.72 (2.21) 3.76 (0.07) 6.96 (0.34)
a
Data are expressed as the mean and in italics the standard deviation of the three sausage replicates.
466 M.L. Latorre-Moratalla et al. / Meat Science 75 (2007) 460–469
Table 3
Mean (standard deviation) values of biogenic amine contents (mg/kg fresh matter) of spices and raw meat batter used for sausage manufacturing
Black pepper Paprika Cayenne pepper Powdered garlic Meat batter
Tyramine 3.69 (0.12) 3.60 (0.38) 0.48 (0.01) 15.76 (0.12) <0.3
Phenylethylamine n.d.a n.d. n.d. 2.03 (0.18) n.d.
Putrescine n.d. 5.40 (0.18) 2.92 (0.28) 10.23 (0.27) n.d.
Cadaverine 2.50 (0.09) 3.34 (0.12) <0.3 2.31 (0.08) n.d.
Agmatine n.d. 4.48 (0.25) 7.79 (0.44) 3.10 (0.09) n.d.
Spermidine 0.76 (0.15) 6.34 (0.30) 4.00 (0.82) 32.72 (0.02) 2.82 (0.38)
Spermine 5.04 (0.66) 8.70 (0.38) 4.13 (1.05) 20.49 (0.13) 24.26 (3.64)
a
n.d., not detected.
spices may be indicative of contamination with amino acid- (Fig. 4). Batches without starter culture and no HHP treat-
decarboxylase positive microorganisms. In this sense, ment (that is, FnS-nP and CnS-nP) can be considered as
spices might have been vehicles of potentially aminogenic ‘‘control’’, from which the influence of formulation on
microorganisms to meat batter or eventually amino acid- the quantitative and qualitative aspects of aminogenesis
decarboxylase enzymes, which might have contributed to can be determined. Biogenic amine accumulation was
biogenic amine accumulation during the subsequent fer- much lower in fuet that in chorizo sausages. Tyramine
mentation and ripening process. was the only biogenic amine detected in fuet, whereas
During sausage manufacture, contents of physiological cadaverine was the major amine in chorizo sausages, which
polyamines did not show significant changes (p > 0.05). is usually associated with lysine-decarboxylase activity of
No influence of starter inoculation or HHP processing undesirable Gram-negative bacteria (Bover-Cid & Holzap-
was observed in either type of product, fuet or chorizo fel, 1999; Bover-Cid, Miguélez-Arrizado, Latorre-Mora-
(Fig. 3). These data are in agreement with the hypothesis talla, & Vidal-Carou, 2006). Tyramine was the second
that spermidine and spermine in meat products are of amine, followed by putrescine. No other biogenic amine
endogenous origin, not being formed by microbial activity. (histamine, phenylethylamine or tryptamine) was detected
By contrast, the main biogenic amines associated with in any sample. Several explanations can be made to
bacterial activity in fermented meat products (tyramine, account for the differences in the biogenic amine accumula-
putrescine and cadaverine) were influenced by all three tion between products. On the one hand, the spices added
variables studied (product type, starter culture and HHP in chorizo (mainly garlic, but also cayenne pepper and
treatment), in a different manner depending on the amine paprika) may have been a vehicle of aminogenic contami-
100 Spermidine
90 Spermine
80
70
60
mg/kg dm
50
40
30
20
10
0
FnS-nP FnS-P FS-nP FS-P CnS-nP CnS-P CS-nP CS-P
Fuet Chorizo
Fig. 3. Polyamine contents in fuet and chorizo sausages manufactured through spontaneously and starter mediated fermentation, without and with high
hydrostatic pressure treatment.
M.L. Latorre-Moratalla et al. / Meat Science 75 (2007) 460–469 467
50 70
60
40
TYRAMINE (mg/kg dm)
20 30
20
10
10
0 0
0 7 14 21 0 7 14 21
FnS-nP FnS-P FS-nP FS-P CnS-nP CnS-P CS-nP CS-P
Days Days
15 35
30
12
PUTRESCINE (mg/kg dm)
25
9 20
15
6
10
3
5
0 0
0 7 14 21 0 7 14 21
FnS-nP FnS-P FS-nP FS-P CnS-nP CnS-P CS-nP CS-P
Days Days
15 90
80
CADAVERINE (mg/kg dm)
12 70
60
9
50
40
6
30
3 20
10
0 0
0 7 14 21 0 7 14 21
Days Days
Fig. 4. Changes in tyramine, putrescine and cadaverine contents during the manufacture of fuet (F, left column) and chorizo (C, right column) through
spontaneously (nS) and starter (S) mediated fermentation, without (nP) and with (P) high hydrostatic pressure treatment.
nant bacteria or decarboxylases enzymes. Another differ- lower pH values and higher free amino acid contents dur-
ence between products was the amount of curing agents, ing fermentation. Both factors are known to favour bio-
since fuet contained up to twice the initial nitrate and genic amine production by microorganisms, since
nitrite content in comparison to chorizo, in which 0.05 g/ bacterial decarboxylase enzymes are induced by the pres-
kg nitrate and 0.04 g/kg nitrite were incorporated as con- ence of precursor amino acids at mild acid pH (Bover-
stituents of cayenne pepper and paprika (Garriga et al., Cid & Holzapfel, 1999). Nevertheless, the extremely low
2005). Under these concentrations bacteria are less inhib- levels of biogenic amines in fuet sausages were surprising
ited in chorizo than in fuet. Moreover, chorizo reached in comparison to the variable but higher levels (140 mg/
468 M.L. Latorre-Moratalla et al. / Meat Science 75 (2007) 460–469
kg on average with a relative standard deviation of 73%) selected among decarboxylase-negative strains isolated
usually reported for similar products (Miguélez-Arrizado, from fermented sausages, the probability of success is
Bover-Cid, Latorre-Moratalla, & Vidal-Carou, 2006). In much higher. As reported in a previous work (Bover-Cid,
previous work (Bover-Cid et al., 2006) the aminogenesis Izquierdo-Pulido, & Vidal-Carou, 2000), mixed starter cul-
in spontaneously fermented fuet was much more impor- tures of L. sakei (strain CTC494) with S. xylosus (strain
tant, even when the hygienic quality of raw materials was CTC3037 or CTC3050) were effective in reducing 90% of
optimal in both cases. In this cited work, the temperature the overall aminogenesis in fuet. The results obtained
of fermentation was considerably higher (17 °C) than in proved the suitability of the selected indigenous starters
the present study (12 °C), and this may suggest that, for both types of fermented product (fuet and also
besides the hygiene of raw materials and formulation, tem- chorizo).
perature might be a technologically important parameter
to control the aminogenic activity of spontaneous ferment-
4. Conclusion
ing microorganisms.
Low contents of biogenic amines were also observed in
The high pressure treatment (200 MPa for 10 min at
the other three batches of fuet manufactured, which only
17 °C) applied to meat batter showed a strong inhibitory
allows to confirm that starter cultures prevented produc-
effect on diamine formation, but hardly any influence on
tion of biogenic amines under in situ sausage fermentation
tyramine accumulation. Moreover, high hydrostatic pres-
environment, and HHP treatment did not have any influ-
sure processing before sausage fermentation did not reduce
ence. Therefore, the protective effect of HPP processing
the capability of the inoculated lactobacilli and staphylo-
and indigenous starter culture will be discussed based on
cocci strains to lead the fermentation, which wielded a
the results obtained for chorizo sausages. In spontaneously
strong protective effect against tyramine and diamine pro-
fermented sausages, the application of HPP (batch CnS-P)
ducing microflora. The pressurization of meat batter did
resulted in a strong inhibition of diamine accumulation, the
not interfere with the ripening performance, since no signif-
levels of putrescine and cadaverine being up to 88% and
icant differences were observed in pH, Aw, proteolysis and
98% lower than the non-pressurized batch (CnS-nP). By
in the colour of the sausages. Therefore, it seems challeng-
contrast, tyramine production was almost equal in both
ing and interesting to proceed with further research dealing
batches. It seems that high pressure (at 200 MPa) has a
with such non-thermal technology to improve the hygienic
hygeinizing effect reducing the lysine- and ornithine-decar-
status of raw material.
boxylase activity of contaminant bacteria in agreement
with the also reduced counts of enterobacteria; whereas
tyrosine-decarboxylase positive microorganisms, such as
Acknowledgements
enterococci, are not sensitive to the applied pressure.
Little is known about the effect of HPP treatment of raw
This work was supported by the Spanish Interministerial
materials on the aminogenesis occurring during food fer-
Commission of Science and Technology (CICYT ref.
mentation. Some reports have been published dealing with
ALI99-0308), the National Institute for Food and Agricul-
cheese making. Milk pressurization at 500 MPa for 15 min
tural Research (INIA ref. RTA01-084) and the EU project
at 20 °C was equivalent to heat pasteurization (72 °C for
TRADISAUSAGE (QLK1-CT-2002-02240). Sara Bover-
15 seg), without differences on biogenic amine accumula-
Cid acknowledges the funding support of the Ramon y Ca-
tion (Novella-Rodrı́guez, Veciana-Nogués, Trujillo-Mesa,
jal Program of the Spanish Ministry of Science and
et al., 2002). The application of 400 MPa for 5 min to dried
Technology.
curds after salting in brine, in order to accelerate cheese
ripening, had no significant effect on aminogenesis in com-
parison to untreated samples. However, milder and longer
References
high-pressure treatment (50 MPa for 72 h) yielded almost
3-fold higher tyramine contents (Novella-Rodrı́guez, Veci- AOAC. (1995). Official methods of analysis (16th ed.). Washington, DC:
ana-Nogués, Saldo, & Vidal-Carou, 2002). Association of Official Analytical Chemists.
The inoculation of strains previously selected among Astiasarán, I., Villanueva, R., & Bello, J. (1990). Analysis of proteolysis
indigenous sausage microflora as starter culture was the and protein insolubility during the manufacture of some varieties of
dry sausage. Meat Science, 28, 111–117.
most protecting measure to avoid biogenic amine accumu-
Bover-Cid, S., & Holzapfel, W. (1999). Improved screening procedure for
lation during chorizo manufacture. Indeed, starters were biogenic amine production by lactic acid bacteria. International
not only able to reduce up to 93% putrescine and up to Journal of Food Microbiology, 53, 33–41.
99% cadaverine accumulation, but also about 76% of tyra- Bover-Cid, S., Hugas, M., Izquierdo-Pulido, M., & Vidal-Carou, M. C.
mine. Starter cultures are not always reported as being able (2000). Reduction of biogenic amine formation using a negative amino
acid-decarboxylase starter culture for fermentation of fuet sausages.
to reduce or inhibit the accumulation of all biogenic
Journal of Food Protection, 63, 237–243.
amines, which have been attributed to their low competi- Bover-Cid, S., Izquierdo-Pulido, M., & Vidal-Carou, M. C. (2000). Mixed
tiveness or difficulty to adapt to meat fermentation starter cultures to control biogenic amine production in dry fermented
(Bover-Cid, Hugas, et al., 2000). If starters are accurately sausages. Journal of Food Protection, 63, 1556–1562.
M.L. Latorre-Moratalla et al. / Meat Science 75 (2007) 460–469 469
Bover-Cid, S., Izquierdo-Pulido, M., & Vidal-Carou, M. C. (2001). during the ripening of semi-dry fermented sausages. Meat Science, 62,
Effectiveness of a Lactobacillus sakei starter culture in the reduction of 205–216.
biogenic amines accumulation as a function of the raw material Jung, S., Lamballerie-Anton, M. D., Taylor, R. G., & Ghoul, M. (2000).
quality. Journal of Food Protection, 64, 367–373. High pressure effects on lysosome integrity and lysosomal enzyme
Bover-Cid, S., Miguélez-Arrizado, M. J., Latorre-Moratalla, M. L., & activity in bovine muscle. Journal of Agriculture and Food Chemistry,
Vidal-Carou, M. C. (2006). Freezing of meat raw materials affects 48, 2467–2471.
tyramine and diamine accumulation in spontaneously fermented Lois, A. L., Gutiérrez, L. M., Zumalacárregui, J. M., & López, A. (1987).
sausages. Meat Science, 72, 62–68. Changes in several constituents during the ripening of ‘Chorizo’ – A
Di Maria, S., Basso, A. L., Santoro, E., Grazia, L., & Coppola, R. Spanish dry sausage. Meat Science, 19, 169–177.
(2002). Monitoring of Staphylococcus xylosus DSM 20266 added as Mariné-Font, A., Vidal-Carou, M. C., Izquierdo-Pulido, M., Veciana-
starter during fermentation and ripening of soppressata molisana, a Nogués, M. T., & Hernández-Jover, T. (1995). Les amines biògenes
typical Italian sausage. Journal of Applied Microbiology, 92, dans les aliments: leur signification, leur analyse. Annales des falsifi-
158–164. cations, de l’expertise chimique et toxicologique, 88, 119–140.
Garriga, M., Marcos, B., Martı́n, B., Veciana-Nogués, M. T., Bover-Cid, Miguélez-Arrizado, M. J., Bover-Cid, S., Latorre-Moratalla, M. L., &
S., Hugas, S., et al. (2005). Starter cultures and high pressure Vidal-Carou, M. C. (2006). Biogenic amines in Spanish fermented
processing to improve the hygiene and safety of slightly fermented sausages as a function of diameter and artisanal or industrial origin.
sausages. Journal of Food Protection, 68(11), 2341–2348. Journal of the Science of Food and Agriculture, 86, 549–557.
Halász, A., Báráth, A., Simon-Sarkadi, L., & Holzapfel, W. (1994). Novella-Rodrı́guez, S., Veciana-Nogués, M. T., Saldo, J., & Vidal-Carou,
Biogenic amines and their production by microorganisms in food. M. C. (2002). Effects of high hydrostatic pressure treatments on
Trends in Food Science and Technology, 5, 42–49. biogenic amine contents in goat cheeses during ripening. Journal of
Hernández-Jover, T., Izquierdo-Pulido, M., Veciana-Nogués, M. T., & Agricultural and Food Chemistry, 50, 7288–7292.
Vidal-Carou, M. C. (1996). Ion-pair high performance liquid chro- Novella-Rodrı́guez, S., Veciana-Nogués, M. T., Trujillo-Mesa, A. J., &
matographic determination of biogenic amines in meat and meat Vidal-Carou, M. C. (2002). Profile of biogenic amines in goat cheese
products. Journal of Agricultural and Food Chemistry, 44, 2710–2715. made from pasteurized and pressurized milks. Journal of Food Science,
Homma, N., Ikeuchi, Y., & Suzuki, A. (1994). Effects of high pressure 67, 2940–2944.
treatment on the proteolytic enzymes in meat. Meat Science, 38, Ordóñez, J., Hierro, A., Bruna, J., & de la Hoz, L. (1999). Changes in the
219–228. components of dry-fermented sausages during ripening. Critical
Hugas, M., Garriga, M., & Monfort, J. M. (2002). New mild technologies Reviews in Food Science and Nutrition, 39(4), 329–367.
in meat processing: high pressure as a model technology. Meat Science, Ruı́z-Capillas, C., & Jiménez-Colmenero, F. (2004). Biogenic amine
62(3), 359–371. content in Spanish retail market meat products treated with protective
Hughes, M. C., Kerry, J. P., Arendt, E. K., Kenneally, P. M., McSweeney, atmosphere and high pressure. European Food Research and Technol-
P. L. H., & O’Neill, E. E. (2002). Characterization of proteolysis ogy, 218, 237–241.
RESULTADOS
Artículo VIII.
M.L. Latorre-Moratalla, S.Bover-Cid, R. Talon, M. Garriga, E. Zanardi, A. Ianieri, M.J.
Fraqueza, M. Elias, E.H. Drosinos, M.C. Vidal-Carou. (2010). Strategies to reduce biogenic
amine accumulation in traditional sausage manufacturing. LWT-Food science and
Technology, 43 (1): 20-25.
Índice de impacto (JCR 2008): 1,887
Posición en el área “Food and Science Technology”: 24/107
Artículo IX.
R. Talon, S. Leroy, I.Lebert , P. Giammarinaro, J.P. Chacornac, M.L. Latorre-Moratalla, M.C.
Vidal-Carou , E. Zanardi, M. Conter, A. Lebecque. (2008). Safety improvement and
preservation of typical sensory qualities of traditional dry fermented sausages using
autochthonous starter cultures. International Journal of Food Microbiology, 126: 227-234.
209
ESTRATEGIAS PARA REDUCIR LA ACUMULACIÓN DE AMINAS EN EMBUTIDOS ARTESANALES
El objetivo de esta parte del trabajo, enmarcado dentro del proyecto europeo
Tradisausage, fue evaluar la eficacia de dos tipos de estrategias de control para evitar
la formación de aminas biógenas en productos cárnicos crudos-curados fermentados
elaborados artesanalmente y originarios de diferentes países europeos. Las estrategias
estudiadas consistieron en la modificación de la formulación incrementando las
concentraciones de azúcar y/o la inoculación de cultivos iniciadores artesanales,
específicamente aislados y seleccionados para cada tipo de producto y previamente
caracterizados como aminoácido-descarboxilasa negativos in vitro (Capítulo 7.1)
210
RESULTADOS
9.2.3 Resultados
S1: L. sakei
Chouriço
S2: S. equorum
(Portugal) VIII
Cultivo S3: L. sakei y S. equorum
iniciador
autóctono
(S) S4: S. xylosus CTC6013 y L. sakei CTC6626
Fuet
(España)
S5: S. xylosus CTC6013 y L. sakei CTC494
Aeros thasou
S6: L. sakei y aceite esencial de Satureja thymbra (0,5%)
(Grecia)
Formulación y
Cultivo Saucisson
FS1: Sacarosa (0,50%) y S. succinus, S. equorum y L. sakei IX
iniciador (Francia)
autóctono (FS)
211
ESTRATEGIAS PARA REDUCIR LA ACUMULACIÓN DE AMINAS EN EMBUTIDOS ARTESANALES
a
Se elaboró paralelamente a cada lote con estrategia un lote control.
212
RESULTADOS
213
RESULTADOS
Artículo VIII.
M.L. Latorre-Moratalla, S.Bover-Cid, R. Talon, M. Garriga, E. Zanardi, A. Ianieri, M.J.
Fraqueza, M. Elias, E.H. Drosinos, M.C. Vidal-Carou. (2010). Strategies to reduce
biogenic amine accumulation in traditional sausage manufacturing. LWT-Food
science and Technology, 43 (1): 20-25.
Índice de impacto (JCR 2008): 1,887
Posición en el área “Food and Science Technology”: 24/107
215
LWT - Food Science and Technology 43 (2010) 20–25
a r t i c l e i n f o a b s t r a c t
Article history: Different strategies in the reduction of biogenic amine accumulation during the manufacture of five
Received 21 January 2009 European traditional fermented sausages were studied concerning sausage formulation, the increase of
Received in revised form sugar in the Italian salame abruzzese reduced the accumulation of cadaverine up to 43%. However, the
22 June 2009
addition of sugar in the French saucisson did not show a significant amine reduction. The inoculation of
Accepted 23 June 2009
a decarboxylase-negative autochthonous starter culture reduced the biogenic amine accumulation in
a different manner depending on the species and strain(s). The highest reduction was achieved by
Keywords:
Lactobacillus sakei used in the Greek aeros thasou, resulting in a total putrescine reduction and a signif-
Traditional fermented sausage
Biogenic amines icant decrease in tyramine (62%) and histamine (71%). In Portuguese chouriços cadaverine reduction was
Autochthonous starter culture only of 45% when a single strain of Staphylococcus equorum was inoculated, whereas a single strain of L.
Sugar sakei or a mixture of S. equorum yielded a 75% and 89% of reduction, respectively. In Spanish fuet,
a combination of L. sakei CTC6626 plus S. xylosus CTC6013 had only a very slight effect on tyramine
reduction (19%) in Spanish fuet, whereas L. sakei CTC494 plus S. xylosus CTC6013 was capable to reduce
tyraminogenesis by nearly 50%, suggesting that L. sakei CTC494 was the strain responsible for the
additional tyramine reduction.
Ó 2009 Elsevier Ltd. All rights reserved.
1. Introduction found and their levels reported in the literature vary in a wide range
(Latorre-Moratalla et al., 2008; Suzzi & Gardini, 2003). In general,
Traditionally, interest in the study of biogenic amines such as tyramine along with putrescine, cadaverine and histamine are the
tyramine and histamine in foods has been linked to their potential most important amines detected in fermented sausages of both
risk for human health due to their vasoactive properties. Although industrial and artisan origin (Miguélez-Arrizado, Bover-Cid,
biogenic amines have been studied for more than 30 years as Latorre-Moratalla, & Vidal-Carou, 2006; Montel, Masson, & Talon,
hygiene indicator in meat, nowadays the interest of the study of 1999; Parente et al., 2001). These compounds are formed by the
mainly histamine, tyramine, cadaverine and putrescine is more decarboxylation of the precursor amino acid by specific enzymes of
relevant since food safety requirements are higher. Fermented microbial origin under suitable conditions. The manufacturing of
foods, and particularly fermented meat products, constitute one of fermented sausage allows the availability of the precursor free
the foods in which considerable amounts of biogenic amines can be amino acids resulting from proteolytic phenomena and the growth
of a variety of micro-organisms which can show aminogenic ability
(Vidal-Carou, Veciana-Nogués, Latorre-Moratalla, & Bover-Cid,
* Corresponding author. Fax: þ34 93 403 59 31.
E-mail address: [email protected] (M.C. Vidal-Carou).
2007).
1
Present address: Institute for Food and Agricultural Research and Technology In the current context in which food safety and food quality are
(IRTA), Finca Camps i Armet, E-17121 Monells, Spain. important concerns, technological and scientific efforts are being
0023-6438/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved.
doi:10.1016/j.lwt.2009.06.018
M.L. Latorre-Moratalla et al. / LWT - Food Science and Technology 43 (2010) 20–25 21
focused on minimizing the risks associated with potentially 2. Materials and methods
unhealthy food components as well as those related to poor
hygienic practices. In this way, the development of appropriate 2.1. Samples
manufacturing technologies to obtain sausages free or nearly free
from biogenic amines is one of the current targets of the meat All products were manufactured from pork meat. Other ingre-
sector, including the traditional manufacturers. The importance of dients such as sugar, curing salts and spices, and the manufacturing
using measures focused on the hygienic quality of both raw conditions, varied depending on the product and the processing
material and processing units to avoid the development of ami- unit. Table 1 summarizes the specific technological characteristics
nogenic contaminant bacteria and in turn, to reduce biogenic amine and the particular strategy applied by each project partner involved
content, is well known. However, proper hygiene may not be in the study. Different amounts of sugar were incorporated into
enough to avoid some biogenic amine formation and other tech- Italian salame abruzzese and French saucisson. Different autoch-
nological measures must be applied in relation to sausage formu- thonous starter cultures were used in Portuguese chouriços,
lation, ripening conditions and starter culture (Leroy & Vuyst, 2004; Spanish fuet and Greek aeros thasou. The strategies applied were
Vidal-Carou et al., 2007). Lactic acid bacteria, responsible for the chosen depending on the specific requirements and particular
acidification process, and staphylococci, related to proteolysis, color characteristics of each product or manufacturer. A control sausage
formation and aroma development, are the micro-organisms was manufactured in parallel without the application of the
commonly selected for use as starter cultures in fermented sausage. strategy (i.e. original formulation or spontaneous fermentation).
However, some species are more appropriate than others, and the Indigenous bacteria to be used as a starter culture were previously
selection should be performed to strain level (Bover-Cid & Hol- isolated from traditional sausages by each partner, and all strains
zapfel, 1999), when the negative amino acid decarboxylase ability is were proven to lack decarboxylase activity (Bover-Cid, Hugas,
concerned. Izquierdo-Pulido, & Vidal-Carou, 2001; Garriga et al., 2005). For
Traditional fermented sausages are characterized by handmade each strategy, three sausages were sampled (minced and homog-
manufacturing usually in small-scale units, following spontaneous enized to obtain the analytical samples) at three points during the
fermentation by their particular in-house flora (Talon et al., 2007). manufacturing process, point zero (Z): meat batter just stuffed,
These products suffer slight acidification and have sensorial middle point (M): after fermentation (at the end of bacterial
properties nowadays very appreciated by the consumers. Available exponential growth) and final point (F): product after ripening,
data show that these products are as susceptible to accumulation ready for consumption. The 14 samples studied, 9 strategies and 5
of biogenic amines as industrial products (Montel et al., 1999; controls (one for each type of product), were analyzed by triplicate.
Parente et al., 2001). There is therefore interest in exploiting Approximately 100 g of sample was wrapped in aluminum foil,
technological measures to reduce aminogenesis during the packed under vacuum, frozen at ÿ20 C and sent in dry ice to the
manufacture of traditional fermented sausages, such as the use of laboratory, where samples were kept at ÿ20 C until analysis.
an autochthonous starter culture (Benito et al., 2007; Villani et al.,
2007) originating from meat, which lacks amino acid decarbox- 2.2. Analytical methods
ylase activity and is well adapted to the ecology of traditional meat
fermentation. pH was measured using a micro computerized pH meter Crison
The European project ‘‘Tradisausage’’ (QLK1 CT-2002-02240) 2001 (Crison Barcelona, Spain), inserting the electrode directly in
aimed to improve the quality and safety of traditional fermented the sausages. Water activity (aw) values were obtained at 25 C with
sausages. As part of this project a first exploratory study of AqualabÒ equipment (Decagon Devices Inc., Pullman, Washington).
biogenic amine accumulation during the manufacture of different Moisture was determined by drying the sample at 100–105 C to
European, traditionally fermented sausages, was performed constant weight (AOAC, 2005).
(Latorre-Moratalla et al., 2008). Afterwards, several processing Tyramine, histamine, putrescine and cadaverine were detected
units were selected to study the suitability of specific measures to and quantified by ion-pair reverse-phase high performance liquid
reduce biogenic amine formation, and thus contribute to chromatography as described in Hernández-Jover, Izquierdo-
improving the global quality of these products. This paper pres- Pulido, Veciana-Nogués, and Vidal-Carou (1996). This method is
ents the results of the application of technological strategies based on the formation of ion-pairs between biogenic amines,
relating to sausage formulation or the addition of an autochtho- previously extracted with 0.6 mol/L perchloric acid (Panreac) from
nous starter culture. 5 to 10 g of sample without casings. The results are referred to dry
Table 1
Strategies applied by each country participating in the Tradisausage Project.
Indigenous starter culture (S) S1: L. sakei Chouriço (Portugal) Fermentation / Resting: 48 h at 1.5 C/80% RH
S2: S. equorum Ripening/smoking: 8 days at 20 C/70% RH
S3: L. sakei & S. equorum
S4: S. xylosus CTC6013 & L. sakei CTC6626 Fuet (Spain) Fermentation: 2 days at 12 C/85% RH
S5: S. xylosus CTC6013 & L. sakei CTC494 Ripening: 28 days at 10 C/75% RH
S6: L. sakei & Satureja essential oil (5 g/kg) Aeros thasou (Greece) Fermentation: 7 days from 23–24 C/92–94% RH to 17–18 C/80–82% RH
Ripening: 21 days at 15 C/76–80% RH
a
A control sample was manufactured and monitored in parallel for comparison.
22 M.L. Latorre-Moratalla et al. / LWT - Food Science and Technology 43 (2010) 20–25
F1 F2 F3
150 7.0 150 7.0 375 7.0
mg/kg dm
mg/kg dm
90 6.2 90 6.2 225 6.2
pH
pH
pH
60 5.8 60 5.8 150 5.8
Fig. 1. Contents of tyramine (diamonds), putrescine (squares), cadaverine (triangles) and histamine (circles) and pH values (crosses) in samples just stuffed (Z), intermediate
product after fermentation (M) and final product after ripening (F) using a modified strategy (dd) in comparison with the corresponding control (- - -). F1: Dextrose (1.9 g/kg) &
saccharose (1.9 g/kg); F2: dextrose (3 g/kg) & saccharose (2 g/kg) and F3: saccharose (5 g/kg).
matter (dm) to make comparable the biogenic amine values among 3.1. Physicochemical parameters
products with different moisture during the drying process.
The physicochemical parameters determined were aw and pH,
both of which are important for monitoring the sausages during
2.3. Statistical analysis
maturation/ripening.
aw decreased throughout the manufacturing process in all
Analysis of the variance (ANOVA), Post-hoc contrast (HSD
products and there were no differences between control and
Tukey) and t-tests were performed using the software package SPSS
modified samples, values reaching between 0.87 and 0.92 in the
v.11.0 for Windows (SPSS Inc., Chicago, IL, USA).
final products.
The pH values of products with the addition of sugar did not
3. Results suffer the typical pH decrease (Fig. 1), achieving values higher than
those of the starter cultures. In the Italian sausages, the pH values
Biogenic amine accumulation was monitored throughout the were from 6 to 6.3 in the control, 6.6 in F1 and 6.8 in F2. French
manufacture of traditional fermented sausages in which specific products showed an initial pH of 5.6 and final pH of 6.8 in the two
improving measures were applied: modification of sausage cases. In the case of products inoculated with autochthonous
formulation (change of sugar type and/or quantity), and the inoc- starter culture decreased an average of 0.6 units during the
ulation of selected autochthonous starter cultures. The strategy fermentation step and in some products even throughout the
applied, was compared with a control sample manufactured ripening process (0.2 units). The values ranged from 5.4 to 6.3 in
following the original formulation and processing conditions raw materials, from 4.7 to 5.7 after fermentation and from 4.6 to 5.7
usually applied by the manufacturer. in the final product depending on the origin of the product (Fig. 2).
S1 S2 S3
375 7.0 375 7.0 375 7.0
mg/kg dm
mg/kg dm
pH
pH
S4 S5 S6
200 7.0 200 7.0 100 6.0
mg/kg dm
mg/kg dm
pH
pH
Fig. 2. Contents of tyramine (diamonds), putrescine (squares), cadaverine (triangles) and histamine (circles) and pH values (crosses) in samples just stuffed (Z), intermediate
product after fermentation (M) and final product after ripening (F) using a modified strategy (dd) in comparison with the corresponding control (- - -). S1: L. sakei; S2: S. equorum;
S3: L. sakei & S. equorum; S4: L. sakei CTC6626 & S. xylosus CTC6013; S5: L. sakei CTC494 & S. xylosus CTC6013; S6: L. sakei & Satureja thymbra essential oil (5 g/kg).
M.L. Latorre-Moratalla et al. / LWT - Food Science and Technology 43 (2010) 20–25 23
3.2. Formulation changes single strain of S. equorum (S2) failed to reduce significantly the
accumulation of these two biogenic amines.
The modification of the formulation applied in the Italian salame The strategy applied for the production of Spanish fuet involved
abruzzese consisted of the addition of an increased amount of sugar two different combinations of starter bacteria. One consisted of
(glucose and saccharose), 3.8 g/kg (F1) and 5 g/kg (F2), compared L. sakei CTC6626 plus Staphylococcus xylosus CTC6013 (S4), and the
with the control manufactured with 2.6 g/kg of sugar as originally. other used L. sakei CTC494 plus S. xylosus CTC6013 (S5). Tyramine
Results are shown in Fig. 1. Biogenic amines found in the final was the only amine present at considerable levels (174 mg/kg dm)
product of the control were cadaverine (126 mg/kg dm) followed in the control fuet. The level of putrescine was low (15 mg/kg dm)
by tyramine (78 mg/kg dm). Putrescine and histamine were below while cadaverine and histamine were not detected throughout the
the detection limit (<0.5 mg/kg) throughout manufacturing manufacturing process. The inoculation of starter cultures was able
process. The increase in sugar (F1 and F2) significantly reduced to reduce tyramine accumulation to a significantly different
(p < 0.05) the final content of cadaverine but not of tyramine (p < 0.05) extent depending on the L. sakei strain used. Thus, the
(p > 0.05). In fact, the higher the sugar amount the earlier the addition of the strain L. sakei CTC494 (S5) resulted in products with
tyramine accumulation occurred. less than 100 mg/kg of tyramine whereas the use of L. sakei
Strategy F3 corresponded to the French saucisson and was CTC6626 (S4) resulted in almost 150 mg/kg.
manufactured with 5 g/kg of saccharose. In the control product The strategy used to manufacture the Greek aeros thasou (S6)
(manufactured without sugar), cadaverine was the most abundant consisted of the inoculation of a single decarboxylase-negative
amine, achieving final values of 313 mg/kg dm. Although in lower starter culture strain of L. sakei complemented with 5 g/kg of Sat-
amounts, tyramine (59 mg/kg dm), putrescine (26 mg/kg dm) and ureja thymbra essential oil, which acts as a natural antimicrobial
histamine (6 mg/kg dm) were also found, though they appeared agent. The L. sakei strain was used as an autochthonous starter
after the fermentation step. In contrast to the Italian salame culture instead of the commercial starter culture (containing L.
abruzzese, in French products the addition of saccharose did not sakei, Staphylococcus carnosus and S. xylosus) that is usually
result in a decrease of biogenic amine formation. Slightly but employed by the Greek manufacturer studied. Tyramine was the
significantly higher levels of cadaverine, tyramine and histamine main amine present in the final product of the control (82 mg/kg
were observed in the ripened products with added saccharose in dm). Histamine and putrescine were also found but at very low
comparison with the control. levels (37 and 21 mg/kg dm, respectively). Following application of
the modified strategy, tyramine and histamine were significantly
(p < 0.05) reduced, and the production of putrescine was inhibited
3.3. Addition of autochthonous starter cultures to undetectable levels.
Table 2
Summary of the effectiveness of the strategies expressed as % reduction of biogenic amine accumulation in comparison with the control. The symbol asterisk ‘‘*’’ indicates
statistical significance (p < 0.05).
TY PU CA HI
Formulation F1: glucose (1.9 g/kg) & saccharose (1.9 g/kg) nr – 49* –
F2: glucose (3 g/kg) & saccharose (2 g/kg) nr – 21* –
F3: saccharose (5 g/kg) nr 21 nr nr
cadaverine, by 43% and 21% respectively. Consequently, a moderate composed of Staphylococcus succinus, S. equorum and L. sakei,
increase in sugar (F1) achieved the best result, while further compared with spontaneous fermentation. This study, carried out
increase in sugar was less effective (F2) or totally failed (F3) to in a real processing unit, proved that the use of an autochthonous
reduce cadaverine levels. Tyramine formation could not be reduced starter can successfully replace the spontaneous fermented
in any case irrespectively the amount and type of sugar added. The bacteria responsible for tyramine formation, and partially inhibits
existing results in this subject are controversial. It has been sug- the growth of spoilage flora related to histamine and cadaverine
gested that the addition of certain concentrations of sugars to formation. However, other studies suggested that the use of
sausage formulations can promote the development of lactic acid certain starter cultures does not guarantee the prevention of the
bacteria, resulting in a rapid and sharp acidification, which has aminogenesis (Bozkurt & Erkmen, 2002; Komprda et al., 2004).
been reported as a key factor limiting the growth of contaminant For instance, Parente et al. (2001) concluded that the commercial
bacteria with potential decarboxylase activity (Bover-Cid, starter cultures (Pediococcus pentosaceus plus S. xylosus, and L.
Izquierdo-Pulido, & Vidal-Carou, 2001a; Maijala, Eerola, Lievonen, sakei plus S. xylosus) did not prevent the production of biogenic
Hill, & Hirvi, 1995). González-Fernández, Santos, Jaime, and Rovira amines, irrespective of the type of products (salsiccia and sop-
(2003) studied the effect of different concentrations of different pressata), showing similar or often higher levels than the same
types and combinations of sugar (glucose, lactose and sucrose) on products manufactured by traditional practices without starter.
the formation of biogenic amine in chorizo sausages and concluded The results obtained for the Spanish fuet (S4 and S5) indicate
that concentrations of sugar higher than 5 g/kg would reduce that it is not only the species but also the strain used that is
biogenic amine formation, probably due to the more rapid pH important for biogenic amine reduction. The starter culture used in
decrease. However, in the present work this higher drop in pH was S4 (L. sakei CTC6626 plus S. xylosus CTC6013) had only a very slight
not observed in samples supplemented with additional amounts of effect on tyramine reduction (19%), whereas the starter inoculated
sugar. On the other hand, the high amount of sugar used in F3 in S5 (L. sakei CTC494 plus S. xylosus CTC6013) was able to reduce
seemed to presumably promote the growth and/or activity of tyraminogenesis by nearly 50%, even when it was produced by the
aminogenic micro-organisms, which could explain the slight but same manufacturer with the same raw material, ingredients and
significantly higher increase in the different biogenic amines. This technological conditions. The strains used in this study had previ-
was also observed in Bover-Cid et al. (2001a), who demonstrated ously been shown to perform successfully as starter cultures in dry
that the lack of sugar in the formulation of fuet sausage generated fermented sausages, showing a proper competitiveness and
an increase in tyramine and cadaverine levels in comparison with implantation in the product (Garriga et al., 2005; Hugas, Garriga,
sausages formulated with glucose (4 g/kg) or glucose (1 g/kg) plus Aymerich, & Monfort, 1995). Moreover, Bover-Cid, Izquierdo-Pulido,
lactose (20 g/kg). Formerly, the study carried out by Vandekerck- and Vidal-Carou (2000) obtained a reduction of 90% of the total
hove (1977) in dry sausages manufactured in a pilot plant with the amine content using the L. sakei CTC494 strain as a starter culture in
addition of different sugar types (glucose, dextrins, lactose or fuet sausages manufactured following industrial practices in an
maltose) revealed that they did not have any effect on biogenic experimental pilot plant. Later, a practically total reduction of
amine production. Therefore, the effect of sausage formulation on putrescine and cadaverine and 76% reduction of tyramine were
biogenic amine reduction may depend on the technological factors reported by the use of the L. sakei CTC6626 and S. xylosus CTC6013
used for sausage manufacture. combination, among other strains, in the manufacture of traditional
Concerning the strategies related to the addition of a decar- sausages, including fuet and chorizo, in an experimental pilot plant
boxylase-negative autochthonous starter culture, biogenic amines (Garriga et al., 2005; Latorre-Moratalla et al., 2007). The different
were reduced in a different manner depending on the strain used degree of biogenic amine reduction achieved in the Spanish fuet (S4
(Table 2). Whenever L. sakei was inoculated there was a reduction and S5) manufactured in a real traditional processing plant in
of all biogenic amines, from 17 to 100% depending on the strain comparison with the above cited studies using other combinations
and the amine considered. The highest biogenic amine reduction of the same strains, may be due to the different technological
was achieved by the strain of L. sakei used in the Greek aeros conditions applied (industrial or traditional practices), the different
thasou in combination with the essential oil (S6), resulting in type of product (fuet or chorizo sausages) and/or even processing
total putrescine reduction and a significant decrease in tyramine places (experimental or industrial processing plant versus real
(62%) and histamine (71%). On the other hand, when a single traditional processing plant).
strain of S. equorum (S2) was inoculated, the cadaverine reduction The high levels of cadaverine in these spontaneously fermented
was only 45%, being not able to reduce the tyramine and Portuguese chouriços are probably due to the higher counts of
putrescine contents. The use of a mixed starter culture including Enterobacteriaceae in products manufactured in this processing
lactobacilli and staphylococci was also quite successful, particu- unit (Latorre-Moratalla et al., 2008). Enterobacteriaceae are the
larly in the case of cadaverine, for which the highest reduction main factor responsible for cadaverine formation (Bover-Cid et al.,
(89%) was obtained in S3, inoculated with L. sakei and S. equorum 2001; Durlu-Özkaya, Ayhan, & Vural, 2001), so this could be
strains. There are several studies supporting the usefulness of considered as a good indicator to evaluate hygiene conditions for
decarboxylase-negative single or mixed starter cultures for raw materials and/or the manufacturing process. On the other
reducing aminogenesis during fermentation of dry sausage (Suzzi, hand, the addition of Satureja thymbra essential oil (with a strain of
& Gardini, 2003; Vidal-Carou et al., 2007), although to different L. sakei as a starter) in S6 could influence amine reduction, since it
extents depending on the amine. For instance, González-Fernán- could act as an antimicrobial agent inhibiting the growth or activity
dez et al. (2003) concluded that the use of a competitive starter of the decarboxylase-positive spoilage bacteria. The effectiveness of
culture prevents the growth of micro-organisms responsible for a starter culture seems to be strongly linked to the microbial quality
biogenic amine formation in sausages manufactured under of the raw material, as reported Bover-Cid, Izquierdo-Pulido, and
simulated industrial conditions. However, there are scarce studies Vidal-Carou (2001b) who showed that the reduction in biogenic
about the effect of autochthonous starter cultures on biogenic amine accumulation by L. sakei strain CTC494 was not the same
amine accumulation. Talon et al. (2008) observed an 87% reduc- when different hygienic quality of raw material was used to sausage
tion in tyramine, a 38% reduction in histamine and a 35% manufacturing.
reduction in cadaverine during the manufacture of traditional In conclusion, it could be highlighted that the type and
fermented sausages using an autochthonous starter culture concentration of sugar (as a fermentation substrate) were only
M.L. Latorre-Moratalla et al. / LWT - Food Science and Technology 43 (2010) 20–25 25
useful for reducing cadaverine, which is the main biogenic amine González-Fernández, C., Santos, E. M., Jaime, I., & Rovira, J. (2003). Influence of
starter cultures and sugar concentrations on biogenic amine contents in chorizo
produced by spoilage bacteria. The use of the autochthonous
dry sausage. Food Microbiology, 20, 275–284.
starters was the most effective strategy for reducing biogenic amine Hernández-Jover, T., Izquierdo-Pulido, M., Veciana-Nogués, M. T., & Vidal-
content in fermented sausage. Moreover, the results confirm the Carou, M. C. (1996). Ion-pair high-performance liquid chromatographic deter-
important role of the product, technological conditions and the mination of biogenic amines in meat and meat products. Journal of Agricultural
and Food Chemistry, 44(9), 2710–2715.
manufacturing plant in the efficiency of the starter. Consequently it Hugas, M., Garriga, M., Aymerich, M. T., & Monfort, J. M. (1995). Inhibition of Listeria
has to be borne in mind that it is not only the inoculation of the in dry fermented sausages by the bacteriocinogenic Lactobacillus sake CTC494.
starter and the modification of formulation, but also optimal Journal of Applied Bacteriology, 79, 322–330.
Komprda, T., Smela, D., Pechova, P., Kalhotka, L., Stencl, J., & Klejdus, B. (2004). Effect
hygienic conditions of raw materials and processing conditions, of starter culture, spice mix and storage time and temperature on biogenic
contribute to favor the starter performance and to reduce the amine content of dry fermented sausages. Meat Science, 67, 607–616.
aminogenesis during traditional fermented sausages manufacture. Latorre-Moratalla, M. L., Bover-Cid, S., Aymerich, T., Marcos, B., Vidal-Carou, M. C., &
Garriga, M. (2007). Aminogenesis control in fermented sausages manufactured
with pressurized meat batter and starter culture. Meat Science, 75(3), 460–469.
Acknowledgement Latorre-Moratalla, M. L., Veciana-Nogués, T., Bover-Cid, S., Garriga, M., Aymerich, T.,
Zanardi, E., et al. (2008). Biogenic amines in traditional fermented sausages
produced in selected European countries. Food Chemistry, 107, 912–921.
This study received financial support from the European project: Leroy, F., & Vuyst, L. (2004). Lactic acid bacteria as functional starter cultures for the
Assessment and improvement of safety of traditional dry sausages food fermentation industry. Trends in Food Science & Technology, 15(2), 67–78.
from producers to consumers (QLK1 CT-2002-02240). Maijala, R., Eerola, S., Lievonen, S., Hill, P., & Hirvi, T. (1995). Formation of biogenic
amines during ripening of dry sausages as affected by starter culture and
thawing time of raw materials. Journal of Food Science, 60, 1187–1190.
References Miguélez-Arrizado, M. J., Bover-Cid, S., Latorre-Moratalla, M. L., & Vidal-Carou, M. C.
(2006). Biogenic amines in Spanish fermented sausages as a function of
AOAC. (2005). Official methods of analysis (19th ed.). Washington, DC, USA: Asso- diameter and artisanal or industrial origin. Journal of the Science of Food and
ciation of Official Analytical Chemists. Agriculture, 86, 549–557.
Benito, M. J., Martı́n, A., Aranda, E., Pérez-Nevado, F., Ruiz-Moyano, S., & Córdoba, M. Montel, M. C., Masson, F., & Talon, R. (1999). Comparison of biogenic amine content in
(2007). Characterization and selection of autochthonous lactic acid bacteria traditional and industrial French dry sausages. Sciences des Aliments, 19, 247–254.
isolated from traditional Iberian dry-fermented salchichón and chorizo Parente, E., Martuscelli, M., Gardini, F., Grieco, S., Crudele, M. A., & Suzzi, G. (2001).
sausages. Journal of Food Science, 72(6), 193–201. Evolution of microbial populations and biogenic amine production in dry
Bover-Cid, S., & Holzapfel, W. H. (1999). Improved screening procedure for biogenic sausages produced in southern Italy. Journal of Applied Microbiology, 90,
amine production by lactic acid bacteria. International Journal of Food Microbi- 882–891.
ology, 53(1), 33–41. Ruiz-Capillas, C., & Jiménez-Colmenero, F. (2004). Biogenic amines in meat and
Bover-Cid, S., Hugas, M., Izquierdo-Pulido, M., & Vidal-Carou, M. C. (2001). Amino meat products. Critical Reviews in Food Science and Nutrition, 44, 489–499.
acid-decarboxylase activity of bacteria isolated from fermented pork sausage. Suzzi, G., & Gardini, F. (2003). Biogenic amines in dry fermented sausages: a review.
International Journal of Food Microbiology, 66, 185–189. International Journal of Food Microbiology, 88, 41–54.
Bover-Cid, S., Izquierdo-Pulido, M., & Vidal-Carou, M. (2000). Mixed starter cultures Talon, R., Lebert, I., Lebert, A., Leroy, S., Garriga, M., Aymerich, T., et al. (2007).
to control biogenic amine production in dry fermented sausages. Journal Food Traditional dry fermented sausages produced in small-scale processing units in
Protection, 63, 1556–1562. Mediterranean countries and Slovakia. 1. Microbial ecosystems of processing
Bover-Cid, S., Izquierdo-Pulido, M., & Vidal-Carou, M. C. (2001a). Changes in environments. Meat Science, 77, 570–579.
biogenic amine and polyamine contents in slightly fermented sausages man- Talon, R., Leroy, S., Lebert, I., Giammarinaro, P., Chacornac, J. P., Latorre-
ufactured with and without sugar. Meat Science, 57, 215–221. Moratalla, M. L., et al. (2008). Safety improvement of typical sensory qualities of
Bover-Cid, S., Izquierdo-Pulido, M., & Vidal-Carou, M. C. (2001b). Effectiveness of traditional dry fermented sausages using autochthonous starter cultures.
a Lactobacillus sakei starter culture in the reduction of biogenic amine International Journal of Food Microbiology, 126, 227–234.
accumulation as a function of the raw material. Journal Food Protection, 64(3), Vandekerckhove, P. (1977). Amines in dry fermented sausage. Journal of Food
367–373. Science, 42, 283–285.
Bozkurt, H., & Erkmen, O. (2002). Effects of starter cultures and additives on the Vidal-Carou, M. C., Veciana-Nogués, T., Latorre-Moratalla, M. L., & Bover-Cid, S.
quality of Turkish style sausage (sucuk). Meat Science, 61(2), 149–156. (2007). Biogenic amines: risks and control. Handbook of fermented meat and
Durlu-Özkaya, F., Ayhan, K., & Vural, N. (2001). Biogenic amines produced by poultry. Blackwell Publishing.
Enterobacteriaceae isolated from meat products. Meat Science, 58, 163–166. Villani, F., Casaburi, A., Pennacchia, C., Filosa, L., Russo, F., & Ercolini, D. (2007).
Garriga, M., Marcos, B., Martı́n, B., Veciana-Nogués, M., Bover-Cid, S., Hugas, M., et Microbial ecology of the soppressata of Vallo di Diano, a traditional dry fer-
al. (2005). Starter cultures and high-pressure processing to improve the hygiene mented sausage from southern Italy, and in vitro and in situ selection of
and safety of slightly fermented sausages. Journal of Food Protection, 68, autochthonous starter cultures. Applied and Environmental Microbiology, 73(17),
2341–2348. 5453–5463.
RESULTADOS
Artículo IX.
R. Talon, S. Leroy, I.Lebert , P. Giammarinaro, J.P. Chacornac, M.L. Latorre-Moratalla,
M.C. Vidal-Carou , E. Zanardi, M. Conter, A. Lebecque. (2008). Safety improvement and
preservation of typical sensory qualities of traditional dry fermented sausages using
autochthonous starter cultures. International Journal of Food Microbiology, 126: 227-
234.
Índice de impacto (JCR 2008): 2.753
Posición en el área “Food and Science Technology”: 8/107
223
International Journal of Food Microbiology 126 (2008) 227–234
A R T I C L E I N F O A B S T R A C T
Article history: Traditional dry fermented sausages are manufactured without addition of starter cultures in small-scale
Received 24 April 2008 processing units, their fermentation relying on indigenous microflora. Characterisation and control of these
Received in revised form 23 May 2008 specific bacteria are essential for the sensory quality and the safety of the sausages. The aim of this study was
Accepted 23 May 2008
to develop an autochthonous starter culture that improves safety while preserving the typical sensory
characteristics of traditional sausages.
Keywords:
Sausages
An autochthonous starter composed of Lactobacillus sakei, Staphylococcus equorum and Staphylococcus succinus
Autochthonous starter isolated from a traditional fermented sausage was developed. These strains were tested for their susceptibility
Monitoring to antibiotics and their production of biogenic amines. This starter was evaluated in situ at the French
Safety traditional processing unit where the strains had been isolated. Effects of the autochthonous starter were
Sensory quality assessed by analysing the microbial, physico-chemical, biochemical and sensory characteristics of the sausages.
PCR species-specific Inoculation with the chosen species was confirmed using known species-specific PCR assays for L. sakei and
S. equorum and a species-specific PCR assay developed in this study for S. succinus. Strains were monitored by
pulse-field gel electrophoresis typing. Addition of autochthonous microbial starter cultures improved safety
compared with the traditional natural fermentation of sausages, by inhibiting the pathogen Listeria
monocytogenes, decreasing the level of biogenic amines and by limiting fatty acid and cholesterol oxidation.
Moreover, autochthonous starter did not affect the typical sensory quality of the traditional sausages.
This is the first time to our knowledge that selection, development and validation in situ of autochthonous
starter cultures have been carried out, and also the first time that S. equorum together with S. succinus have
been used as starter cultures for meat fermentation. Use of autochthonous starter cultures is an effective tool
for limiting the formation of unsafe compounds in traditional sausage while preserving their original and
specific sensory quality.
© 2008 Elsevier B.V. All rights reserved.
0168-1605/$ – see front matter © 2008 Elsevier B.V. All rights reserved.
doi:10.1016/j.ijfoodmicro.2008.05.031
228 R. Talon et al. / International Journal of Food Microbiology 126 (2008) 227–234
Morot-Bizot et al., 2004; Giammarinaro et al., 2005; Rantsiou and mixture of the strains L. sakei F08F202, S. equorum F08bF15 and
Cocolin, 2006; Urso et al., 2006). By using these methods, the LAB S. succinus F08bF19 at 106 bacteria/g of each strain were added. The
species the most commonly identified in traditional fermented strains were grown overnight at 30 °C in MRS broth for Lactobacillus
sausages are Lactobacillus sakei, Lactobacillus curvatus and Lactobacil- and in brain heart infusion (BHI, Merck) broth for Staphylococcus.
lus plantarum (Aymerich et al., 2006; Urso et al., 2006). Among GCC+ Subsequently the cells were washed twice and suspended in saline
isolates, Staphylococcus xylosus, Staphylococcus equorum, Staphylococ- water. Then 200 ml of the starter cultures in saline water was used to
cus succinus and Staphylococcus saprophyticus are mentioned, often inoculate 20 kg of batter. In batch 1, 200 ml of saline water was added to
with S. xylosus predominant (Mauriello et al., 2004; Corbière Morot- 20 kg of batter.
Bizot et al., 2006; Drosinos et al., 2007). Ripening was performed as follows: 48 h of fermentation at 20 °C
The identification of technological bacteria is necessary to select with a relative humidity (RH) of 90% and 52 days of drying with 80%
strains to be employed as an autochthonous starter culture (Villani RH at 12 °C.
et al., 2007). The main challenge in developing starter cultures is, of
course, to improve safety, but also to preserve the typical sensory 2.3. Sampling procedure
quality of traditional sausages. The development of starter culture
based on indigenous technological bacteria of traditional sausages can For each batch, three meat samples were examined: the stuffed
be an alternative, as these strains should be well adapted to the batter (labelled Z), the product after fermentation (M) and the final
environment, and compete well against contaminant strains. product (F). For each sampling step, three sausages were taken.
The aim of this study was to develop an autochthonous starter
culture that improves safety while preserving the typical sensory 2.4. Microbiological analysis
characteristic of traditional sausage. An autochthonous starter com-
posed of three strains belonging to L. sakei, S. equorum and S. succinus 25 g of each sample was transferred to 225 ml of sterile buffered
was tested in situ in a French traditional processing unit where these peptone water (BPW) solution and homogenised for 4 min with a
dominant strains were previously isolated. The role of the autochtho- Stomacher. Decimal dilutions in BPW solution were prepared.
nous starter culture was assessed by microbial, physico-chemical, Duplicate 1 ml or 0.1 ml samples of appropriate dilutions were
biochemical and sensory analyses of the final product. The monitoring poured or spread on the selective media to enumerate the bacteria
of the three species was confirmed by species-specific PCR assays and according to the methods described by Lebert et al. (2007a).
pulse-field gel electrophoresis typing.
2.5. Molecular methods of monitoring starter strains
2. Materials and methods
Twenty-four to 30 colonies were randomly selected on MRS
2.1. Characteristics of the strains (Merck) plates to monitor L. sakei and on mannitol salt agar (MSA,
Merck) plates to monitor S. equorum and S. succinus. Colonies were
The L. sakei F08F202, S. equorum F08bF15 and S. succinus F08bF19 isolated from each step of manufacturing (Z, M, F) for both batches.
strains were all isolated from the traditional dry fermented sausages Colonies were grown on MRS agar for L. sakei and on BHI agar (Merck)
manufactured by the small French processing unit F08 (Lebert et al., for staphylococci. The isolates were stored at −80 °C in 20% glycerol
2007a). In these sausages, these three strains belonged to the before molecular analysis.
dominant bacteria. Identification at species level was done by species-specific PCR for
Antibiotic susceptibility of these three strains was tested by the L. sakei (Berthier and Ehrlich, 1998) and for S. equorum (Blaiotta et al.,
agar disc diffusion method on Muller Hinton media (Merck) for Sta- 2004) as described. A part of a colony was used as DNA template.
phylococcus and on Man–Rogosa–Sharp agar (MRS, Merck) for Lacto- Concerning S. succinus, we have developed a species-specific PCR
bacillus. The following antibiotics were tested: penicillin (6 µg), targeting sodA gene (AY845222). A sodA fragment of 163 bp was
tetracycline (30 µg), erythromycin (15 µg), kanamycin (30 µg), amplified using the primers SucSpe1 (TGTTCGCAATAATGGTGGAGGT-
chloramphenicol (30 µg), and ciprofloxacin (5 µg). After incubation CAC) and SucSpe2 (CGAAACGTGCTGCAGCTTTATTC). These primers
at 37 °C for 18 h for Staphylococcus and at 30 °C for 24 h under were used at 0.32 µM in 25 µl of PCR mixture containing 50 µM of each
anaerobic conditions for Lactobacillus, the antibiotic susceptibilities deoxyribonucleoside triphosphate, 1 mM MgCl2 and 1 U of Taq DNA
were evaluated according to the recommendations of the “Comité de polymerase in 1× buffer according to the manufacturer's instructions
l'Antibiogramme de la Société Française de Microbiologie”. (Promega, France). For efficient amplification, the following conditions
Amino acid-decarboxylase activities of the three strains were were used: 10 min at 4 °C, 5 min at 94 °C; 30 cycles of 30 s at 94 °C, 30 s
determined according to Bover-Cid, Hugas, Izquierdo-Pulido and at 67 °C and 10 s at 72 °C; and a final 5 min hold at 72 °C. The PCR
Vidal-Carou (2001). Pure cultures were inoculated in a decarboxylase products were resolved by agarose (1.5% w/v) gel electrophoresis at
broth containing the precursor amino acids (tyrosine, histidine, 8 V cm− 1 for 30 min. The specificity of the S. succinus PCR primers was
ornithine, lysine, phenylalanine, tryptophan), together with pyri- checked against the type strains of the 36 validated staphylococcal
doxal-5′-phosphate as cofactor, and growth factors. The type and species and of the subspecies of S. cohnii, S. equorum and S. succinus.
amount of biogenic amines formed after 4 days of incubation (30 °C) All the type strains used were listed in the study of Giammarinaro
were determined by HPLC according to Hernández-Jover, Izquierdo- et al. (2005). DNAs of type strains were extracted using the Wizard®
Pulido, Veciana-Nogučs and Vidal-Carou (1996). Genomic DNA Purification Kit (Promega, Lyon Charbonnières, France)
according to the manufacturer's instructions. About 50 ng was used
2.2. Sausage manufacturing for PCR amplification. Moreover the S. succinus-specific PCR assay was
tested on 21 wild strains of S. succinus previously identified according
Sausage trials were carried out in the small processing unit F08 to the method of Giammarinaro et al. (2005). DNA templates from the
manufacturing traditional sausages where the technological strains S. succinus isolates and the strain used as starter were obtained from
have been previously isolated. A batter of lean pork (2/3), pork fat (1/3), parts of single colonies during the first denaturing step of PCR.
30 g/kg NaCl, and spices (pepper, garlic) was prepared. Before filling Strains identified at species level by PCR were monitored by pulsed
the natural casings, the batter was divided into two batches of 20 kg field gel electrophoresis (PFGE) analysis. Genomic DNA was prepared
each. Batch 1 was used for natural fermentation and considered as the in agarose plugs as described previously (Corbière Morot-Bizot et al.,
control. In batch 2, sucrose (5 g/kg) and starter culture composed of a 2004) for the Staphylococcus strains and using the same method for
R. Talon et al. / International Journal of Food Microbiology 126 (2008) 227–234 229
Table 1
Bacterial growth, pH and aw in the control batch and in the batch inoculated with autochthonous starters
Batch Samples Time days Yeast/Mould LAB GCC+ Enterococci Enterobacteriaceae Pseudomonas L. monocytogenes pH aw
Data are expressed in log CFU/g, limit of detection 1.0 log CFU/g for L. monocytogenes, standard deviation of microbial counts was inferior to 0.3 log CFU/g.
Z, M, F: steps of manufacturing, Z = batter, M = fermentation, F = end of ripening.
Enumeration was performed according to the methods described by Lebert et al. (2007a): yeasts and moulds were enumerated on yeast extract glucose chloramphenicol agar, LAB:
lactic acid bacteria on Man–Rogosa–Sharp, GCC+: Gram-positive catalase positive cocci on mannitol salt phenol red agar, Enterococci on M-Enterococcus selective agar,
Enterobacteriaceae in crystal violet neutral red bile glucose agar, Pseudomonas on cetrimide-fucidin-cephaloridine agar, Listeria monocytogenes on Listeria agar according to Ottaviani
and Agosti.
Lactobacillus strain except that the addition of lysostaphin was omitted. 2.8. Fatty acid composition
Agarose plugs containing chromosomal DNA were digested with the
endonuclease SmaI for S. equorum and S. succinus DNA and with NotI for Fatty acid estimation was carried out on total lipids extracted by a
L. sakei DNA. Digested DNAs were submitted to PFGE in 1% agarose gels dichloromethane/methanol mixture (2/1 v/v) according to Folch, Lees
on a CHEF-DRIII apparatus (Bio-Rad, Ivry, France). The electrophoretic and Sloane-Stanley (1957) and submitted to transesterification by
conditions were selected with switch times of 40 to 100 s for 2 h and 5 to NaOH and BF3 methanolic solution (AOAC, 1990). Gas chromato-
35 s for 22 h at 6 V/cm and 14 °C. Lambda ladder was used as molecular graphic analysis was performed with a Hewlett Packard HP 6890
weight marker. Gels were stained with ethidium bromide and digitised (Hewlett Packard, Milan, Italy) chromatograph equipped with a
with the Gel Doc 2000 apparatus (Bio-Rad). Gels were analysed using capillary fused silica column INNOWax (J&W, Agilent Technologies,
Quantity one Quantitation software (Bio-Rad). Milan, Italy) (30 m length, 0.25 mm bore, 0.25 μm film thickness),
split–splitless injector and flame ionisation detector. The latter two
2.6. Physico-chemical analysis were kept at constant temperatures of 260 °C and 270 °C respectively.
Nitrogen at a linear velocity of 30 cm/s was the carrier gas.
The pH of the meat samples at the three steps of manufacturing (Z, Temperature of the oven was set at 50 °C for 2 min followed by a
M, F) for the 2 batches was measured with a pH meter MP230 (Mettler drop from 50 °C to 220 °C at a rate of 4 °C/min. The final temperature
Toledo, Viroflay, France) with a pH probe (Inlab 427 penetration probe, was kept constant for 22 min. One μl of methyl-esters solution was
Mettler Toledo). The water activity (aw) of the meat samples was injected. HP Chemstation software was used as data acquisition and
measured with an aw-sprint TH500 (Novasina, Roucaire, France). Total data processing system.
fat content of the final product (F) of the 2 batches was determined by
Soxhlet extraction using petroleum ether (ISO, 1973). 2.9. Lipid oxidation determination
2.7. Biogenic amine determination Fatty acid oxidation was evaluated by the thiobarbituric acid
reactive substances test (TBARS) and the determination of 4-hydroxy-
Biogenic amines (tyramine, histamine, putrescine and cadaverine) 2-nonenal (4-HNE) content. Cholesterol oxidation was estimated by
were analyzed on the meat samples (Z, M, F), by ion-pair reverse the determination of cholesterol oxidation products (COPs).
phase high performance liquid chromatography according to Hernán- TBARS test was performed according to the method Novelli et al.
dez-Jover et al. (1996). Briefly, the method involved the extraction of (1998). Briefly, 10 g of sausage homogenate was distilled and an
biogenic amines with 0.6 N perchloric acid from a homogenised aliquot of the distillate was mixed with 2-thiobarbituric acid aqueous
aliquot (5–10 g). Amine separation was performed through a C18 solution. After boiling, the absorbance of the chromofore formed was
reverse phase column (NovaPack C18, Waters Chromatography, S.A) read by a spectrophotometer at 534 nm. TBARS values were expressed
followed by a post-column derivatization with o-phthalaldehyde-2- as mg of malonaldehyde per kg (mg MDA/kg).
mercaptoethanol with spectrofluorimetric detection. Biogenic amine 4-HNE content was determined according to the analytical
contents were referred to dry matter (dm) to avoid the concentration procedure proposed by Zanardi, Jagersma, Ghidini and Chizzolini
effect due to the drying process. (2002), based on a purification by solid phase extraction and liquid
The data were subjected to analysis of variance (ANOVA) with a chromatography/mass spectrometry analysis by HPLC-MS/MS.MS/MS
Post-hoc contrast (HSD Tuckey) (software package SPSS v.11.0 for acquisition, and was performed by monitoring the reaction m/z
Windows). 171 → 69 characteristic of 4-HNE.
Table 2
Identification and characterisation of the isolates at the three steps of manufacturing in the control batch and in the batch inoculated with autochthonous starters
Batch Samples Staphylococcus isolatesa S. equorum PFGEb S. succinus PFGEb LAB isolates c
L. sakei PFGEb
Control Z 29 17 0/17 0 0 30 0 0
Control M 26 20 0/20 6 2/6 30 0 0
Control F 30 13 2/13 15 6/15 30 3 0/3
Starter Z 30 24 24/24 6 6/6 30 30 30/30
Starter M 30 22 22/22 7 7/7 24 24 24/24
Starter F 30 23 11/23 6 4/6 30 30 30/30
3. Results
The technological bacteria, LAB and GCC+, had an initial level of 4.1
and 3.5 log CFU/g, respectively, in the control batch, increased tenfold
and hundredfold during the fermentation and reached a population of
6.6 log at the end of the ripening (Table 1). In the batch inoculated
with starters, the LAB and GCC+ had an initial level of 6.3 log CFU/g.
The LAB increased 1.7 log during the fermentation and 0.8 log during
the ripening. The GCC+ increased 0.7 log during the fermentation and
returned to the initial level during the ripening period.
Enterococci grew in the control batch throughout the process and
reached a high level (6.2 log CFU/g). In the starter batch, they
decreased during the fermentation and increased during ripening but
reached only 4.2 logCFU/g. Enterobacteriaceae increased during the
fermentation and decreased during ripening in the 2 batches. Pseu-
domonas remained constant during the fermentation and decreased
during ripening in the 2 batches. L. monocytogenes was not detected in
the batter (level below 1.0 log CFU/g). It grew in the control batch to
reach a level slightly above the tolerated level (2.0 log CFU/g) at the
Fig. 1. PFGE patterns of NotI restricted genomic DNA of L. sakei and SmaI restricted
end of ripening, whereas in the starter batch it remained near the
genomic DNA of S. equorum and S. succinus used as autochthonous starters. detection limit.
The pH remained stable up to the fermentation step in the starter
batch and then increased, while in the control batch the pH increased
Cholesterol content was determined through alkaline saponifica- throughout the process and reached a value slightly higher than in the
tion, solvent extraction, derivatization as trimethylsilyl-ether and gas starter batch. Water activity decreased in the two batches during
chromatographic analysis according to Adams, Sullivan, Smith and ripening (Table 1).
Richter (1986). COPs were determined by the analytical procedure
including the total lipid extraction, lipid fractionation and COPs 3.2. Monitoring of the starter cultures
isolation, and GC/MS analysis as described by Zanardi et al. (1998).
Five different COPs were analysed: 7β-hydroxycholesterol, 7-keto- For the monitoring of S. succinus, no rapid and accurate method has
cholesterol, 5,6α-epoxycholesterol, 25-hydroxycholesterol, 20α- been described in the literature. In order to easily identify S. succinus,
hydroxycholesterol. we developed a species-specific PCR assay targeting the sodA gene.
The data were subjected to analysis of variance (one-way ANOVA) Several authors have demonstrated the discriminative power of the
and p ≤ 0.05 was used for the evaluation of statistically significant
differences (SPSS Inc., ver. 13.0, Chicago, IL, USA).
Table 3
2.10. Sensory analysis Quantity of biogenic amines (mg/kg of dry material) in the control batch and in the
batch inoculated with autochthonous starters at the three steps of manufacturing
The method performed to describe the organoleptic diversity of Batch Samples Tyramine Putrescine Cadaverine Histamine
the traditional dry sausages was inspired by the Quantitative Control Z nd nd nd nd
Descriptive Analysis® procedure described by Stone, Sidel, Oliver, Control M nd nd 8.32 (1.00) nd
Woosley and Singleton, (1974) and by ISO Norm 11035 (1995). Dry Control F 58.77 (7.80)a 26.30 (2.76) 312.96 (9.12) 6.29 (0.89)
fermented sausages from the two batches were tasted by a trained Starter Z nd nd nd nd
Starter M nd nd 5.04 (0.37) nd
panel of 9 subjects during 12 sessions for training and evaluation.
Starter F 7.70 (2.87)b 19.18 (0.10) 202.95 (10.67)b 3.90 (0.15)b
Presentation of the products was sequential monadic in a randomised
Z, M, F: steps of manufacturing, Z = batter, M = fermentation, F = end of ripening.
order. Evaluations were conducted in standardised individual booths.
nd: not detected.
For each dry sausage, 3 slices (3 mm. thick) were presented on a small a
Standard deviation.
plate carrying a 3-digit random number. A continuous 10-point b
Final contents of inoculated batch significantly different from the control batch
intensity scale was used to evaluate the intensity of the attributes. The (p b 0.05).
R. Talon et al. / International Journal of Food Microbiology 126 (2008) 227–234 231
Table 4 Tyramine, putrescine and histamine were also found but in lower
Lipid oxidation index at the end of ripening of the control batch and the batch amounts. Cadaverine appeared during fermentation while the other
inoculated with autochthonous starters
amines were detected only in the ripening step. In all cases, no
Lipid oxidation index Control Starter biogenic amines were found in the batter samples. The addition of
4-hydroxy-2-nonenal (mg/kg) n.d.1 n.d. starters significantly reduced (p b 0.05) the accumulation of the above
TBARS value (mg MDA/kg) 0.71 ± 0.012 a 0.61 ± 0.05 b mentioned biogenic amines but did not affect putrescine.
7β-hydroxycholesterol (mg/kg) 0.50 ± 0.10 a 0.30 ± 0.13 a
5α,6α-epoxycholesterol (mg/kg) 1.19 ± 0.45 n.d.
3.4. Fatty acid composition
7-ketocholesterol (mg/kg) 2.88 ± 0.60 a 0.57 ± 0.05 b
25-hydroxycholesterol (mg/kg) 0.19 ± 0.05 0.08 ± 0.01
Total COPs (mg/kg) 4.75 ± 0.85 a 0.95 ± 0.10 b The average content of total lipids of dry fermented sausages at the
% oxidised cholesterol 0.30 ± 0.06 a 0.08 ± 0.01 b end of ripening period was 24.7 ± 0.2% and 22.3 ± 0.4% in control and
1
Lower than the limit of detection; 2 mean values ± standard error; mean values in the starter batches, respectively. These values fall in a normal range for
same row followed by different letters differ significantly (p ≤ 0.05). commercial products of such a type and no significant differences
were detected in the two batches. A similar figure was observed for
fatty acid composition which was not statistically different between
sodA gene to identify the different species of Staphylococcus (Poyart the two batches. In control and starter batches the percentage of
et al., 2001; Blaiotta et al., 2004, 2005; Giammarinaro et al., 2005). saturated fatty acid was 41.2 and 43.5, respectively, whereas that of
When tested with all the type strains of each staphylococcal species, monounsaturated was 46.3 and 45.3 and that of polyunsaturated was
the primers SucSpe1 and SucSpe2 allowed the amplification of a 12.5 and 11.2, respectively.
fragment of 163 bp only when DNA from either S. succinus subsp.
succinus or from S. succinus subsp. casei type strain was used as 3.5. Lipid oxidation
template (data not shown). In addition to the validated type strains, the
S. succinus-specific PCR assay was applied to 21 wild strains of S. The results of the conventional indexes of lipid oxidation are
succinus. A 163 bp product was obtained for all the strains when reported in Table 4. The dry fermented sausages did not show
colonies of S. succinus were used as template (data not shown). detectable amounts of 4-hydroxy-2-nonenal. This means that the level
The S. equorum and S. succinus-specific PCR assays allowed of 4-hydroxy-2-nonenal was lower than 0.043 mg/kg, the limit of
identification of the two species in the 2 batches during all detection of the analytical method (Zanardi et al., 2002). Autochtho-
fermentation steps except in the batter of the control batch where S. nous starters appeared to help improve lipid oxidative stability
succinus was not detected. The S. equorum species was dominant because starter batches presented significantly lower TBARS values
compared with the S. succinus species except in the final sausage of (0.61 mg MDA/kg) than the control batch (0.71 mg MDA/kg).
the control batch in which an equal ratio was found (Table 2). In the A similar figure could be applied for total COPs content, which was
starter batch, the ratio between S. equorum and S. succinus was 0.8/0.2 five times lower in starter batch (0.95 mg/kg) than in the control batch
and this was observed throughout the process. (4.75 mg/kg), and for the percentage of oxidised cholesterol, which
In the control batch, only 15% isolates at the end of the process was nearly four times lower in starter batch (0.08%) than in control
identified as S. equorum had the same PFGE profile as the inoculated S. batch (0.30%) (Table 4). Overall, cholesterol oxidation was found to be
equorum F08bF15 strain while for S. succinus 33% of isolates after limited both as type of COPs encountered and as total level of
fermentation and 40% of isolates at the end of the process had the same oxidation. Three COPs (7β-hydroxycholesterol, 7-ketocholesterol and
PFGE profile as the inoculated S. succinus F08bF19 strain (Table 2, Fig. 1). 25-hydroxycholestrol) were constantly detected in both sausage
In the starter batch, the two strains inoculated were dominant from the batches whereas 5α,6α-epoxycholesterol was only detected in the
start of the process and remained constant until the end of the ripening, control batch at the level of 1.19 mg/kg. The content of 7β-
where 48% of the isolates identified as S. equorum and 67% of the isolates hydroxycholesterol was similar in the two batches whereas the levels
identified as S. succinus had the same PFGE profile as the corresponding of 7-ketocholesterol and 25-hydroxycholestrol were significantly
inoculated strain (Table 2, Fig. 1). higher in control sausages.
Using the L. sakei specific PCR assay, only three isolates from the
final dry sausage of the control batch were identified as L. sakei, 3.6. Sensory analysis
whereas all the strains isolated from the starter batch and at the three
steps of manufacturing were identified as L. sakei (Table 2). All the The specific sensory quality of the French dry fermented sausage is
isolates of L. sakei characterised by PFGE analysis in the starter batch mainly associated with its odour and flavour (Rason et al., 2007). The
had the same PFGE profile as the inoculated L. sakei F08bF19 strain addition of autochthonous starters had no effect on the overall aroma
(Table 2, Fig. 1). and flavour of the sausages (Table 5). The rancid and saltiness
attributes were perceived as prominent by nose (aroma) but not in the
3.3. Biogenic amines mouth (flavour) in the sausages of the starter batch. Starter cultures
noticeably influenced the texture of the sausages compared with the
The sausages manufactured as a control batch showed a consider- control batch (Table 6). Sausage slices of the starter batch were less
able final concentration of cadaverine: 313 mg/kg dm (Table 3). brittle and had a better texture. Moreover, the fat perception of the
Table 5
Sensory analysis at the end of ripening of the control batch and the batch inoculated with autochthonous starters
Colour Global aroma Vinegar Saltiness Marinade Rancid Rancid Pepper Acidity Salty
Control 6.6a1 6.4a 3.9a 3.4a 2.6a 3.9a 5.0a 2.0a 4.1a 6.9a
Starter 6.3a 6.9a 3.3a 2.5b 1.9a 5.0b 5.2a 2.2a 3.7a 6.5a
1
Means with the same letter in a column are not significantly different (p b 0.005) according to Student's t test and the Newman–Keuls multiple comparison test.
232 R. Talon et al. / International Journal of Food Microbiology 126 (2008) 227–234
Sensory qualities of dry fermented sausages (texture, colour, and Blaiotta, G., Casaburi, A., Villani, F., 2005. Identification and differentiation of S Sta-
phylococcus carnosus and Staphylococcus simulans by species-specific PCR assays of
flavour) depend on numerous compounds and chemical or biochem- sodA genes. Systematic and Applied Microbiology 28 (6), 519–526.
ical reactions occurring during the process. Most of the attributes used Bover-Cid, S., Hugas, M., Izquierdo-Pulido, M., Vidal-Carou, M.C., 2001. Amino acid-
in this study are widely used to describe industrial pork dry fermented decarboxylase activity of bacteria isolated from fermented pork sausages.
International Journal of Food Microbiology 66 (3), 185–189.
sausages except for some aroma and flavour attributes, which may be Bösinger, S., Luf, W., Brandl, E., 1993. Oxysterols: their occurrence and biological effects.
specific to traditional dry fermented sausages (Rason et al., 2007). International Dairy Journal 3, 1–33.
Indeed, marinade aroma, vinegar or rancid flavour were not found in Casaburi, A., Blaiotta, G., Mauriello, G., Pepe, O., Villani, F., 2005. Technological activities
of Staphylococcus carnosus and Staphylococcus simulans strains isolated from
studies of the flavour profile of industrial dry sausages (Stahnke, 1995; fermented sausages. Meat Science 71, 643–650.
Rousset-Akrim et al., 1997). Aroma and flavour of the sausages with or Chizzolini, R., Novelli, E., Zanardi, E., 1998. Oxidation in traditional Mediterranean meat
without autochthonous starters were not significantly different. It is products. Meat Science 49 (supplement 1), S87–S99.
Cocolin, L., Manzano, M., Aggio, D., Cantoni, C., Comi, G., 2001. A novel polymerase chain
well known that staphylococci contribute to the sensory quality of
reaction (PCR) — denaturing gradient gel electrophoresis (DGGE) for the
sausages via the catabolism of carbohydrates and amino acids, the identification of Micrococcaceae strains involved in meat fermentations. Its
formation of esters and their interaction with fatty acids (Montel et al., application to naturally fermented Italian sausages. Meat Science 58 (1), 59–64.
1998). In this study GCC+ constituted an important fraction of the Corbière Morot-Bizot, S., Talon, R., Leroy, S., 2004. Development of a multiplex PCR for
the identification of Staphylococcus genus and four staphylococcal species isolated
sausage bacteria regardless of inoculation. Furthermore S. equorum from food. Journal of Applied Microbiology 97 (5), 1087–1094.
and S. succinus were the dominant species in both types of sausages. Corbière Morot-Bizot, S., Leroy, S., Talon, R., 2006. Staphylococcal community of a small
These findings could explain why the sensory property of the two unit manufacturing traditional dry fermented sausages. International Journal of
Food Microbiology 108 (2), 210–217.
types of sausage was similar. Drosinos, E.H., Paramithiotis, S., Kolovos, G., Tsikouras, I., Metaxopoulos, I., 2007.
The final consistency of the sausage is the result of its acidification Phenotypic and technological diversity of lactic acid bacteria and staphylococci
and dehydration. Thanks to their acidifying capacity, lactic acid isolated from traditionally fermented sausages in Southern Greece. Food Micro-
biology 24 (3), 260–270.
bacteria contribute to the firmness of the sausage (Talon et al., Durlu-Özkaya, F., Ayhan, K., Vural, N., 2001. Biogenic amines produced by Enterobacter-
2002). Acidification also favours the dehydration of the product by iaceae isolated from meat products. Meat Science 58 (2), 163–166.
reducing the water retention capacity of the mixture. In this study EC, 2007. Commission Regulation (EC) n° 1441/2007 of the 7 December 2007 which
modifies (EC) n° 2073/2005 on microbiological criteria for foodstuffs. OJEU L322,
improvement of the overall texture observed in the inoculated 12–29.
sausages could be attributed to the high level of L. sakei and to the Folch, J., Lees, M., Sloane-Stanley, G.H., 1957. A simple method for the isolation and
pH stabilisation during the fermentation step. purification of total lipids from animal tissues. Journal of Biological Chemistry 226,
496–500.
This is the first time to our knowledge that S. equorum and S.
Fontana, C., Cocconcelli, P.S., Vignolo, G., 2005. Monitoring the bacterial population
succinus have been tested as starter cultures in sausage manufacturing. dynamics during fermentation of artisanal Argentinean sausages. International
The present investigation indicates that the use of adequate auto- Journal of Food Microbiology 103 (2), 131–142.
chthonous microbial starter cultures is an efficient way to improve the Ghiretti, G., Zanardi, E., Novelli, E., Campanini, G., Dazzi, G., Madarena, G., Chizzolini, R.,
1997. Comparative evaluation of some antioxidants in salame milano and
safety of the traditional sausages by inhibiting pathogenic bacteria mortadella production. Meat Science 47 (1/2), 167–176.
(L. monocytogenes), decreasing the level of biogenic amines and Giammarinaro, P., Leroy, S., Chacornac, J.-P., Delmas, J., Talon, R., 2005. Development of a
limiting fatty acid and cholesterol oxidation. Moreover, autochthonous new oligonucleotide array to identify staphylococcal strains at species level. Journal
of Clinical Microbiology 43 (8), 3673–3680.
microbial starter cultures did not affect the typical sensory quality of Gonzalez-Fernandez, C., Santos, E.M., Jaime, I., Rovira, J., 2003. Influence of starter
the traditional sausages. Use of autochthonous starter cultures is an cultures and sugar concentrations on biogenic amine contents in chorizo dry
important tool for traditional sausage manufacture to limit the sausage. Food Microbiology 20, 275–284.
Gounadaki, A.S., Skandamis, P.N., Drosinos, E.H., Nychas, G.-J.E., 2008. Microbial ecology
formation of unsafe compounds while preserving product specificity. of food contact surfaces and products of small-scale facilities producing traditional
sausages. Food Microbiology 25 (2), 313–323.
Acknowledgements Hernandez-Jover, T., Izquierdo-Pulido, M., Veciana-Nogučs, M.T., Vidal-Carou, M.C.,
1996. Ion-pair high-performance liquid chromatographic determination of bio-
genic amines in meat and meat products. Journal of Agricultural and Food
This work was financially supported by EU program QLK1-CT2002- Chemistry 44, 2710–2715.
02240. We thank I. Chevalier (ENITA, France) for providing the strain of Hugas, M., 1998. Bacteriocinogenic lactic acid bacteria for the biopreservation of meat
and meat products. Meat Science 49 (1), S139–S150.
Lactobacillus sakei (F08F202). We would like to thank Brigitte Duclos
ISO,1973. Meat and meat products. Determination of Total Fat Content. Standard Method
for secretarial assistance, and David Marsh for revision of the English. No. 1443. International Organisation for Standardization, Geneve, Switzerland.
ISO Norm 11035, 1995. Analyse sensorielle-méthodologie-recherche de descripteurs
pour l'élaboration d'un profil sensoriel.
References Jordana, J., 2000. Traditional foods: challenges facing the European food industry. Food
Research International 33, 147–152.
Adams, M.L., Sullivan, D.M., Smith, R.L., Richter, E.F., 1986. Evaluation of direct Latorre-Moratalla, M.L., Bover-Cid, Aymerich, T., Marcos, B., Vidal-Carou, M.C., Garriga,
saponification method for determination of cholesterol in meats. Journal Associa- M., 2007. Aminogenesis control in fermented sausages manufactured with
tion of Official Analytical Chemists 69 (5), 844–846. pressurized meat batter and starter culture. Meat Science 75 (3), 460–469.
AOAC, 1990. Meat and meat products. In: Helrich, K. (Ed.), Official Methods of Analysis, Latorre-Moratalla, M.L., Veciana-Nogues, T., Bover-Cid, S., Garriga, M., Aymerich, T.,
vol. 2. Association of Official Analytical Chemists, Arlington, VA, pp. 931–948. Zanardi, E., Ianieri, A., Fraqueza, M.J., Patarata, L., Drosinos, E.H., Laukova, A., Talon,
Aymerich, T., Martin, B., Garriga, M., Hugas, M., 2003. Microbial quality and direct PCR R., Vidal-Carou, M.C., 2008. Biogenic amines in traditional fermented sausages
identification of lactic acid bacteria and nonpathogenic Staphylococci from produced in selected European countries. Food Chemistry 107 (2), 912–921.
artisanal low-acid sausages. Applied and Environmental Microbiology 69 (8), Lebert, I., Leroy, S., Giammarinaro, P., Lebert, A., Chacornac, J.P., Bover-Cid, S., Vidal-
4583–4594. Carou, M.C., Talon, R., 2007a. Diversity of microorganisms in the environment and
Aymerich, T., Martín, B., Garriga, M., Vidal-Carou, M.C., Bover-Cid, S., Hugas, M., 2006. dry fermented sausages of small traditional French processing units. Meat Science
Safety properties and molecular strain typing of lactic acid bacteria from slightly 76 (1), 112–122.
fermented sausages. Journal of Applied Microbiology 100 (1), 40–49. Lebert, I., Leroy, S., Talon, R., 2007b. Microorganisms in traditional fermented meats —
Barrière, C., Centeno, D., Lebert, A., Leroy-Sétrin, S., Berdagué, J.L., Talon, R., 2001a. Roles chapter 11. In: Toldra, F., Wai-Kit, N., Sebranek, J.G., Stahnke, L.H., Expedito, F.S.,
of superoxide dismutase and catalase of Staphylococcus xylosus in the inhibition of Tadeu, Talon, R.t.A.E., Hui, Y.H.A.E. (Eds.), Handbook of Fermented Meat and Poultry,
linoleic acid oxidation. FEMS Microbiology Letters 201 (2), 181–185. pp. 113–124.
Barrière, C., Leroy-Sétrin, S., Talon, R., 2001b. Characterization of catalase and Leroy, F., Verluyten, J., De Vuyst, L., 2006a. Functional meat starter cultures for improved
superoxide dismutase in Staphylococcus carnosus 833 strain. Journal of Applied sausage fermentation. International Journal of Food Microbiology 106 (3), 270–285.
Microbiology 91 (3), 514–519. Leroy, S., Chevallier, I., Lebert, I., Chacornac, J.P., Talon, R., 2006b. Saucissons secs
Berthier, F., Ehrlich, S.D., 1998. Rapid species identification within two groups of closely fermiers du Massif central — Identification et caractérisation de la flore d'intérêt
related lactobacilli using PCR primers that target the 16S/23S rRNA spacer region. technologique: bactéries lactiques et staphylocoques à coagulase négative. Viandes
FEMS Microbiology Letters 161 (1), 97–106. et Produits Carnés 25 (5), 171–175.
Blaiotta, G., Ercolini, D., Mauriello, G., Salzano, G., Villani, F., 2004. Rapid and reliable Mauriello, G., Casaburi, A., Blaiotta, G., Villani, F., 2004. Isolation and technological
identification of Staphylococcus equorum by a species-specific PCR assay targeting properties of coagulase negative Staphylococci from fermented sausages of
the sodA gene. Systematic and Applied Microbiology 27 (6), 696–702. southern Italy. Meat Science 67 (1), 149–158.
234 R. Talon et al. / International Journal of Food Microbiology 126 (2008) 227–234
Miguélez-Arrizado, M.J., Bover-Cid, S., Latorre-Moratalla, M.L., Vidal-Carou, M.C., 2006. Samelis, J., Metaxopoulos, J., Vlassi, M., Pappa, A., 1998. Stability and safety of traditional
Biogenic amines in Spanish fermented sausages as a function of diameter and Greek salami — a microbiological ecology study. International Journal of Food
artisanal or industrial origin. Journal of the Science of Food and Agriculture 86, Microbiology 44 (1–2), 69–82.
549–557. Stahnke, L.H., 1995. Dried sausages fermented with Staphylococcus xylosus at different
Montel, M.C., Masson, F., Talon, R., 1998. Bacterial role in flavour development. Meat temperatures with different ingredients levels. Part III. Sensory evaluation. Meat
Science, vol. 49. Elsevier, pp. S111–S123. Science 41 (2), 211–223.
Montel, M.C., Masson, F., Talon, R., 1999. Comparison of biogenic amine content in Stone, H., Sidel, J., Oliver, S., Woosley, A., Singleton, R.C., 1974. Sensory evaluation by
traditional and industrial French dry sausages. Sciences des Aliments, vol. 19. quantitative descriptive analysis. Food Technology 28, 24–34.
Lavoisier, pp. 247–254. Suzzi, G., Gardini, F., 2003. Biogenic amines in dry fermented sausages: a review.
Naes, T., Langsrud, R., 1998. Fixed or random assessors in sensory profiling? Food International Journal of Food Microbiology 88 (1), 41–54.
Quality and Preference 9, 145–152. Talon, R., Walter, D., Montel, M.C., 2000. Growth and effect of staphylococci and lactic
Novelli, E., Zanardi, E., Ghiretti, G.P., Campanini, G., Dazzi, G., Madarena, G., Chizzolini, R., acid bacteria on unsaturated free fatty acid. Meat Science 54, 41–47.
1998. Lipid and cholesterol oxidation in frozen stored pork, salame Milano and Talon, R., Leroy-Sétrin, S., Fadda, S., 2002. Bacterial starters involved in the quality of
mortadella. Meat Science 48, 29–40. fermented meat products. Research Advances in Quality of Meat and Meat
Ogier, J.C., Serror, P., in press. The Enterococcus genus. International Journal of Food Products, vol. Chapter 10. Research Signpost, pp. 175–191.
Microbiology. doi:10.1016/j.ijfoodmicro.2007.08.017. Urso, R., Comi, G., Cocolin, L., 2006. Ecology of lactic acid bacteria in Italian fermented
Parente, E., Martuscelli, M., Gardini, F., Grieco, S., Crudele, M.A., Suzzi, G., 2001. Evolution sausages: isolation, identification and molecular characterization. Systematic and
of microbial populations and biogenic amine production in dry sausages produced Applied Microbiology 29 (8), 671–680.
in Southern Italy. Journal of Applied Microbiology 90 (6), 882–891. Villani, F., Casaburi, A., Pennacchia, C., Filosa, L., Russo, F., Ercolini, D., 2007. Microbial
Poyart, C., Quesne, G., Boumaila, C., Trieu-Cuot, P., 2001. Rapid and accurate species-level ecology of the soppressata of Vallo di Diano, a traditional dry fermented sausage
identification of coagulase-negative staphylococci by using the sodA gene as a from southern Italy, and in vitro and in situ selection of autochthonous starter
target. Journal of Clinical Microbiology 39 (12), 4296–4301. cultures. Applied and Environmental Microbiology 73 (17), 5453–5463.
Rantsiou, K., Cocolin, L., 2006. New developments in the study of the microbiota of Zanardi, E., Novelli, E., Nanni, N., Ghiretti, G., Delbono, G., Campanini, G., Dazzi, G.,
naturally fermented sausages as determined by molecular methods: a review. Madarena, G., Chizzolini, R., 1998. Oxidative stability and dietary treatment with
International Journal of Food Microbiology 108 (2), 255–267. vitamin E, oleic acid and copper of fresh and cooked pork chops. Meat Science 49 (3),
Rason, J., Martin, J.F., Dufour, E., Lebecque, A., 2007. Diversity of the sensory 309–320.
characteristics of traditional dry sausages from the centre of France: relation with Zanardi, E., Jagersma, C., Ghidini, S., Chizzolini, R., 2002. Solid phase extraction and
regional know-how. Food Quality and Preference 18 (3), 517–530. liquid chromatography tandem mass spectrometry for the evaluation of 4-hydroxy-
Roig Sagués, A.-X., Hernandez-Herrero, M., Lopez-Sabater, E.I., Rodriguez-Jerez, J.J., 2-nonenal in pork products. Journal of Agricultural and Food Chemistry 50,
Mora-Ventura, M.T., 1996. Histidine decarboxylase activity of bacteria isolated 5268–5272.
from raw and ripened salchichon, a Spanish cured sausage. Journal of Food Zanardi, E., Ghidini, S., Battaglia, A., Chizzolini, R., 2004. Lipolysis and lipid oxidation in
Protection 59 (5), 516–520. fermented sausages depending on different processing conditions and different
Rousset-Akrim, S., Martin, J.F., Bayle, M.-C., Berdagué, J.L., 1997. Comparison between an antioxidants. Meat Science 66, 415–423.
odour profile and a flavour profile of dry fermented sausages. International Journal
of Food Science & Technology 32, 539–546.
RESULTADOS
10
DESARROLLO Y VALIDACIÓN DE MÉTODOS
PARA LA DETERMINACIÓN DE AMINAS
BIÓGENAS Y DE LA ACTIVIDAD
AMINOÁCIDO-DESCARBOXILASA
233
RESULTADOS
Artículo X.
M.L. Latorre-Moratalla, J. Bosch-Fusté, T. Lavizzari, S. Bover-Cid, M.T. Veciana-Nogués, M.C.
Vidal-Carou. (2009). Validation of an Ultra High Pressure Liquid Chromatographic (UHPLC)
method for the determination of biologically active amines in food. Journal of
Chromatography A, 1216 (45): 7715-7720.
Índice de impacto (JCR 2008): 3,576
Posición en el área “Analytical Chemistry”: 6/70
Comunicación escrita.
M.L. Latorre-Moratalla, J. Bosch-Fusté, T. Lavizzari, S. Bover-Cid, M.T. Veciana-Nogués, M.C.
Vidal-Carou. Determinación de aminas biológicamente activas en alimentos por
cromatografía de ultra alta eficacia (UPLC). V Congreso Internacional de Ciencia y
Tecnología de los Alimentos. Murcia, 26-29 de Mayo de 2009.
235
DESARROLLO Y VALIDACIÓN DE MÉTODOS
10.1.3 Resultados
236
RESULTADOS
237
DESARROLLO Y VALIDACIÓN DE MÉTODOS
Reactivo derivatización:
Eluyente A: Eluyente B:
31,0 g/l de ácido bórico
solución acuosa con eluyente A: Acetonitrilo
26,2 g/l de hidróxido sódico
acetato sódico 0,1M (6,6:3,4); pH 4.5
0,2 g/l orto-ftaldehído en 5ml
Octanosulfonato sódico
de metanol
10mM; pH 4.8
3,0 ml/l de 2-mercaptoetanol
3,0 ml/l de éter de
Fase estacionaria: polioxietilenlaurílico al 30%
Columna Acquity UPLC
BEH C18 1.7 µm (2.1 x
50 mm) (42 ºC)
Bomba Post- columna
Waters 510 ©
Gestor de muestras y Flujo de reactivo derivatizante:
auto inyector 0,4 ml/min
( Acquity UPLC©)
Temperatura: 4 ºC
Figura 10.1. Sistema de cromatografía líquida de ultra alta eficacia (UHPLC) unido a un
sistema de derivatización post-columna, condiciones cromatográficas y gradiente de
elución linear utilizados para la determinación de 12 aminas biógenas.
238
RESULTADOS
239
RESULTADOS
Artículo X.
M.L. Latorre-Moratalla, J. Bosch-Fusté, T. Lavizzari, S. Bover-Cid, M.T. Veciana-
Nogués, M.C. Vidal-Carou. (2009). Validation of an Ultra High Pressure Liquid
Chromatographic (UHPLC) method for the determination of biologically active
amines in food. Journal of Chromatography A, 1216 (45): 7715-7720.
Índice de impacto (JCR 2008): 3,576
Posición en el área “Analytical Chemistry”: 6/70
241
Journal of Chromatography A, 1216 (2009) 7715–7720
Journal of Chromatography A
journal homepage: www.elsevier.com/locate/chroma
a r t i c l e i n f o a b s t r a c t
Article history: Biologically active amines include the so called biogenic amines, such as histamine, tyramine and cadav-
Received 22 April 2009 erine, and polyamines such as spermidine and spermine. Ultra high pressure liquid chromatography
Received in revised form 23 August 2009 (UHPLC) is a new generation of separation techniques that takes full advantage of chromatographic prin-
Accepted 27 August 2009
ciples to increase speed flow which drastically reduce analysis time. The aim of the present work was
Available online 1 September 2009
to validate a rapid method of UHPLC to detect the presence of biogenic amines and polyamines in food.
Different food matrixes (wine, fish, cheese, and dry fermented sausage) were used in order to test the
Keywords:
versatility of the method. The UHPLC method described in this article has been demonstrated as a reli-
UHPLC method
Biogenic amines
able procedure to determine 12 biogenic amines and polyamines in less than 7 min of chromatographic
Polyamines elution. The method provides a satisfactory linearity and chromatographic sensitivity with a detection
OPA limit lower than 0.2 mg/L and a determination limit falling below 0.3 mg/L for all amines. The precision, in
Food terms of relative standard deviation, was lower than 5% and the accuracy, as mean recovery, was between
93% and 98%, depending on the food matrix.
© 2009 Elsevier B.V. All rights reserved.
0021-9673/$ – see front matter © 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.chroma.2009.08.072
7716 M.L. Latorre-Moratalla et al. / J. Chromatogr. A 1216 (2009) 7715–7720
Analytical determination of these amines can be carried out placed into an oven to keep it at constant temperature (see below).
through a variety of approaches, being the chromatographic Data acquisition was accomplished with the Empower version 2
procedures the most commonly used [11,12]. Thin layer chro- system.
matography [13,14] or gas chromatography [15] has been proposed
but high performance liquid chromatography (HPLC), coupled to 2.3. Chemicals
distinct detection techniques, has been the most extensive method
used over the past 30-plus years [16–21]. Traditional HPLC meth- Ultra pure water was obtained from Milli-Q system (Millipore).
ods allow the determination of a wide variety of biogenic amines HPLC grade acetonitrile and methanol were obtained from SDS
(over 10), but the time required to carry out the analysis is rela- (Peppin, France). The other reagent-grade chemicals used were:
tively long, between 20 and 60 min per sample [11,12]. Based on sodium acetate anhydrous, Brij 35, 2-mercaptoethanol, OPA, and
the HPLC principles, when sub-2 mm porous particles are used, acetic acid from Merck (Darmstadt, Germany); sodium octane-
speed and peak capacity can be extended to new limits. Ultra sulphonate from Romil Chemicals (Cambridge, UK) and boric acid,
high pressure liquid chromatography (UHPLC) is a new genera- potassium hydroxide, hydrochloric acid 35% (HCl), and perchloric
tion of chromatographic techniques, that in comparison with HPLC, acid 70% from Panreac (Montplet & Esteban, Barcelona, Spain). The
operate at higher pressures, up to 15 000 psi, require less vol- following biogenic amine and polyamine standards were obtained
ume of sample and captures detector signals at high data rates from Sigma (St. Louis, MO, USA): histamine (HI) dihydrocloride,
for fast eluting peaks [22,23]. Thus, UHPLC technology allows a tyramine (TY) free base, b-phenylethylamine (PHE) hydrochloride,
drastically reduction on time analysis while increasing resolution serotonin (SE) creatinine sulphate, tryptamine (TR) hydrochloride,
and sensitivity [24,25]. According to our knowledge, there is only octopamine (OC) free base, dopamine (DO) free base, cadaver-
a previous recently published method [26] that uses this new ine (CA) dihydrocloride, putrescine (PU) hydrochloride, agamatine
technology for the biogenic amine determination. However, this (AG) sulphate, spermine (SM) tetrahydrochloride, and spermidine
method uses dansyl chloride for biogenic amine derivatization, (SD) trihydrochloride. A 1000 mg/L stock solution of each amine as
which is an expensive time procedure than an on-line post-column a free base was prepared in 0.1 M HCl. A 50 mg/L intermediate solu-
derivatization with OPA. In addition, the UHPLC method described tion including all biogenic amines and polyamines was prepared in
by Dadáková et al. [26] is only able to determine eight biogenic 0.1 M HCl from the stock solution. Finally, working standard solu-
amines. tions (ranging from 0.1 to 50 mg/L) were prepared in 0.1 M HCl from
The aim of the present work was to validate a rapid, precise, the intermediate standard solution. The standard solutions were
and versatile UHPLC method coupled with an on-line OPA post- passed through a 0.22 mm filter, protected from light and stored
column derivatization, which allows the determination of twelve under refrigeration.
biogenic amines and polyamines in different food types. The pro-
cedure was validated in terms of linearity, sensitivity, precision, 2.4. Chromatographic conditions
and recovery. To prove the versatility of the method, the anal-
ysis was carried out on wine, fish, cheese, and dry fermented Mobile phase consisted of the eluent A as a solution of 0.1 M
sausages. sodium acetate and 10 mM sodium octanesulphonate adjusted to
pH 4.8 with acetic acid, and the eluent B as a mixture of solvent
B-acetonitrile (6.6:3.4), where solvent B was a solution of 0.2 M
2. Material and methods
sodium acetate and 10 mM sodium octanesulphonate adjusted to
pH 4.5 with acetic acid. The mobile phase was filtered through a
2.1. Samples and sample preparation
0.22 mm filter. The post-column derivatization reagent was pre-
pared as follows: 15.5 g of boric acid and 13.0 g of potassium
Samples of red wine, fish, semi-ripened cheese, and dry
hydroxide were dissolved in 500 ml of water, then 1.5 ml of 30%
fermented sausages were selected to check the recovery and
Brij and 1.5 ml of 2-mercaptoethanol as a reducing agent were
the precision of the method. The preparation of solid samples
added; finally, 0.1 g of OPA dissolved in 2.5 ml of methanol was
consisted of the mechanical trituration and homogenization of
added to the above solution. The derivatization reagent was pre-
the product using a domestic mincing machine for 1 min. An
pared daily, passed through a 0.22 mm filter, and protected from
aliquot of 5–10 g was accurately weighed in a centrifuge tube
light.
and thoroughly mixed with 9 ml of 0.6 M perchloric acid in a
A linear gradient programme was implemented as fol-
magnetic stirring plate for 20 min. Thereafter, the two phases
lows: time = 0 min, A:B (80:20); time = 2 min, A:B (80:20);
were separated by centrifugation at 5600 × g at 4 ◦ C for 20 min.
time = 3 min, A:B (60:40); time = 4 min, A:B (50:50); time = 5 min,
The extraction process was repeated twice for 20 and 10 min,
A:B (40:60); time = 6 min, A:B (20:80); time = 6.40 min, A:B (80:20);
respectively. The supernatants collected were combined and the
time = 7 min, A:B (80:20).
final volume was adjusted to 25 ml with 0.6 M perchloric acid.
The flow rate of the mobile phase was 0.8 ml/min, and the flow
Before UHPLC analysis, perchloric extracts and wine samples
rate of the derivatization reagent was 0.4 ml/min. The column tem-
were passed through a 0.22 mm filter (GHP, Waters Corp, Milford,
perature was 42 ◦ C while the post-column reaction equipment was
MA).
kept at room temperature. Automatic injection of 1 ml of the stan-
dard solution and samples was carried out. Vials filled with either
2.2. Equipment standard solutions or samples were kept at 4 ◦ C in the auto sam-
pler. Fluorimetric detection at 340 nm for excitation and 445 nm
UHPLC was performed using a Waters Acquity system (Milford, for emission was applied.
MA, USA), which consisted of a binary pump and an auto-sampler
accomplished with a post-column pump (Waters 510) and a flu- 2.5. Statistical analysis
orescence detector (Waters 2475). The post-column pump was
connected to a zero dead volume mixing T installed between All statistical tests were performed using Statistical Software
the column outlet and the detector. Chromatographic separation Package for Windows SPSS, version 15 (SPSS, Chicago, IL, USA). To
was performed using an Acquity UPLC BEH C18 1.7 mm column assess the reliability of the method, analysis of variance for linear
(2.1 mm × 50 mm) (Waters corp., Milford, MA, USA), which was regression was used. To test for comparisons between data sets,
M.L. Latorre-Moratalla et al. / J. Chromatogr. A 1216 (2009) 7715–7720 7717
Fig. 1. Chromatograms of a biogenic amine and polyamine solution of 25 mg/L (A), wine (B), fish (C), cheese (D), and dry sausage extracts (E). OC: octopamine; DO: dopamine;
TY: tyramine; PU: putrescine; SE: serotonin; CA: cadaverine; HI: histamine; AG: agmatine; PHE: phenylethylamine; SD: spermidine; TR: tryptamine; SM: spermine.
the t-test was used, and finally the Cochran test was used to test resolution, particularly those of serotonine and tryptamine. There-
for homogeneity of variance. fore, several pH levels (from 4.5 to 5.3) and temperatures (from 37
to 45 ◦ C) were assayed to find the best resolved peaks.
3. Results and discussion The method allows the resolution of a total of 12 biologically
active amines in a single chromatographic run on a 7-min elution
Chromatographic conditions were achieved by following the programme. The new conditions reduced 9-fold the elution time
original HPLC methods used to quantify 12 biogenic amines in sev- reported by the original HPLC methods [27–30], and between 5
eral food types [27–30]. To adapt the original mobile phase flow and 11-fold by others previous HPLC methods for the determina-
rate and the injection volume to the UHPLC system a scaling factor tion of a similar number of biogenic amines in wine [19,21,31], fish
(derived from the ratio of the column cross sectional areas) was [16], cheese [32,33], and dry fermented sausages [34,35]. As a result
applied in order to retain the linear velocity of the mobile phase. of the time reduction, the spent of solvents is drastically reduced
In addition, the pH of the mobile phase and the temperature of the making the present UHPLC method of lower reagent cost and less
stationary phase (column) were modified slightly to improve peak environmental impact.
7718 M.L. Latorre-Moratalla et al. / J. Chromatogr. A 1216 (2009) 7715–7720
Table 1
Precision (RSD) and recovery (mean and standard deviation) of the UPLC method for the determination of octopamine (OC), dopamine (DO), tyramine (TY), putrescine (PU),
serotonine (SE), cadaverine (CA), histamine (HI), agmatine (AG), phenylethylamine (PHE), spermidine (SD), tryptamine (TR) and spermine (SM) in wine.
Initial content Content after RSDc (%) RSDHd (%) Recovery (%) Content after RSD (%) RSDH (%) Recovery (%) Cochran’s
(mg/L) addition (mg/L) addition (mg/L) teste Cexp
OC ndf 4.80 3.14 6.32 95.90 (3.01) 9.79 2.57 5.68 97.87 (2.51) 0.59
DO nd 4.99 0.56 6.28 99.73 (0.56) 10.09 3.57 5.65 98.94 (1.20) 0.82
TY 2.48 7.63 1.86 5.89 102.01 (1.90) 12.41 2.33 5.48 99.48 (2.31) 0.60
PU 10.79 15.57 4.04 5.29 98.59 (3.98) 20.03 2.16 5.10 96.38 (20.8) 0.78
SE nd 5.04 2.60 6.27 100.80 (2.62) 10.08 3.57 5.65 100.76 (3.60) 0.65
CA nd 5.16 3.04 6.25 103.28 (3.14) 10.02 2.87 5.65 100.24 (2.88) 0.54
HI 5.45 10.18 3.97 5.64 97.37 (3.87) 14.46 2.25 5.35 93.56 (2.10) 0.77
AG nd 4.88 2.07 6.30 97.64 (2.02) 9.82 3.27 5.67 98.20 (3.21) 0.72
PHE 0.64 5.78 3.21 6.14 102.62 (3.30) 10.81 1.47 5.59 101.61 (1.49) 0.83
SD 0.99 6.13 3.58 6.09 100.97 (1.96) 10.88 1.49 5.59 99.01 (1.48) 0.64
TR nd 4.91 3.91 6.30 98.25 (3.84) 9.60 1.87 5.69 95.96 (1.79) 0.82
SM nd 4.92 2.32 6.29 98.40 (2.28) 10.04 1.35 5.65 100.44 (1.36) 0.74
a
5 mg/L of each amine.
b
10 mg/L of each amine.
c
RDS, relative standard deviation for the eight determinations.
d
RDSH, upper limit of the acceptable range for relative standard deviations according to Horwitz’s formula for intra-laboratory study.
e
Cochran test, Ctab (7, 2, 0.05) = 0.8332.
f
Not detected.
The reliability of the UHPLC method for routine analysis of differ- 3.2. Sensitivity
ent food matrixes (fish, cheese, wine, and dry fermented sausages)
was assessed in terms of linearity, sensitivity, precision, and The chromatographic detection limit (DL) and determination
recovery [36]. As it can be seen in Fig. 1, the chromatograms limit (DtL) were obtained according to the IUPAC approach [36].
of the standard solutions and of food samples assayed were Standard regression curves were obtained at a low-concentration
simple, without interferences and with certain amine identifica- range (from 0.1 to 2 mg/L) for all biogenic amines and polyamines.
tion on the basis of the retention time by comparison with the Baseline noise was determined using a perchloric acid solution
standard. (0.6 M) as a blank. DLs were lower than or equal to 0.05 mg/L for
OC, TY, PU, CA, HI, AG, PHE, and SD, 0.12 mg/L for DO, SE, and TR,
3.1. Linearity and 0.2 mg/L for SM. DtLs were 0.1 mg/L for OC, TY, PU, CA, HI, AG,
PHE, and SD, 0.2 mg/L for DO, and SE, and 0.3 mg/L for TR and SM.
Linear calibration curve of fluorimetric response for all bio- All DLs and DtLs obtained for each amine were confirmed by the
genic amines and polyamines studied were obtained from 11 points analysis of a standard solution at those level concentrations.
of different concentrations between 0.1 and 50 mg/L. Linearity
of the UHPLC method was verified by analysis of the variance 3.3. Precision
of the regression. Least-squares analysis produced a correlation
coefficient of r ≥ 0.9990 for all biogenic amines and polyamines The precision of the method, in terms of repeatability, was
(p < 0.001). The coefficient of determination (r2 ) was higher than assessed by carrying out eight independent determinations for
99.8% for all standard curves. each food sample using the same UHPLC conditions (appara-
Table 2
Precision (RSD) and recovery (mean and standard deviation) of the UPLC method for the determination of octopamine (OC), dopamine (DO), tyramine (TY), putrescine (PU),
serotonine (SE), cadaverine (CA), histamine (HI), agmatine (AG), phenylethylamine (PHE), spermidine (SD), tryptamine (TR) and spermine (SM) in fish.
Initial content Content after RSDc (%) RSDHd (%) Recovery (%) Content after RSD (%) RSDH (%) Recovery (%) Cochran’s
(mg/kg) addition (mg/kg) addition (mg/kg) teste Cexp
OC ndf 23.68 2.25 4.97 94.73 (2.13) 46.83 1.17 4.48 93.65 (1.10) 0.79
DO nd 24.10 1.61 4.96 96.40 (1.56) 47.76 1.36 4.47 95.51 (1.30) 0.59
TY nd 23.89 2.09 4.96 95.58 (2.00) 47.53 1.17 4.47 95.06 (1.11) 0.76
PU 1.03 25.29 1.70 4.92 97.16 (1.65) 48.96 0.82 4.45 95.96 (0.79) 0.81
SE nd 21.71 1.87 5.03 86.83 (1.62) 41.84 2.69 4.56 83.68 (2.25) 0.66
CA nd 24.23 1.69 4.95 96.90 (1.64) 48.05 1.48 4.47 96.10 (1.42) 0.57
HI nd 23.56 1.27 4.97 94.23 (1.20) 46.66 1.69 4.49 93.31 (1.58) 0.64
AG nd 23.23 2.07 4.98 92.91 (1.92) 46.61 1.64 4.49 93.23 (1.53) 0.61
PHE nd 22.84 1.69 5.00 91.38 (1.55) 46.06 1.70 4.49 92.13 (1.57) 0.51
SD 3.34 28.00 2.20 4.84 98.81 (2.18) 52.32 1.79 4.41 98.09 (1.76) 0.60
TR nd 21.08 2.56 5.06 84.30 (2.16) 43.21 2.73 4.54 86.43 (2.36) 0.54
SM 6.16 27.40 2.33 4.86 87.93 (2.05) 49.87 1.97 4.44 88.80 (1.75) 0.58
a
25 mg/kg of each amine.
b
50 mg/kg of each amine.
c
RDS, relative standard deviation for the eight determinations.
d
RDSH, upper limit of the acceptable range for relative standard deviations according to Horwitz’s formula for intra-laboratory study (1/2 of the interlaboratory study
calculate by the formula).
e
Cochran test, Ctab (7, 2, 0.05) = 0.8332.
f
Not detected.
M.L. Latorre-Moratalla et al. / J. Chromatogr. A 1216 (2009) 7715–7720 7719
Table 3
Precision (RSD) and recovery (mean and standard deviation) of the UPLC method for the determination of octopamine (OC), dopamine (DO), tyramine (TY), putrescine (PU),
serotonine (SE), cadaverine (CA), histamine (HI), agmatine (AG), phenylethylamine (PHE), spermidine (SD), tryptamine (TR) and spermine (SM) in cheese.
Initial content Content after RSDc (%) RSDHd (%) Recovery (%) Content after RSD (%) RSDH (%) Recovery (%) Cochran’s
(mg/kg) addition addition teste Cexp
(mg/kg) (mg/Kg)
OC ndf 23.76 1.04 4.97 94.11 (0.59) 45.60 2.02 4.50 92.06 (1.22) 0.81
DO 8.52 33.60 1.69 4.71 100.14 (1.83) 58.56 2.65 4.34 100.08 (2.65) 0.68
TY 10.02 32.92 2.87 4.73 94.30 (2.64) 56.56 1.66 4.36 91.98 (3.46) 0.63
PU nqg 22.60 2.70 5.00 90.40 (2.44) 43.59 2.79 4.53 88.60 (1.58) 0.71
SE nd 20.31 1.44 5.08 81.25 (1.17) 39.55 3.12 4.61 79.10 (2.43) 0.81
CA 9.89 33.49 2.98 4.72 94.41 (2.22) 64.62 1.59 4.27 92.46 (1.47) 0.69
HI 2.19 24.38 2.78 4.95 91.45 (1.54) 45.97 1.39 4.50 88.80 (0.72) 0.82
AG nd 24.98 2.39 4.93 99.92 (2.39) 48.89 2.18 4.45 97.77 (2.13) 0.56
PHE nd 25.75 1.01 4.91 103.00 (1.04) 51.00 1.23 4.43 102.01 (1.26) 0.59
SD 1.24 24.35 1.79 4.95 92.81 (1.66) 48.06 1.99 4.47 93.80 (1.87) 0.56
TR 3.29 28.14 1.42 4.84 99.44 (1.41) 53.57 1.53 4.39 100.53 (1.54) 0.54
SM 0.91 23.40 3.08 4.98 91.47 (2.00) 47.00 3.21 4.48 94.79 (1.96) 0.51
a
25 mg/kg of each amine.
b
50 mg/kg of each amine.
c
RDS, relative standard deviation for the eight determinations.
d
RDSH, upper limit of the acceptable range for relative standard deviations according to Horwitz’s formula for intra-laboratory study (1/2 of the interlaboratory study
calculate by the formula).
e
Cochran test, Ctab (7, 2, 0.05) = 0.8332.
f
Not detected.
g
Not quantified.
tus and reagents). Since none of the food products contained 3.4. Recovery
all analytes, samples were spiked by adding known amounts
of all the biogenic amines and polyamines. To test the preci- The accuracy of the method was tested by the standard addi-
sion at two different concentration levels, known amounts of tion procedure using two addition levels (5 and 10 mg/L for wine,
biologically active amines were added (5 and 10 mg/L in wine and 25 and 50 mg/kg for the solid samples of each amine). Eight
samples, and 25 and 50 mg/kg in the fish, cheese, and dry fer- determinations were carried out for each food sample and each
mented sausage samples). For all the biogenic amines and for addition level (Tables 1–4). The mean recovery of biogenic amines
all the food products, the relative standard deviation (RSD) was and polyamines was greater than 98% (SD = 2.3) for wine, which
always lower than 5% (Tables 1–4 ), which indicates that the was not statistically different from the theoretical value of 100%
method can be carried out with a satisfactory level of precision. The (p > 0.05 according to the Student’s t-test). Recoveries greater than
results are consistent with the Horwitz formula for intra-laboratory 93% were recorded for amines in the solid foods (fish, cheese, and
studies [37]. dry sausage). Cochran’s C-test was used to verify that the variance of
Table 4
Precision (RSD) and recovery (mean and standard deviation) of the UPLC method for the determination of octopamine (OC), dopamine (DO), tyramine (TY), putrescine (PU),
serotonine (SE), cadaverine (CA), histamine (HI), agmatine (AG), phenylethylamine (PHE), spermidine (SD), tryptamine (TR) and spermine (SM) in dry sausage.
OC ndf 21.96 1.69 5.03 87.85 (1.49) 44.74 1.86 4.51 89.48 (1.66) 0.55
DO nd 23.14 2.40 4.99 92.56 (2.22) 48.29 2.72 4.46 95.58 (2.63) 0.58
TY 129.08 153.14 2.14 3.75 99.92 (2.04) 175.23 2.50 3.68 97.85 (2.44) 0.59
PU 98.14 123.44 1.31 3.88 100.24 (1.32) 147.33 2.11 3.77 99.45 (2.09) 0.72
SE nd 21.57 4.69 5.04 86.27 (4.04) 42.31 3.60 4.55 84.63 (3.04) 0.64
CA 28.95 50.34 1.36 4.44 93.32 (1.27) 74.11 2.92 4.18 93.86 (2.74) 0.82
HI nd 23.96 2.59 4.96 95.83 (2.48) 46.73 3.38 4.49 93.45 (3.16) 0.62
AG nd 23.72 2.16 4.97 94.88 (2.05) 46.99 2.62 4.48 93.99 (2.46) 0.59
PHE nd 23.65 1.22 4.97 94.62 (1.15) 47.42 2.84 4.48 94.24 (2.17) 0.78
SD 17.10 40.61 0.98 4.58 96.47 (0.95) 63.98 1.69 4.28 95.35 (1.61) 0.74
TR nd 22.37 2.35 5.01 89.48 (2.10) 43.66 2.24 4.53 87.33 (1.96) 0.54
SM 7.94 30.75 3.36 4.78 93.64 (3.15) 53.78 2.41 4.39 92.99 (2.24) 0.66
a
25 mg/kg of each amine.
b
50 mg/kg of each amine.
c
RDS, relative standard deviation for the eight determinations.
d
RDSH, upper limit of the acceptable range for relative standard deviations according to Horwitz’s formula for intra-laboratory study (1/2 of the interlaboratory study
calculate by the formula).
e
Cochran test, Ctab (7, 2, 0.05) = 0.8332.
f
Not detected.
7720 M.L. Latorre-Moratalla et al. / J. Chromatogr. A 1216 (2009) 7715–7720
recovery values was not dependent on the amine content (addition [3] S.L. Taylor, Crit. Rev. Toxicol. 17 (1996) 91.
level) of the sample (p > 0.05). [4] S. Bardócz, Trends Food Sci. Technol. 6 (1995) 341.
[5] A.R. Shalaby, Food Res. Int. 29 (1996) 675.
[6] L. Maintz, T. Bieber, N. Novak, Dtsch Arztebl 103 (2006) 51.
3.5. Lack of interferences [7] A. Halász, A. Baráth, L. Simon-Sarkadi, W. Holzapfel, Trends Food Sci. Technol.
5 (1994) 42.
[8] T. Hernández-Jover, M. Izquierdo-Pulido, M.T. Veciana-Nogués, A. Marine-Font,
To verify the lack of interferences from amino acids, a stan- M.C. Vidal-Carou, J. Agric. Food Chem. 45 (1997) 2098.
dard solution including all the amino acid precursors of the [9] S. Bover-Cid, T. Hernández-Jover, M.J. Miguélez-Arrizado, M.C. Vidal-Carou, Eur.
studied amines (tyrosine, histidine, tryptophan, lysine, arginine, Food Res. Technol. 216 (2003) 477.
[10] B. Brink, C. Damink, H.M.L.J. Joosten, J.H.J. Huis in’t Veld, Int. J. Food Microbiol.
phenylethylamine, glutamine, and ornithine) was injected using
11 (1990) 73.
the same chromatographic conditions as described above. Due to [11] M.C. Vidal-Carou, M.L. Latorre-Moratalla, S. Bover-Cid, in: L. Nollet, F. Toldrá
their more polar nature, amino acids have a smaller retention (Eds.), Handbook of Processed Meats and Poultry Analysis, Taylor & Francis
Group, Broken Sound Parkway NW, Boca Raton, 2009, p. 665.
time than biogenic amines and elute in the first 30 s of the chro-
[12] A. Önal, Food Chem. 103 (2007) 1475.
matogram. As it has been reported for post-column derivatization [13] A.R. Shalaby, Food Chem. 65 (1999) 117.
procedures [27,38], the proposed method allows avoiding peak [14] J. Lapa-Guimara˜es, J. Pickova, J. Chromatogr. A 1045 (2004) 223.
interferences. [15] P.L. Rogers, W. Staruszkiewicz, J. AOAC Int. 80 (1997) 591.
[16] J. Kirschbaum, K. Rebscher, H. Brückner, J. Chromatogr. A 881 (2000) 517.
[17] Z. Loukou, A. Zotou, J. Chromatogr. A 996 (2003) 103.
4. Conclusion [18] E. Anli, N. Vural, S. Yilmaz, H. Vural, J. Food Compos. Anal. 17 (2004) 53.
[19] A. Macorbal, M.C. Polo, P.J. Martín-Alvarez, M.V. Moreno-Arribas, Food Res. Int.
38 (2005) 387.
The UHPLC method described is a reliable procedure to deter- [20] T. Lavizzari, M.T. Veciana-Nogués, S. Bover-Cid, A. Mariné-Font, M.C. Vidal-
mine 12 biogenic amines and polyamines in different food types Carou, J. Chromatogr. A 1129 (2006) 67.
in less than 7 min of chromatographic elution, showing a satisfac- [21] E.H. Soufleros, E. Bouloumpasi, A. Zotou, Z. Loukou, Food Chem. 101 (2007)
704.
tory linearity, sensitivity, precision, and accuracy irrespective of the [22] Y. Yang, C. Hodges, Separation Science Redefined (Special Issues of LC–GC N.
food matrix. The shortening of the run time was between 5-fold and Am.), May 2005.
11-fold less in comparison with the conventional existing HPLC [23] J.W. Thompson, J.S. Mellors, J.W. Eschelbach, J.W. Jorgerson, LC–GC Eur. 24
(2006) 16.
methods. This allows the analysis of a large number of samples [24] M. Swartz, Separation Science Redefined (Special Issues of LC–GC N. Am.), May
spending not only less time but also less solvent volumes, which 2005.
is in agreement with environmental sustainability criteria. To our [25] D.T.T. Nguyen, D. Guillarme, S. Rudaz, J.L. Veuthey, J. Sep. Sci. 29 (2006) 1836.
[26] E. Dadáková, M. Křížek, T. Pelikánová, Food Chem. 116 (2009) 365.
knowledge, this is the first UHPLC procedure with OPA post-column
[27] M.T. Veciana-Nogués, T. Hernández-Jover, A. Mariné-Font, M.C. Vidal-Carou, J.
derivatization and fluorescence detection proposed to determine AOAC Int. 78 (1995) 1045.
biogenic amines and polyamines in food. [28] T. Hernández-Jover, M. Izquierdo-Pulido, M.T. Veciana-Nogués, M.C. Vidal-
Carou, J. Agric. Food Chem. 44 (1996) 2710.
[29] S. Novella-Rodríguez, M.T. Vecina-Nogués, M.C. Vidal-Carou, J. Agric. Food.
Acknowledgements Chem. 48 (2000) 5117.
[30] M.C. Vidal-Carou, F. Lahoz-Portoles, S. Bover-Cid, A. Marine-Font, J. Chromatogr.
A 998 (2003) 235.
The authors would like to thank Direcció General de Recerca of
[31] V. del Petre, A. Costantini, F. Cecchini, M. Morassut, E. García-Moruno, Food
the Generalitat de Catalunya (2008-00668 SGR) for their support Chem. 112 (2009) 474.
and also the funding support from the Instituto Danone. [32] N. Innocente, M. Biasutti, M. Padovese, S. Moret, Food Chem. 101 (2007) 1285.
[33] Á Körös, Z. Varga, I. Molnár-Perl, J. Chromatogr. A 1203 (2008) 146.
[34] S. Moret, L. Conte, J. Chromatogr. A 729 (1996) 363.
References [35] G. Saccani, E. Tanzi, P. Pastore, S. Cavalli, M. Rey, J. Chromatogr. A 1082 (2005)
43.
[1] P. Kalac, P. Krausová, Food Chem. 90 (2005) 219. [36] M. Thompson, S. Ellison, R. Wood, Pure Appl. Chem. 74 (2002) 835.
[2] M.C. Vidal-Carou, M.T. Veciana-Nogués, M.L. Latorre-Moratalla, S. Bover-Cid, in: [37] W. Horwitz, Anal. Chem. 4 (1982) 67.
F. Toldrà (Ed.), Handbook of Fermented Meat and Poultry, Blackwell Publishing, [38] M. Izquierdo-Pulido, M.C. Vidal-Carou, A. Mariné-Font, J. AOAC Int. 76 (1993)
Ames, Iowa, 2007, p. 455. 1027.
RESULTADOS
Comunicación escrita.
M.L. Latorre-Moratalla, J. Bosch-Fusté, T. Lavizzari, S. Bover-Cid, M.T. Veciana-Nogués,
M.C. Vidal-Carou. Determinación de aminas biológicamente activas en alimentos por
cromatografía de ultra alta eficacia (UPLC). V Congreso Internacional de Ciencia y
Tecnología de los Alimentos. Murcia, 26-29 de Mayo de 2009.
249
Determinación de aminas biologicamente activas en alimentos
por cromatografía de ultra alta eficacia (UPLC).
M.L. Latorre Moratalla1, J. Bosch Fusté, S. Bover Cid2, T. Lavizzari, T. Veciana Nogués1 and M.C. Vidal Carou1
1Departament de Nutrición y Bromatología, Universitat de Barcelona. Av. Joan XXIII s/n, 08028 Barcelona, España.
2IRTA, Finca Granja Camps i Armet, E-17121 Monells, España.
INTRODUCCIÓN OBJETIVOS
Las aminas biológicamente activas incluyen las llamadas aminas biógenas (histamina,
Desarrollar un método de UPLC rápido,
tiramina…) y las poliaminas (espermidina y espermina). Aunque, estos compuestos se han
preciso y versátil para la determinación de
estudiado en muchos tipos de alimentos [1], su análisis no es un procedimiento simple debido 12 aminas biógenas y poliaminas en
a sus diferentes estructuras químicas, a las diferentes concentraciones en las que pueden diferentes tipos de alimentos.
estar presentes y a la complejidad de la matriz alimentaria. La cromatografía líquida de ultra
alta eficacia (UPLC) es una nueva técnica de cromatográfica, que en comparación con la Evaluar la fiabilidad del método así como
comprobar su efectividad (versatilidad) para
cromatografía líquida de alta eficacia convencional, es capaz de trabajar a presiones de hasta
diferentes matrices alimentarias.
15.000 psi., permitiendo una drástica reducción del tiempo de análisis, al igual que un
aumento de la resolución y la sensibilidad [2].
RESULTADOS
Las condiciones cromatográficas y el gradiente de elución linear El método mostró una satisfactoria linealidad (coeficiente de
obtenidos tras el desarrollo del método se detallan en la Tabla 1. correlación de r≥0.9990) y sensibilidad (límite de detección <0.2 mg/L y
de determinación <0,3 mg/L) para todas las aminas. La precisión,
fase móvil: 0.8 ml/min Tiempo Fase A Fase B
evaluada en términos de repetitividad y expresada como desviación
Eluyente A : (solución acuosa con (min) (%) (%) estándar relativa (DSR) y la exactitud o recuperación del método
octanosulfonato sódico, pH 4.8) 0:00 80 20 obtenidas para los diferentes alimentos estudiados se muestran en la
Eluyente B: (eluyente A : acetonitrilo (6.6:3.4),
2:00 80 20 Tabla 2. La DSR fue en todos los casos inferior al 5% indicando un
pH 4.5).
3:00 60 40
buen nivel de precisión del método y siendo estos resultados
Derivatización post-columna: 0.4 ml/min 4:00 50 50
5:00 40 60
coherentes con la fórmula de Horwitz para estudios interlaboratorio [4].
reactivo de derivatización: o-oftaldehido
6:00 20 80 La recuperación media de todas las aminas biológicamente activas fue
Detección fluorimétrica: 6:40 80 20 superior al 98% en el vino y al 93% en el resto de los alimentos.
λ excitación: 340 nm y λ emisión: 445 nm.
7:00 80 20
Vino Pescado Queso Embutido
DSR (%) Rec. (%) DSR (%) Rec. (%) DSR (%) Rec. (%) DSR (%) Rec. (%)
Tabla 1. Condiciones cromatográficas y gradiente de elución del
método UPLC descrito. OC 2,86 96,89 1,71 94,19 1,53 93,09 1,78 88,67
DO 2,07 99,34 1,49 95,96 2,17 100,11 2,56 94,07
El método de UPLC descrito permitió determinar 12 aminas TI 2,10 100,75 1,63 95,32 2,27 93,14 2,32 98,89
biógenas y poliaminas en menos de 7 minutos de elución PU 3,10 97,49 1,26 96,56 2,75 89,50 1,71 99,85
cromatográfica (Figura 2). Este método permitió la reducción del SE 3,09 100,78 2,28 85,26 2,28 80,18 4,15 85,45
tiempo de análisis de entre 6 y 10 veces en comparación con otros
CA 2,96 101,76 1,59 96,50 2,29 93,44 2,14 93,59
métodos de HPLC existentes. Esto, permite el análisis de un gran
HI 3,11 95,47 1,48 93,77 2,09 90,13 2,99 94,64
número de muestras no sólo en menos tiempo, sino con un menor
AG 2,67 97,92 1,86 93,07 2,29 98,85 2,39 94,44
gasto en solventes cumpliendo así con los actuales criterios de
FE 2,34 102,12 1,70 91,76 1,12 102,51 2,03 94,43
sostenibilidad ambiental.
SD 2,54 99,99 2,00 98,45 1,89 93,31 1,34 95,91
TR 2,89 97,11 2,65 85,37 1,48 99,99 2,30 88,41
PU
SM 1,84 99,42 2,15 88,37 3,15 93,13 2,89 93,32
SD
Tabla2. Precisión (DSR) y recuperación (Rec.) de las 12 aminas en los diferentes alimentos
CA
evaluados. El test de Chochran verificó que la precisión y la recuperación obtenida no
depende del nivel de aminas adicionado en la muestra, por lo que la tabla presenta el valor
HI medio resultante de dos niveles de adición .
OC AG SM
FE
TI TR
CONCLUSIÓN
DO SE
En conclusión, el método de UPLC descrito es un procedimiento
fiable para la determinación de 12 aminas biológicamente
0.00
0.00 0.50 1.00
1.00 1.50 2.00
2.00 2.50 3.00
3.00 3.50 4.00
4.00 4.50 5.00
5.00 5.50 6.00
6.00 6.50 7.00
7.00
activas en menos de 7 minutos de elución cromatográfica,
Minutes
Minutes mostrando una satisfactoria linealidad, sensibilidad, precisión y
Figura 2. Cromatograma de una solución patrón de 25 mg /kg de aminas biógenas y poliaminas.
OC: octopamina; DO: dopamina; TI: tiramina; PU: putrescina; SE: serotonina; CA: cadaverina; HI:
exactitud independientemente de la matriz alimentaria
histamina; AG: agmatina; FE: feniletilamina; SD: espermidina; TR: triptamina; SM: espermina considerada.
Bibliografía Agradecimientos
[1] Shalaby (1996) Food Res Int 29, 675- 690. [2] Ying Yang y col. (2005). Sep Sci. Los.autores agradecen al Ministerio de ……. Y al Instituto Danone por la financiación concedida
Redefined, 31-35. [3] Thompson y col., (2002) Pure Appl. Chem, 74, 835-855. [4] Horwitz,
(1982). Anal. Chem. 4, 67.
RESULTADOS
Artículo XI.
M.L. Latorre-Moratalla, S.Bover-Cid, M.T. Veciana-Nogués, M.C. Vidal-Carou.(2009). Thin-
layer chromatography for the identification and semi-quantification of biogenic amines
produced by bacteria. Journal of Chromatography A, 1216: 4129-4132.
Comunicación escrita.
M.L. Latorre-Moratalla, S. Bover-Cid, M.T. Veciana-Nogués, M.C. Vidal-Carou. Thin layer
chromatography for the identification and semi-quantification of bacterial amino acid
decarboxylase activity. 12as Jornadas de Análisis Instrumental. Barcelona, 21-23 de Octubre
de 2008.
253
DESARROLLO Y VALIDACIÓN DE MÉTODOS
254
RESULTADOS
10.2.3 Resultados
Las aminas dansiladas se aplican en una placa cromatográfica de sílica gel que
se introduce en una cámara o jarra cromatográfica con la fase móvil o solvente de
elución. Se evaluaron un total de 5 condiciones cromatográficas y se seleccionó la fase
móvil descrita por Lapa-Guimarães y col. (2004), compuesta por cloroformo, dietiléter
y trietilamina, en una proporción de 4:1:1. Cuando el solvente de elución recorre una
255
DESARROLLO Y VALIDACIÓN DE MÉTODOS
256
RESULTADOS
Para comprobar la fiabilidad del método, los resultados de CCF de las aminas
producidas por 20 cepas de microorganismos se compararon con los obtenidos por el
método de HPLC de referencia (Hernández-Jover y col., 1996, descrito en el apartado
5.3 de la sección Material y Métodos). Según el test estadístico χ2 (Chi cuadrado), no
existen diferencias significativas entre los niveles de semi-cuantificación establecidos.
257
DESARROLLO Y VALIDACIÓN DE MÉTODOS
258
RESULTADOS
Artículo XI.
M.L. Latorre-Moratalla, S.Bover-Cid, M.T. Veciana-Nogués, M.C. Vidal-Carou.(2009).
Thin-layer chromatography for the identification and semi-quantification of
biogenic amines produced by bacteria. Journal of Chromatography A, 1216: 4129-
4132.
Índice de impacto (JCR 2008): 3,576
Posición en el área “Analytical Chemistry”: 6/70
259
Journal of Chromatography A, 1216 (2009) 4128–4132
Journal of Chromatography A
journal homepage: www.elsevier.com/locate/chroma
Short communication
a r t i c l e i n f o a b s t r a c t
Article history: The screening TLC method described enables the simultaneous identification and semi-quantification of
Received 20 November 2008 eight biogenic amines with a large number of samples handled in a short period of time. The dansyla-
Received in revised form 2 February 2009 tion process time was drastically reduced from 80 to 18 min by increasing the reaction temperature to
Accepted 16 February 2009
100 ◦ C. Bacteria could be classified as no, low, moderate or powerful amine producers when no spots were
Available online 21 February 2009
noticeable in TLC plates, less than 50 mg/L, from 50 to 500 mg/L, or more than 500 mg/L of amines were
present in the decarboxylase broth medium, respectively. This TLC method is a simpler, faster and less
Keywords:
expensive alternative to other methods, such as differential culture media, HPLC and even more sensitive
Thin-layer chromatography
Biogenic amines
than other TLC procedures.
Amino acid decarboxylase activity © 2009 Elsevier B.V. All rights reserved.
Dansyl chloride
0021-9673/$ – see front matter © 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.chroma.2009.02.045
M.L. Latorre-Moratalla et al. / J. Chromatogr. A 1216 (2009) 4128–4132 4129
(AG) sulfate, spermine (SM) tetrahydrochloride and spermidine 2.5. Solvent system
(SD) trihydrochloride), at 1000 mg/L in 5% trichloroacetic acid
(TCA). Working standards with all BAs were prepared by diluting Several solvent systems (A–F) were assessed to select the most
the stock solution in 5% TCA. Standards were refrigerated protected suitable for the simultaneous resolution of nine BAs (Table 1).
from light until required. Among solvent systems applied by Lapa-Guimarães et al. [18] to
separate BAs from seafood, two solvent systems were assayed: (A)
2.2. Assessment of amino acid decarboxylase capability of single development with chloroform–diethyl ether–triethylamine
bacterial strains (4:1:1) and (B) double developments using chloroform–diethyl
ether–triethylamine (6:4:1) and chloroform–triethylamine
The microorganisms tested included Lactobacillus curvatus, Lac- (6:1). To improve the chromatographic resolution some
tobacillus brevis, Staphylococcus xylosus, Staphylococcus carnosus, modifications were considered: (C) chloroform–diethyl
Enterococcus faecium, Enterobacter cloacae and Klebsiela oxytoca ether–triethylamine (5:1:1), which higher chloroform propor-
isolated from fermented sausages. Some of these strains showed tion decreased the solvent polarity, (D) chloroform–diethyl
decarboxylase activity under in vitro conditions, producing TY, PU, ether–triethylamine (4:2:1), which also reduced solvent polarity,
CA, HI and/or PHE, whereas others did not. (E) chloroform–diethyl ether–triethylamine (3:1:1), to reduce
To promote enzyme induction [7], strains were subcultured environmental residues by diminishing the chloroform proportion
four times in de Man, Rogosa and Sharpe Broth (MRS broth) for and (F) dichloromethane–diethyl ether–triethylamine (4:1:1), to
lactic acid bacteria and in tryptic soy broth (TSB broth) for staphy- diminish the toxicity by avoiding chloroform.
lococci and enterobacteria containing 0.1% of the corresponding
amino acid precursor (l-tyrosine free base; l-histidine monochloro- 2.6. Validation of the TLC method
hydrate; l-ornithine monochlorohydrate; l-triptophan; l-lysine
monochlorohydrate; l-phenylalanine; l-arginine) at 30 ◦ C for 24 h. The repeatability of chromatographic separation was studied by
Afterwards, bacterial strains were placed in a decarboxylase running different concentrations of standards (from 5 to 50 mg/L)
medium described by Bover-Cid and Holzapfel [7], and incubated in triplicate using the selected solvent system. Since the procedure
aerobically at 30 ◦ C for 4 days. is a semi-quantitative method, repeatability could not be expressed
After incubation, 2 mL of decarboxylase broth were centrifuged in terms of amine concentration.
(6720 × g/10 min) for cell precipitation. For the HPLC analysis, 1 mL To determine the sensitivity, standard solutions of decreasing
of 0.6 M perchloric acid was added to 1 mL of supernatant to concentrations (from 500 to 0.5 mg/L) were ran. The detection limit
precipitate proteins, centrifuged (6720 × g/10 min) and the super- was measured in terms of the minimum fluorescence intensity of
natant was filtered through 0.45 mm. For the TLC analysis, the dansyl amines needed for noticeable visualization at 366 nm.
culture supernatant was diluted 10-fold (200 mL/2 mL) to reduce To check the selectivity, potential interference from Dns-Cl and
the proportion of decarboxylase medium and minimize interfer- the matrix (decarboxylase medium) were evaluated. Samples of
ences during the derivatization. decarboxylase medium, containing the precursor amino acids, and
BA standards were used.
To accelerate the derivatization process some modifications in BAs were analyzed from samples by ion-pair reverse-phase
the conditions (110 ◦ C during 10 min) of Meseguer-Lloret et al. [17] HPLC (Waters, Milford, MA, USA) according to Hernández-Jover et
were assessed and compared with that reported by Lapa-Guimarães al. [16] and successfully applied to determine BA production by
et al. [18] (at 40 ◦ C for 60 min plus 20 min after the addition of microorganisms [7]. This method applies a post-column deriva-
glycine to react with residual Dns-Cl). Other temperatures and tization with o-phthalaldehyde/2-mercaptoethanol, followed by
times, from 40 to 100 ◦ C and from 45 to 5 min, were also assessed a spectrofluorometric detection (excitation and emission wave-
and 100 ◦ C for 12 min plus 6 min after the glycine addition were lengths of 340 and 445 nm, respectively).
chosen as the optimal. The thermostability of BAs at 100 ◦ C was
checked previously. During this procedure, light exposure was min- 2.8. Statistical analysis
imized.
Concordance between the TLC and HPLC results was tested by
2.4. Separation of dansyl amines by TLC the, Chi-square test using the SPSS 14.0 (Statistical Software Package
for Windows, Chicago, IL, USA).
The TLC glass plates were 20 cm × 20 cm, precoated with
0.25 mm of silica gel G60 (Merk, Darmstadt, Germany); they were 3. Results and discussion
activated at 100 ◦ C for 1 h. A 10-ml volume of ethyl acetate extract
of dansylated amines was applied at 2 cm from the plate base edge 3.1. BA dansylation optimization
at 1 cm intervals.
The developing chamber was loaded with 100 mL of the sol- Fig. 1 shows the BA standards derivatized at 100 and 50 ◦ C. No
vent system previously equilibrated with a saturation pad. When significant differences in the size or intensity of spots were found
the solvent reached the distance from the start position (10–17 cm, between the dansylation processes assayed. High temperatures
depending on the type of development tested), the plate was (100 ◦ C) allowed a 4-fold reduction in the reaction time from the
removed from the chamber, dried, and separated spots were viewed original 80 min [18] to 18 min (12 min plus 6 min after the glycine
under a UV lamp at 366 nm. To identify each BA, the retention factor addition), allowing a higher number of possible analyses per day.
(RF ) was determined and compared with the RF of a standard, being
the fluorescence and colour also useful to locate the amines on the 3.2. Solvent system selection
plate. The RF is defined as the distance traveled by the compound
divided by the distance traveled by the solvent. The size and light Table 1 shows the BA RF values using the solvent systems
intensity of the spots allowed semi-quantification. assayed. Systems A and B allowed a good resolution of all BA,
4130 M.L. Latorre-Moratalla et al. / J. Chromatogr. A 1216 (2009) 4128–4132
Table 1
RF values and fluorescent colour response of each biogenic amine using the different solvent systems.
A B C D E F
although PU and TRY remained quite close. The rest of the systems detection limit obtained for all BAs using the proposed method was
did not significantly improve PU and TRY separation, rather they similar to those obtained by Lapa-Guimarães et al. [18] for seafood.
negatively affected the resolution of other BAs. Therefore solvent The method showed good selectivity since no significant inter-
system A was chosen as the simplest and quickest. Fig. 2 shows ference appeared. The use of glycine, which reacts with Dns-Cl
the separation of standard solutions of each BA and a mixture of residue, allowed a BA determination free from this interference [18].
all, using solvent system A, obtaining the following BA order: AG, Likewise, there was no interference from amino acids in the decar-
PU, TRP, CA, SD, HI, SM, TY and PHE. The BAs were well resolved boxylase medium, since they had a smaller RF than the BAs due to
without tail formation in any spot. Despite PU and TRP appeared so their high polar nature.
close, they could be clearly distinguished in the eluted TLC plates.
AG was separated from the rest, but its permanent position at the
3.4. Semi-quantification of BAs produced by microorganisms
start makes difficult its semi-quantification.
Different bacterial strains with known decarboxylase activity
3.3. TLC method validation were used to evaluate the TLC method described above. To estab-
lish whether the method is useful for semi-quantitative purposes,
Satisfactory chromatographic separation repeatability was the size and fluorescent intensity of the spots of different standards
obtained as shown by the fairly constant RF . The RF variation coeffi- were considered. This TLC method allows amino acid decarboxylase
cients was 2.4% in average, PHE being the least variable (0.7%) and positive bacteria to be identified and classified as low BA producers,
HI the most (4.2%). RF repeatability was compromised by the evapo- if the size and intensity of the spot was similar or lower than that of
ration of solvents over time, modifying the separation of the spots. the 5 mg/L standard; moderate producers, when the size and inten-
This could be a problem especially for PU and TRP. Thus, mobile sity was similar to the 25 mg/L standard, and powerful producers if
phases must be renewed when RF values deviate from the calculated the resulting spot was similar or higher than the 50 mg/L standard.
variation coefficients. Taking into account the sample dilution during acid extraction of
The detection limit was 10 ng (1 mg/L per 10 mL spotted) for all the culture media, the actual amount in the samples were 10-fold
BAs, which improves by 10- to 1000-fold the sensitivity reported by
García-Moruno et al. [10] method applied to bacterial cultures. The
Fig. 2. TLC development and separation of BAs (20 mg/L) using the solvent system
Fig. 1. TLC development of biogenic amine standards dansylated at 50 ◦ C (A) and chloroform–diethyl ether–triethylamine (4:1:1), agmatine (AG), putrescine (PU),
100 ◦ C (B). PU: putrescine; TRP: tryptamine; CA: cadaverine; SD: spermidine; HI: tryptamine (TRP), cadaverine (CA), spermidine (SD), histamine (HI), spermine (SM),
histamine; SM: spermine; TY: tyramine; PHE: phenylethylamine. tyramine (TY) and phenylethylamine (PHE).
M.L. Latorre-Moratalla et al. / J. Chromatogr. A 1216 (2009) 4128–4132 4131
Table 2
Biogenic amine production of different strains of enterococci determined by TLC (+++: ≥500 mg/L; ++: 50–500 mg/L; +: ≤50 mg/L; −: negative) and HPLC (mg/L) methods.
Strain TY PHE PU CA HI
TLC HPLC TLC HPLC TLC HPLC TLC HPLC TLC HPLC
EF1 + 25.12 − − − − − − − −
EF2 +++ 1633.8 ++ 297.7 − − − − − −
EF3 +++ 1595.1 ++ 206.7 − − − − − −
EF4 +++ 1007.6 ++ 169.0 − − − − − −
EF5 +++ 963.3 ++ 235.1 − − − − − −
EF6 +++ 1380.3 ++ 377.9 − − − − − −
EF7 +++ 2235.2 ++ 645.0 − − − − − −
EF8 +++ 687.2 ++ 297.9 − − − − − −
EF9 +++ 1376.9 ++ 270.2 − − − − − −
EF10 − − − − − − − − − −
EF11 +++ 2281.7 +++ 716.1 − − − − − −
EF12 − − − − − − − − − −
EF13 +++ 1323.9 − − − − − − − −
EF14 +++ 1146.8 ++ 406.1 − − − − − −
EF15 +++ 1452.9 − − − − − − − −
EF16 − − − − − − − − − −
EF17 ++ 562.2 + 28.1 − − − − − −
EF18 +++ 1669.9 − − − − − − − −
EF19 ++ 632.75 + 22.3 − − − − − −
EF20 − − − − − − − − − −
LC +++ 2561.65 ++ 175.51 +++ 1673.6 + 20.79 − −
LB ++ 169.47 + 11.28 − − − − − −
SX − − − − +++ 430 ++ 140 − −
SC − − ++ 160.50 − − − − − −
EC − − − − +++ 568 +++ 755 + 29
KO − − − − − − +++ 683 + 39
TY: tyramine; PHE: phenylethylamine; PU: putrescine; CA: cadaverine; HI: histamine; LC: Lactobacillus curvatus, LB: Lactobacillus brevis; EF: Enterococcus faecium; SX:
Staphylococcus xylosus; SC: Staphylococcus carnosus; EC: Enterobacter Cloacae; KO: Klebsiela oxytoca.
References [9] L. Actis, J. Smoot, C. Barancin, R. Findlay, J. Microbiol. Methods 39 (1999) 79.
[10] E. Garcia-Moruno, A.V. Carrascosa, R. Munoz, J. Food Protect. 68 (2005) 625.
[1] G. Suzzi, F. Gardini, Int. J. Food Microbiol. 88 (2003) 41. [11] A.R. Shalaby, Food Chem. 65 (1999) 117.
[2] M.L. Latorre-Moratalla, T. Veciana-Nogués, S. Bover-Cid, M. Garriga, T. Aymerich, [12] R. Shakila, T.S. Vasundhara, K.V. Kumudavally, Food Chem. 75 (2001) 255.
E. Zanardi, A. Ianieri, M.J. Fraqueza, L. Patarata, E.H. Drosinos, A. Laukova, R. [13] J. Valls, R. Bello, M. Kodaira, J. Food Qual. 25 (2002) 165.
Talon, M.C. Vidal-Carou, Food Chem. 107 (2008) 912. [14] J. Rosier, C. Peteghem, Z. Lebensm. Unters. Forsch. 186 (1988) 25.
[3] A. Marcobal, B. de las Rivas, R. Muñoz, JVL 1 (2006) 187. [15] A.R. Shalaby, Food Chem. 49 (1994) 305.
[4] C.M. Chen, C.I. Wie, J.A. Koburger, M.R. Marshall, J. Food Protect. 54 (1989) 808. [16] T. Hernández-Jover, M. Izquierdo-Pulido, M.T. Veciana-Nogués, M.C. Vidal-
[5] R. Maijala, S. Enrola, Meat Sci. 35 (1993) 387. Carou, J. Agric. Food Chem. 44 (1996) 2710.
[6] A.R. Roig-Sagués, S. Eerola, Food Res. Technol. 205 (1997) 227. [17] S. Meseguer-Lloret, C. Molins-Legua, J. Verdú-Andres, P. Campíns-Falcó, J. Chro-
[7] S. Bover-Cid, W.H. Holzapfel, Int. J. Food Microbiol. 53 (1999) 33. matogr. A 1035 (2004) 75.
[8] C. Barancin, J. Smoot, R. Findlay, L. Actis, Plasmid 39 (1998) 235. [18] J. Lapa-Guimara˜es, J. Pickova, J. Chromatogr. A 1045 (2004) 223.
RESULTADOS
Comunicación escrita.
M.L. Latorre-Moratalla, S. Bover-Cid, M.T. Veciana-Nogués, M.C. Vidal-Carou. Thin layer
chromatography for the identification and semi-quantification of bacterial amino acid
decarboxylase activity. 12as Jornadas de Análisis Instrumental. Barcelona, 21-23 de Octubre de
2008.
267
Thin-Layer Chromatography for the identification and
Thin-
Semi--Quantification of bacterial Amino Acid Decarboxylase Activity
Semi
M. Luz Latorre Moratalla, Sara Bover Cid, Teresa Veciana Nogués and M. Carmen Vidal Carou
1Department de Nutrition and Food Science, Faculty of Pharmacy, Universitat de Barcelona. Av. Joan XXIII s/n, E08028 Barcelona, Spain.
2IRTA, Finca Granja Camps i Armet, E-17121 Monells, Spain.
OBJECTIVES
INTRODUCTION To develop a screening TLC method to
Most of the existing screening methods to detect positive decarboxylase determinate the BA produced in vitro by
microorganism are based on a suitable culture medium for biogenic amines (BA) microorganisms which allows handling a large
formation and their subsequent identification and quantification by high performance number of samples in a short time.
liquid chromatography (HPLC). However this technique requires sophisticated equipment To asses the semi quantification of the TLC
method comparing with a usually applied
with a high cost and trained staff that probably surpasses the requirements for a rapid
quantitative HPLC method.
screening analysis. Thin layer chromatography (TLC) is a simple, quick and inexpensive
procedure that could be useful for the analysis of BA formed by bacteria. To identify and to semi quantify BA produced
by different type of bacterial cultures commonly
present in foods by the TLC proposed method.
Retention factor
0.54
a) dansylation process: BA are derivatizated with dansyl chloride using a modification of the
method described by Lapa-Guimarães et al. [1], at 100ºC during a total time of 18 min. 0.42
0.38
b)TLC development: Ten µl of ethyl acetate extract containing the dansyl-amines are applied at 0.30
2cm from the base edge of TLC plate (20 cm x 20 cm precoated with 0.25 mm silica gel G60) in 0.26
5mm bands at 1cm intervals. Developing chamber is loaded with 100mL of the solvent system,
consisting on chloroform, diethyl ether and triethylamine (4:1:1). When the solvent reach the
distance to the front limit (17 cm), the plate is removed from the developing chamber, dried,
and the components are visualized under a UV lamp at 366 nm. To identity each BA from the
0
mixture, the retention factor is determined and compared with the Rf of a standard . The size
AG PU TRP CA SD HI SM TY PHE BA
and the light intensity of the spots allowed the semi quantification.
Microbial strains tested: Lactobacillus curvatus, Lactobacillus brevis, Enterococcus faecium, low BA similar or lower than the
producers <50 mg/L standard of 5 mg/L.
Staphylococcus xylosus, Sthaphylococcus carnosus, Enterobacter cloacae and Klebsiela oxytoca.
moderate BA 50 mg/L - similar to the standard of
producers 500 mg/L 25 mg/L .
Figure 2 shows the TLC identification and semi quantification of BA produced by different type of bacterial strains. The TLC method
is useful to identify the amino acid decarboxylase positive bacteria. For the semi quantification of samples, BA standards are spotted
together with a sample of sterile decarboxylase medium as a blank in order to ensure the lack of interference from the matrix. Table 1
shows the classification of the microorganism by the TLC method, according to the BA accumulated in the decarboxylase medium.
In order to objectively check the reliability of the present TLC method, the
semi quantitative values from the TLC were compared with the quantitative values
PHE
TY provided by a HPLC method as a reference. Several strains, most of them
SM producers of different types of BA and at different concentrations were considered
HI
for the method comparison. The results obtained by the HPLC were, in most of
Biogenic amines
SD
cases, into the range of values obtained by the TLC (Table 2), indicating a good
CA
semi quantification. Moreover, none statistically differences (p>0.05) between
methods for any BA was obtained by a Chi-square test.
TRP
PU
TY PHE PU CA HI
strain TLC HPLC TLC HPLC TLC HPLC TLC HPLC TLC HPLC
LC ≥500 2561.7 50-500 175.5 ≥500 1673.6 <50 20.8 - -
LB ≥500 169.5 <50 11.3 - - - - - -
EF1 <50 27 - - - - - - - -
5 25 50 DC LC LB EF1EF2 EF10 SX SC EC KO
EF2 ≥500 2294 50-500 429 - - - - - -
Standards Bacterial strains
EF3 - - - - - - - - - -
Figure 2 shows the TLC detection of the different BA produced by
each type of bacterial strains: Lactobacillus curvatus (LC), SX - - - - ≥500 1368 ≥500 624 - -
Lactobacillus brevis (LB), Enterococcus faecium (EF1, EF2 and EF10), SC - - 50-500 160.50 - - - - - -
Staphylococcus xylosus (SX), Staphylococcus carnosus (SC),
Enterobacter cloacae (EC) and Klebsiela oxytoca (KO).
EC - - - - ≥500 568 ≥500 755 <50 <50
KO - - - - - - ≥500 683 <50 <50
Table 2. BA production of different strains determined by TLC and HPLC methods
REFERENCES: [1] J. Lapa-Guimarães and J. Pickova, J. Chromatogr A, 1045 (2004), 223. ; [2] T Hernández-Jover, M. Izquierdo-Pulido, M.T. Veciana-Nogués, M.C. Vidal-Carou, J. Agric. Food Chem. 44 (1996), 2710. [3] L. Actis, J.
Smoot, C. Barancin and R. Findlay, J. Microbiol Methods 39 (1999), 79. [4] E. Garcia-Moruno, A.V. Carrascosa and R. Munoz, J. Food Prot 68 (2005), 625.
RESULTADOS
269
DISCUSIÓN GENERAL
11
DISCUSIÓN GENERAL
En este capítulo se presenta una discusión global de los resultados obtenidos
en los diferentes trabajos incluidos en la tesis doctoral, agrupados en bloques
temáticos. En primer lugar se tratan los contenidos de aminas biógenas, los
microorganismos responsables de su formación y los factores que han podido
influenciar en la aminogénesis de los embutidos artesanales europeos. A continuación
se evalúa el posible riesgo para la salud del consumo de estos productos debido a sus
contenidos en aminas biógenas. Finalmente, y después de analizar la significación
higiénica de los contenidos de aminas, se discute la eficacia de las diferentes
estrategias propuestas para reducir la acumulación de aminas biógenas y adaptadas a
este tipo elaboración específica.
271
DISCUSIÓN GENERAL
Discusión General
273
DISCUSIÓN GENERAL
274
DISCUSIÓN GENERAL
2006; Bover-Cid y col., 2001; De las Rivas y col., 2008; Gonzalo de Llano y col., 1998;
Montel y col., 1999; Silla-Santos y col., 1998; Straub y col., 1995).
Las cepas lácticas que mostraron mayor capacidad para formar aminas en los
productos cárnicos fermentados europeos fueron las pertenecientes a las especies de
L. curvatus, L. brevis y E. faecium y E. hirae. Fenotípicamente las cepas de L. brevis y
L. curvatus se asocian con la producción de tiramina y en algunos casos también con la
producción de feniletilamina, triptamina, putrescina y/o cadaverina (Aymerich y col.,
2006; Bover-Cid y col., 1999). Se han identificado ya los genes tirosina-descarboxilasa
(tdc) en varias cepas de L. brevis (Gen Bank accession numbers EF371897.1,
EF371893.1 y AF446085.5) y de L. curvatus (EF371895.1, AJ871286.1, AF354231.1 y
AB086652.1). Del mismo modo, muchas cepas de enterococos aisladas de productos
cárnicos fermentados han sido ampliamente descritos como formadores de aminas,
especialmente de tiramina y feniletilamina (Bover-Cid y col., 2001; Suzzi y Gardini,
2003). En este caso, también se ha aislado e identificado el gen tdc de cepas de las
especies E. faecium (EF371894 y AJ83966) y E. hirae (AY303667). La mayoría de las
cepas aminogénicas de enterococos, no son selectivas para tirosina, sino que también
pueden descarboxilar la fenilalanina (Maijala y Eerola, 1993; Maijala y col., 2006).
275
DISCUSIÓN GENERAL
actividad aminoácido descarboxilasa (Aymerich y col., 2006, Martín y col., 2006), pero
hay excepciones y así, algunos trabajos han descrito un elevado potencial para formar
aminas en cepas concretas de estafilococos (Montel y col., 1999, Silla-Santos, 1998;
Straub y col., 1995). Las cepas de estafilococos aminogénicas presentes en los
embutidos estudiados pertenecían a las especies S. carnosus, S. epidermidis, S. pasteuri
y S. warneri. A pesar de que ninguna de las 17 cepas analizadas de S. xylosus resultó
positiva, en esta especie se ha secuenciado parcialmente el gen que codifica el enzima
tirosina descarboxilasa (Torriani y col., 2008).
276
DISCUSIÓN GENERAL
todas estas variables. Precisamente, esta podría ser una de las razones por las que, en
el estudio presentado en el apartado 6.1, no se encontró una relación
estadísticamente significativa entre la formación de aminas biógenas y los diferentes
parámetros tecnológicos (temperatura y humedad relativa del proceso de elaboración)
y físico-químicos (aw e índice de proteólisis) estudiados en los embutidos artesanales
en función del país de origen. Tampoco Parente y col. (2001) observaron una relación
directa entre el incremento de los contenidos de aminas biógenas en distintos tipos de
embutidos y los diferentes factores o variables relacionados.
277
DISCUSIÓN GENERAL
278
DISCUSIÓN GENERAL
Los resultados de este estudio indican de nuevo que los embutidos elaborados
a temperaturas y humedades relativas más altas acumulan mayores contenidos de
aminas, tanto los fermentados espontáneamente como los inoculados con la cepa
aminogénica, en comparación con los productos elaborados bajo condiciones
típicamente artesanales. Se demuestra por tanto que la temperatura y humedad
relativa elevada favorecen el desarrollo de la microbiota fermentativa y/o estimulan la
actividad aminogénica de los microorganismos aminoácido-descarboxilasa positivos.
Estos resultados concuerdan con los descritos en estudios previos en los que se señala
que la aplicación de temperaturas relativamente elevadas (e.g. 18-26ºC) podrían
favorecer la acción de las enzimas proteolíticas y de las reacciones de descarboxilación
con la consecuente formación de aminas biógenas (Joosten, 1997; Suzzi y Gardini,
2003). Por ejemplo, Masson y col. (1999) demostraron que una misma cepa de
Carnobacterium divergens fue capaz de producir más tiramina a 25ºC que a 15 ºC. En
la mayoría de casos, la influencia de la temperatura se asocia a un mayor crecimiento
bacteriano, lo que conlleva una mayor actividad aminogénica. Sin embargo, en el
presente estudio, los recuentos microbianos fueron muy similares pero la acumulación
de aminas biógenas fue distinta, lo que sugiere que las condiciones del proceso
elevadas favorecieron principalmente la actividad aminogénica de los
microorganismos aminoácido-descarboxilasa positivos.
279
DISCUSIÓN GENERAL
280
DISCUSIÓN GENERAL
281
DISCUSIÓN GENERAL
282
DISCUSIÓN GENERAL
283
DISCUSIÓN GENERAL
producto final. Los grupos A y B (que reúnen más del 60% de los productos analizados)
serían la opción más deseada des del punto de vista higiénico. En estos grupos, los
contenidos totales de aminas fueron desde muy bajos a moderados, siendo en todos
los casos la tiramina la amina mayoritaria, normalmente, seguida por la putrescina. En
estos grupos de embutidos la cadaverina y la histamina fueron prácticamente
inexistentes, lo que indicaría una buena calidad higiénica de las materias primas
utilizadas.
284
DISCUSIÓN GENERAL
las instalaciones y/o utensilios, etc.) (Bover-Cid y col., 2001; Bover-Cid y col., 2003). En
el caso de los embutidos artesanales europeos, sólo 5 de los productos se elaboraron
con materias primas que contenían niveles significativos de aminas biógenas y por
tanto de una baja calidad higiénica. Estos productos quedaron clasificados en los
grupos de peor calidad higiénica (C-E), lo que también confirma que el estado
higiénico-sanitario de las materias primas es un elemento imprescindible, aunque no
suficiente, para obtener productos finales libres o con muy bajos contenidos de aminas
biógenas.
285
DISCUSIÓN GENERAL
Holzapfel, 1999; Bover-Cid y col., 2001; Halász y col., 1994). Una práctica común en la
industria alimentaria para mejorar la calidad higiénica de las materias primas es la
pasteurización y la esterilización de las mismas, al objeto de eliminar la carga
microbiana. Sin embargo, en el caso de los productos cárnicos fermentados, este tipo
de tratamientos no son factibles porque causan un detrimento de las materias primas
y consecuentemente del producto final. La aplicación de otras tecnologías no térmicas,
como el caso de las altas presiones hidrostáticas (APH), se ha planteado como una
alternativa para este propósito. La APH es una de las tecnologías emergentes más
estudiada actualmente, ya que permite inactivar microorganismos con mínimos
cambios nutricionales y sensoriales (Hugas y col., 2002). Hasta el momento, en el
campo de las aminas biógenas, la aplicación de AHP en las materias primas ha sido
únicamente estudiada en la producción de quesos como alternativa a la
pasteurización. En el estudio realizado por Novella-Rodríguez y col. (2002) describen
efectos equivalentes en la reducción de la formación de aminas tras el tratamiento de
materias primas lácteas con APH y con la pasteurización térmica.
286
DISCUSIÓN GENERAL
Como ya se ha concluido en los apartados 6.1 y 9.1 de esta tesis, unas óptimas
condiciones higiénicas son imprescindibles pero no suficientes para reducir la
formación de aminas biógenas, por lo que, en muchas ocasiones puede ser necesaria la
aplicación de otras medidas o estrategias basadas en la tecnología de elaboración.
287
DISCUSIÓN GENERAL
Los cultivos iniciadores autóctonos demostraron ser una buena estrategia para
la reducción de la formación de aminas biógenas en todos los casos estudiados,
aunque no todos los cultivos presentaron la misma eficacia. Las mayores reducciones,
tuvieron lugar mediante la adición de cultivos compuestos por cepas de L. sakei, tanto
solas como en combinación con otras cepas de lactobacilos y/o estafilococos. El efecto
más intenso se detectó sobre todo en la minimización de la acumulación de
cadaverina, con una reducción máxima del 99%. Además, los resultados obtenidos
también demuestran que no sólo son importantes las especies sino la cepa concreta
que forma el cultivo iniciador. Algunas de las cepas utilizadas como cultivos iniciadores
autóctonos ya se habían utilizado con éxito en estudios previos realizados en plantas
piloto, mostrando una adecuada competitividad e implantación en el producto y
consiguiendo reducciones de hasta el 90 % del contenido total de aminas (Hugas y col.,
1995; Bover-Cid y col., 2000; Garriga y col., 2005). Sin embargo, cuando estas mismas
cepas se inoculan en productos elaborados en una planta real de elaboración
288
DISCUSIÓN GENERAL
289
CONCLUSIONES
CONCLUSIONES
291
CONCLUSIONES
12
CONCLUSIONES
293
CONCLUSIONES
294
CONCLUSIONES
295
CONCLUSIONES
296
REFERENCIAS BIBLIOGRÁFICAS
REFERENCIAS BIBLIOGRÁFICAS
297
REFERENCIAS BIBLIOGRÁFICAS
13
REFERENCIAS BIBLIOGRÁFICAS
A
AMON, U., BANGHA, E., KUSTER, T., MENNE, A., VOLLRATH, IB. y GIBBS, BF. (1999).
Enteral histaminosis: Clinical implications. Inflamation Research, 48 (6): 291-295.
ANSORENA, D., MONTEL, MC., ROKKA, M., TALON, R., EEROLA, S., RIZZO, A.,
RAEMAEKERS, M. y DEMEYER, D. (2002).Analysis of biogenic amines in Northern and
Southern European sausages and role of flora in amine production.Meat Science, 61
(2): 141-147.
ASTIASARÁN, I., VILLANUEVA, R., y BELLO, J. (1990). Analysis of proteolysis and protein
insolubility during the manufacture of some varieties of dry sausage.Meat Science,
28: 111-117.
AYGÜN, O., SCHNEIDER, E., SCHEUER, R., USLEBER, E., GAREIS, M. y MARTLBAUER, E.
(1999).Comparison of ELISA and HPLC for the determination of histamine in
cheese.Journal of Agricultural and Food Chemistry, 47(5): 1961–1964.
AYHAN, K., KOLSARICI, N. y ÖZKAN, GA. (1999).The effects a starter culture on the
formation of biogenic amines in Turkish soudjoucks. Meat Science, 53: 183-188.
299
REFERENCIAS BIBLIOGRÁFICAS
AYMERICH, T., MARTÍN, B., GARRIGA, M., VIDAL-CAROU, MC., BOVER-CID, S. y HUGAS,
M. (2006). Safety properties and molecular strain typing of lactic acid bacteria from
slightly fermented sausages. Journal of Applied Microbiology, 100: 40-49.
BARDÓCZ, S. (1995).Polyamines in food and their consequences for food quality and
human health.Trends Food Science and Technology, 6: 341-346.
BERLIN, I., ZIMMER, R., COURNOT, A., PAYAN, C., PEDARRIOSSE, AM. y PUECH, AJ.
(1989). Determination and comparison of the pressor effect of tyramine during long-
term moclobemide and tranylcypromine treatment in healthy volunteers.Clinical
Pharmacology and Therapeutics, 46: 344-351.
BIECK, PR. yANTONIN, KH. (1988). Oral tyramine pressor test and the safety of
monoamine oxidase inhibitor drugs: comparison of brofaromine and
tranylcypromine in healthy subjects. Journal of Clinical Psychopharmacology, 8: 237-
245.
300
REFERENCIAS BIBLIOGRÁFICAS
301
REFERENCIAS BIBLIOGRÁFICAS
BRINK, BT., DAMINK, C., JOOSTEN, H. y HUIS IN’T VELD, J. (1990).Occurrence and
formation of biologically active amines in foods. International Journal of Food
Microbiology, 11: 73-84.
302
REFERENCIAS BIBLIOGRÁFICAS
BUNCIC, S., PAUNOVIC, L., RADISIC, D., VOJINOVIC, G., SMILJANIC, D. y BALTIC, M.
(1993).Effects of gluconodeltalactone and Lactobacillus plantarum on the production
of histamine and tyramine in fermented sausages.International Journal of Food
Microbiology, 17: 303-309.
COCONCELLI, PS. (2007). Starter culture: Bacteria. In F. Todrà, Y.H. Hui, I. Astiasarán,
Wai-Kit Nip, J.G. Sebranek, E.T.F. Silveira, L.H. Stahnke & R. Talon (Eds.), Handbook of
fermented meat and poultry. Oxford, UK: Blackwell Publishing. (pp. 137-146).
303
REFERENCIAS BIBLIOGRÁFICAS
DAS, KC. y MISRA, HP. (2004). Hydroxyl radical scavenging and singlet oxygen
quenching properties of polyamines Molecular Cellular Biochemistry, 262: 127 133
DEMEYER. D., RAEMAEKERS, M., RIZZO, A., HOLCK, A., DE SMEDT, A., TEN BRINK, B.,
HAGEN, B. MONTEL, C., ZANARDI, E., MURBREKK, E., LEROY, F., VANDENDRIESSCHE,
F., LORENTSEN, K., VENEMA, K., SUNESEN, L., STAHNKE, L., DE VUYST, L., TALON, R.
CHIZZOLINI, R. y EEROLA., S. (2000). Control of bioflavour and safety in fermented
sausages: first results of European project. Food Research International, 33: 171-180.
DE LAS RIVAS, B., GONZÁLEZ, R., LANDETE, JM. y MUÑOZ, R. (2008). Characterization of
a second ornithine decarboxylase isolated from Morganella morganii. Journal of
Food Protection, 71: 657-661.
DINGEMANSE, J., WOOD, N., GUENTERT, T., OIE, S., OUWERKERK, M. y AMREIN, R.
(1998).Clinical pharmacology of moclobemide during chronic administration of high
doses to healthy subjects.Psychopharmacology, 140 (2): 164-172.
DRAISCI, R., GIANNETTI, L., BORIA, P., LUCENTINI, L., PALLESCHI, L. y CAVALLI, S.
(1998).Improved ionchromatography-integrated pulsed amperometric detection
method for the evaluation of biogenicamines in food of vegetable or animal origin
and in fermented foods. Journal of Chromatography A, 798(1–2):109–116.
304
REFERENCIAS BIBLIOGRÁFICAS
EEROLA, S., MAIJALA, R., SAGUES, AX., SALMINEN, M. y HIRVI, T. (1996). Biogenic
amines in dry sausages as affected by starter culture and contaminant amine-
positive Lactobacillus. Journal of Food Science, 61 (6): 1243-1246.
EEROLA, S., ROIG-SAGUÉS, AX.y HIRVI TK. (1998). Biogenic amine in Finish dry
sausages. Journal of Food safety,18: 127-138
EKICI, K., SEKEROGLU, R., SANCAK YC. y NOYAN, T. (2004). Note of histamine levels in
Turkish style fermented sausage. Meat Science, 68: 123-125.
305
REFERENCIAS BIBLIOGRÁFICAS
GANGOLLI, SD., BRANDT, PA., FERON, VJ., JANZOWSKY, C., KOEMAN, JH., SPEIJERS,
GJA., SPIEGELHANDLER, B., WALTER, R. y WISHNOW, JS. (1994). Assessment: Nitrate,
nitrite and N-nitroso compunds. European Journal of Pharmacology-Environmental
Toxicology and Pharmacology Section, 292: 1-38.
GARDINI, F., MARTUSCELLI, M., CARUSO, MC., GALGANO, F., CRUDELE, MA., FAVATI,
F., GUERZONI, ME. y SUZZI, G. (2001). Effects of pH, temperature and NaCl
concentration on the growth kinetic, proteolytic activity and biogenic amine
producton of Enterococcus faecalis.International Journal of Food Microbiology, 64:
105-117.
GARDINI, F., MARTUCELLI, M., CRUDELE, MA., PAPARELLA, A. y SUZZI, G. (2002). Use of
staphilococcus xylosus as a starter culture in dried sausages: effect on the biogenic
amine content. Meat Science, 61: 275- 283.
GARRIGA, M., MARCOS, B., MARTÍN, B., VECIANA-NOGUÉS, M.T., BOVER-CID, S.,
HUGAS, S. y AYMERICH, T. (2005). Starter cultures and high pressure processing to
improve the hygiene and safety of slightly fermented sausages. Journal of Food
Protection, 68 (11): 2341-2348.
306
REFERENCIAS BIBLIOGRÁFICAS
HENRY, M. (1960). Dosage biologique de l’histamine dans les aliments. Annales des
Falsifications et de l’Expertise Chimique et Toxicologique, 53: 24-33.
307
REFERENCIAS BIBLIOGRÁFICAS
HONIKEL, K.O. (2007). Principles of curing.In F. Todrà, Y.H. Hui, I. Astiasarán, Wai-Kit
Nip, J.G. Sebranek, E.T.F. Silveira, L.H. Stahnke & R. Talon (Eds.), Handbook of
fermented meat and poultry. Oxford, UK: Blackwell Publishing. (pp. 17-30).
308
REFERENCIAS BIBLIOGRÁFICAS
JANSEN, SC., VAN DUSSELDORP, M., BOTTEMA, KC. y DUBOIS, A. (2003). Intolerance to
dietary biogenic amines: a review. Annals of Allergy and Asthma Immunology,91:
233 40.
309
REFERENCIAS BIBLIOGRÁFICAS
KANNY, G., GRIGNON, G., DAUCA, M., GUEDENET, JC.y MONERET-VAUTRI,N DA.
(1996). Ultrastructural changes in the duodenal mucosa induced by ingested
histamine in patients with chronic urticaria. Allergy, 51: 935-939.
KIM, JH., AHN, HJ., JO, C., PARK, HJ., CHUNG, YJ. y BYUN, MW. (2004). Radiolysis of
biogenic amines in model system by gamma irradiation.Food Control, 15 (5): 405-
408.
KIM, JH., AHN, HJ., LEE, JW., PARK, HJ., RYU, GH., KANG, IJ. y BYUN, MW. (2005).
Effects of gamma irradiation on the biogenic amines in pepperoni with different
packaging conditions.Food Chemistry, 89 (2): 199-205.
KOMPRDA, T., SMELA, D., PECHOVA, P., KALHOTKA, L., STENCL, J. y KLEJDUS, B.
(2004).Effect of starter culture, spice mix and storage time and temperature on
biogenic amine content of dry fermented sausages. Meat Science, 67 (4): 607-616.
310
REFERENCIAS BIBLIOGRÁFICAS
LERKE, PA., PORCUNA, MN. y CHIN, HB. (1983). Screening test for histamine in
fish.Journal of Food Science,48(1): 155–157.
LÜCKE, F.K. Fermented meat products.(1994). Food Research International, 27, 299-07.
311
REFERENCIAS BIBLIOGRÁFICAS
MAIJALA, R. (1993). Formation of histamine and tyramine by some lactic acid bacteria
in MRS-broth and modified decarboxylation agar.Letters of Applied Microbiology, 17:
40-43.
MALE, KB., BOUVRETTE, P., LUONG, JHT. y GIBBS, BF. (1996). Amperometric biosensor
fortotal histamine, putrescine and cadaverine using diamine oxidase.Journal of Food
Science, 61(5): 1012–1016.
312
REFERENCIAS BIBLIOGRÁFICAS
MARTÍN, B., GARRIGA, M., HUGAS, M., BOVER-CID, S., VECIANA-NOGUÉS, MT. y
AYMERICH, T., (2006). Molecular, technological and safety characterization of Gram-
positive catalase-positive cocci from slightly fermented sausages.International
Journal of Food Microbiology, 107:148-158
MC.CABE, BJ. (1986). Dietary tyramine and other pressor amines in MAOI regimens: a
review. Journal of the American Dietetic Association, 86(8): 1059-64.
313
REFERENCIAS BIBLIOGRÁFICAS
PARENTE, E., MARTUSCELLI, M., GARDINI, F., GRIECO, S., CRUDELE, M.A. y SUZZI, G.
(2001). Evolution of microbial populations and biogenic amine production in dry
sausages produced in southern Italy. Journal of Applied Microbiology, 90: 882-891
PATAT, A., BERLIN, I., DURRIEU, G., ARMAND, P., FITOUSSI, S., MOLINIER, P. y CAILLE, P.
(1995) Pressor effect of oral tyramine during treatment with befloxatone, a new
reversible monoamine oxidase-A inhibitor, in healthy subjects.Journal of Clinical
Pharmacology, 35(6): 633-43.
314
REFERENCIAS BIBLIOGRÁFICAS
PEETERS, E.M. (1963). La précence d’histamine dans les aliments. Archives Belgues de
Médecine Sociale, Hygiène, Médecine du Travail et Médecine Légale, 21: 451-463.
PRASAD, A., GLOVER, V., GOODWIN, BL., SANDLER, M., SIGNY, M. y SMITH, SE. (1988).
Enhanced pressor sensitivity to oral tyramine challenge following high dose selegiline
treatment. Psychopharmacology, 95: 540-543.
315
REFERENCIAS BIBLIOGRÁFICAS
from raw and ripened salchichón, a Spanish cured sausage. Journal of Food
Protection, 59(5): 516-520.
ROSEIRO, LC., GOMES, A., GONÇALVES, H., SOL, M., CERCAS, R. y SANTOS, C. 2010).
Effect of processing on proteolysis and biogenic amines formation in a Portuguese
traditional dry-fermented ripened sausage “chouriço Grosso de estremoz e Borda
PGI”.Meat Science, 84: 172-179.
ROSSI, F., TOFALO, R., TORRIANI, S. y SUZZI, G. (2001). Identification by 16S-23S rDNA
intergenic region amplification, genotypic and phenotypic clustering of
Staphylococcus xylosus strains from dry sausages. Journal of Applied Microbiology,
90: 365-371.
316
REFERENCIAS BIBLIOGRÁFICAS
SATTLER, J., HÄFNER, D., KLOTLER, HJ., LORENZ, W. y WAGNER, PH. (1988). Food-
induced histaminosis as an epidemiological problem: plasma histamine elevation
and haemodynamic alterations after oral histamine administration and blockade of
diamine oxidase (DAO). Agents and Actions, 23: 361-365.
SHALABY, AR. (1993). Survey in biogenic amines in Egyptian foods: sausage. Journal of
Science and Food Agriculture, 62: 291-293.
SHALABY, AR. (1996). Significance of biogenic amines to food safety and human
health.Food Research International, 29: 675-690.
SHALABY, AR. (1999). Simple rapid and valid thin layer chromatographic method for
determiningbiogenic amines in foods.Food Chemistry, 65: 117–121.
SMITH, JS., KENNY, PB., KASTNER, CL. y MOORE, MM. (1993). Biogenic amines
formation in fresh vacuum-packaged beef during storage at 1 °C for 120
days.Journal of Food Protection, 56: 497-500.
STRATTON, JE., HUTKINS, RW. y TAYLOR, SL. (1991). Biogenic amines in cheese and
other fermented foods. Journal of Food Protection, 54: 460-470.
317
REFERENCIAS BIBLIOGRÁFICAS
STRAUB, BW., TICHACZEK PS., KICHERER, M., SCHILCHER, SM. y HAMMES, WP. (1994).
Formation of tyramine by lactobacillus curvatus lth-972. Zeitschrift für
Lebensmittel Untersuchung und Forschung, 199: 9-12.
STRAUB, BW., KICHERER, M., SCHILCHER, SM. y HAMMES, WP. (1995). The formation
of biogenic amines by fermentation organisms.Zeitschrift für Lebensmittel
Untersuchung und Forschung, 201: 79-82.
TAMIM, NM., BENNETT, LW., SHELLEM, TA. y DOERR, JA. (2002). High-performance
liquidchromatographic determination of biogenic amines in poultry carcasses.
Journal of Agricultural and Food Chemistry, 50(18): 5012–5015.
TALON, R., LEBERT, I., LEBERT, A., LEROY, S., GARRIGA, M., AYMERICH, T., DROSINOS,
EH., ZANARDI, E., IANIERI, A. y FRAQUEZA MJ.(2007). Traditional dry fermented
sausages produced in small-scale processing units in Mediterranean countries and
Slovakia. 1. Microbial ecosystems of processing environments. Meat Science, 77:
570-59.
TAYLOR, S. (1986). Histamine food poisoning: toxicology and clinical aspects. Critical
Reviews Toxicology, 17 (2): 91-128.
318
REFERENCIAS BIBLIOGRÁFICAS
TOLDRÁ, F. (2007). Biochemistry of meat and fat. In F. Todrà, Y.H. Hui, I. Astiasarán,
Wai-Kit Nip, J.G. Sebranek, E.T.F. Silveira, L.H. Stahnke & R. Talon (Eds.), Handbook of
fermented meat and poultry. Oxford, UK: Blackwell Publishing. (pp. 51-58).
TORRIANI, S., GATTO, V., SEMBENI, S., TOFALO, R., SUZZI, G., BELLETTI, N., GARDINI, F.
y BOVER-CID, S. (2008). Rapid detection and quantification of tyrosine decarboxylase
gene (tdc) and its expression in Gram positive bacteria associated with fermented
foods using PCR-based methods. Journal of Food Protection, 71: 93-101.
TSCHABRUN, R., SICK, K., BAUER, F. y KRANNER. P.(1990). Bildung von Histamin in
schnittfesten Rohwürsten. Fleischwirtschaft, 70:448-452.
319
REFERENCIAS BIBLIOGRÁFICAS
VAN DER BERG, CM., BLOG, LF., KEMPER EM. Y LAZZARO, AJ. (2003). Tyramine
pharmacokinetics and reduced bioavailability with food. Journal of Clinical
Pharmacology, 43: 604-609.
VISSER, S. (1993). Proteolytic enzymes and their relation to cheese ripening and flavor,
an overview. Journal of Dairy Science, 76: 329-350.
320
REFERENCIAS BIBLIOGRÁFICAS
Yang, Y. y Hodges, C. (2005) Assay transfer from HPLC to UPLC for higher analysis
throughput. Separation of Science Redefined, 5: 31-35.
321
ÍNDICE DE TABLAS
ÍNDICE DE TABLAS
TABLA 2.3. DATOS PUBLICADOS EN RELACIÓN A LOS CONTENIDOS DE AMINAS BIÓGENAS (MG/KG
PESO FRESCO) EN EMBUTIDOS FERMENTADOS DEL MERCADO DE DIFERENTES PAÍSES. ............... 31
TABLA 2.5. MICROORGANISMOS, CON UNA RECONOCIDA CAPACIDAD PARA PRODUCIR UNA O
MÁS AMINAS BIÓGENAS, ASOCIADOS CON LA CARNE O LOS PRODUCTOS CÁRNICOS.. ................ 39
TABLA 6.1. CONTENIDOS MEDIOS (DESVIACIÓN ESTÁNDAR) DE AMINAS BIÓGENAS (MG/KG PESO
SECO) EN PRODUCTOS CÁRNICOS CRUDOS-CURADOS FERMENTADOS DE ELABORACIÓN
ARTESANAL ALMACENADOS A DIFERENTES TEMPERATURAS Y PERIODOS DE TIEMPO, SEGÚN
LOS HÁBITOS DE CONSERVACIÓN Y CONSUMO DE LOS DIFERENTES PAÍSES DE PROCEDENCIA.. 107
323
ÍNDICE DE FIGURAS
ÍNDICE DE FIGURAS
FIGURA.4.1. DIAGRAMA DE FLUJO DEL PROCESO DE ELABORACIÓN DE LOS EMBUTIDOS FERMENTADOS ……..62
FIGURA 6.1. EVOLUCIÓN DE LOS CONTENIDOS DE LAS AMINAS BIÓGENAS (MG/KG PESO SECO)
DURANTE EL ALMACENAMIENTO DE EMBUTIDOS FERMENTADOS EN PLANTAS DE
ELABORACIÓN ARTESANAL PROCEDENTES DE PORTUGAL. PRODUCTO CONSERVADO
EN REFRIGERACIÓN (4ºC). T AMB: PRODUCTO CONSERVADO A TEMPERATURA AMBIENTE
(20-25 ºC) …………………………………………………………………………………………………………………………..…….109
325
ÍNDICE DE PUBLICACIONES
ÍNDICE DE PUBLICACIONES
Artículo I ......................................................................................................................... 93
M.L. Latorre-Moratalla, T. Veciana-Nogués, S. Bover-Cid, M. Garriga, T. Aymerich, E. Zanardi,
A. Ianieri, M.J. Fraqueza, L. Patarata, E.H. Drosinos, R. Talon, M.C. Vidal-Carou (2008). Biogenic
amines in traditional fermented sausages produced in selected European countries. Food
Chemistry, 107: 912-921. (Índice de impacto (JCR 2008): 2,696; Posición en el área “Food and
Science Technology”: 9/107)
327
ÍNDICE DE PUBLICACIONES
328
ÍNDICE DE PUBLICACIONES
329
ÍNDICE DE PUBLICACIONES
330
331