The Specific Identification of Staphylococcus Aureus With New Fluorescence in Situ Hybridization (FISH) Methods

The specific identification of Staphylococcus aureus with new fluorescence in situ hybridization (FISH) methods
By
Thomas Sutherland Lawson

A thesis submitted to Macquarie University for the degree of Doctor of Philosophy Faculty of Science January 2012
Examiners Copy
ii
c Thomas Sutherland Lawson, 2012.

A Typeset in L TEX 2 .
iii
Unless otherwise indicated, the material in this thesisby-publication is original and the work of the candidate. The ndings of the thesis were based on investigations at Macquarie University, Sydney, Australia. Tests were performed with the approval of the University Biosafety Committee (09/14/LAB and 5201000927) and were limited to pure cultures of patient isolates at a non-clinical location. Its Chapters contain sections that were published in peer-reviewed Journals and are included as such. To comply with Journal requirements, sections may differ in their format or contain material that overlaps. In some instances the page size and byline of the original publication was modied so that it could be integrated into the thesis. The thesis did not italicize Latin expressions that have common English usage such as in situ, in vivo or in vitro. It followed the American convention for spelling and the citation style of the Journal of Clinical Laboratory Analysis (Online ISSN: 1098-2825).
Thomas Sutherland Lawson
iv
Acknowledgements
I would like to express my gratitude to my supervisors Dr. Russell Connally, Dr. Jon Iredell, Associate Professor Subramanyam Vemulpad and Professor Jim Piper. The sta and students at the Faculty of Science, Macquarie University and at the Centre for Infectious Diseases and Microbiology, Westmead Hospital are thanked for their help. I would like to thank the anonymous reviewers of the manuscripts submitted to journals for their helpful feedback. Finally, thanks to my family and friends for their support. I would like to acknowledge the Australian Research Councils Linkage Projects (LP0775196) for funding this research and the Australian Proteome Analysis Facility for providing laboratory facilities.
vi
Acknowledgements
List of publications and awards

Published manuscripts: 1. Lawson TS, Connally RE, Vemulpad S, Piper JA. In silico evaluation and testing of uorescence in situ hybridization 16S rRNA probes for Staphylococcus aureus. Lab Med 2011;42:587-591 (Chapter 3) (1). 2. Lawson TS, Connally RE, Vemulpad S, Piper JA. Optimization of a two-step permeabilization uorescence in situ hybridization (FISH) assay for the detection of Staphylococcus aureus. J Clin Lab Anal 2011;25:359-365. (Chapter 3) (2). 3. Lawson TS, Connally RE, Vemulpad S, Piper JA. Express uorescence in situ hybridization methods for the detection of Staphylococcus aureus. Clin lab 2011;57:789794 (Chapter 3) (3). 4. Lawson TS, Connally RE, Iredell JR, Vemulpad S, Piper JA. Detection of Staphylococcus aureus with a uorescence in situ hybridization that does not require lysostaphin. J Clin Lab Anal 2011;25:142-147. (Chapter 4) (4). 5. Lawson T, Connally R, Vemulpad S, Piper JA. Dimethyl formamide-free, ureaNaCl uorescence in situ hybridization (FISH) assay for Staphylococcus aureus. Lett Appl Microbiol 2012;10.1111/j.1472-765X.2011.03197.x:(in press). (Chapter 4). (5). 6. Lawson TS, Connally RE, Vemulpad S, Piper JA. In reference to targeted imaging modality selection for bacterial biolms in chronic rhinosinusitis and dierent biolms, dierent disease? a clinical outcomes study. Laryngoscope 2011;121:20432044. A) (6). 7. Lawson TS, Connally RE, Iredell JR, Piper JA. The simultaneous detection and dierentiation of staphylococcus species in blood cultures using uorescence in vii
viii
List of publications and awards
situ hybridization: A comment. Med Princ Pract 2011;20:390-391. (Appendix A) (7). Candidate contribution to the above manuscripts: concept (75%), experimental (100%), analysis of results (85%) and writing (80%). Conference proceeding: 1. Hamey LG, Connally RE, Yen SW, Lawson TS, Piper JA, Iredell JR, Luminescent microspheres resolved from strong background on an automated Time-Gated luminescence microscopy workstation. DICTA 2009 2009;1:223-228. (8). The candidate contributed 5% to this manuscripts concept, analysis and writing. Awards: 1. Automated pathogen detection using time-gated luminescence microscopy, ICS APAI PhD Scholarship, Macquarie University, 2008 to 2011. 2. Commercialization training scheme (CTS) Scholarship and Postgraduate Certicate in Entrepreneurship, Macquarie University, 2008 to 2009. 3. FABLS Support Scheme for Emerging Research Projects, Macquarie University, 2008.
Abstract
Staphylococcus aureus (SA) is a common bacterium associated with potentially serious infections aecting both humans and other mammals. It is of particular concern that SA can rapidly develop resistance to a range of antibiotics. Consequently, SA can cause death and severe disability as a result of treatment failure. Antibiotic resistant SA is especially prevalent in modern hospitals. For these reasons the capacity to rapidly identify SA in patients is a crucial endeavor. The rapid identication of SA plus information about its sensitivity to specic antibiotics can be lifesaving. A range of laboratory based techniques are available for the identication of pathogens such as SA. However, these current techniques have important limitations. These limitations include (i) initial inadequate specicity and (ii) a delay by days of the precise identication of the pathogen. As a result initial treatment of possible infections with SA is usually based on broad clinical judgments and not precise information. These clinical judgments usually lead to the use of broad spectrum antibiotics which may have modest or no impact. These are the reasons for this current project whose aim is to develop techniques which oer (i) specicity concerning the identity of the pathogen infecting a patient and (ii) rapid results. In order to achieve these aims we have sought to further develop and optimize an established laboratory technique - uorescent in situ hybridization (FISH). This technique is most commonly used following the outcomes of a blood culture to identify suspect pathogens such as SA. The use of FISH in this context is to conrm the accuracy of the diagnosis based on the blood culture and Gram-stain. The positive attributes of FISH include its applicability to a range of specimen types plus its accuracy, robustness, short turnaround time and its ability to oer in situ (cellular location of the pathogen in the specimen) information. In technical terms FISH binds oligonucleotides to its complementary nucleotide sequence targets, usually 16S rRNA. The oligonucleotides are then usually visualized ix
Abstract
by uorochrome labels and an epiuorescent microscope. There are limitations to analyses based on FISH. There are delays in the use of FISH because of the need to rst complete a blood culture. This requirement is to make sure the number or load of microbes is suciently high to allow accurate detection. The assay is usually not automated and requires handling by a technician. In addition, the establishment of FISH techniques can be complex and the costs can be high if dedicated equipment is purchased. Finally, routine FISH techniques may lead to the inhibition and obscuring of the signals generated by FISH. It is because of these limitations that FISH is rarely used in clinical diagnostics. Accordingly, the aim of this project was to overcome these limitations and to develop FISH as a viable diagnostic tool. The specic aim was to investigate the accurate and rapid identication of SA with FISH techniques. SA was chosen as the subject and target of this investigation rstly because of its clinical importance, and secondly because it is potentially a dicult pathogen to detect with DNA based FISH techniques. Here, it should be noted that SA is frequently misidentied with coagulase-negative staphylococci (CoNS). In addition, if rened and redeveloped FISH techniques can identify SA, it can be reasonably assumed that the same or similar techniques would be eective with most other common and important pathogens. There are three outcomes of this project. (i) The existing FISH method for detecting SA was improved (Chapter 3). New probe sequences for FISH that were specic to SA were identied. These probes had binding and formamide requirements that were more useful than the existing sequences that are commonly reported and used. High-yield uorophores were found to label SA with a high and consistent signal intensity and were also more resistant to photobleaching. New techniques for the preparation of FISH were developed which facilitate the application of FISH. These techniques eliminate tedious and time-consuming preparation for FISH assays. This was achieved by the development of premixed materials. The adhesion of the specimen containing SA to glass slides was improved. The need for
xi
adequate cell adhesion to glass slides is a technical issue with FISH that is not widely recognized. This technical issue of cell adhesion can be directly linked to the accuracy of the FISH assay. Resolution of this technical problem has been shown in this project to allow detection of SA with much less cell loss and with the considerable benet that SA at lower numbers could be detected. A two-step permeabilization treatment using lysozyme and lysostaphin was developed which was useful if high molecular weight probes were used. This approach shortened the time needed for hybridization incubation when smaller probes were used. These techniques have previously been reported. However, past approaches have been substantially improved and optimized so that SA integrity could be maintained and the FISH assay could be completed in one hour instead of several hours. This is a considerable achievement with potential advantage to patients with serious infections. Tests were run to determine if the time taken to conduct conventional FISH assays could be substantially reduced. A range of techniques were developed all aimed at reducing the time taken to conduct FISH assays. These techniques included the combination of existing permeabilization steps. These developments were successful. It was possible to detect by FISH techniques the presence of SA in 24 minutes (in place of the current 45 to 127 minutes) and to complete a Gram-stain and follow up FISH test within one hour of a positive blood-culture. (ii) New approaches to FISH were tested (Chapter 4). Improving the existing technique is useful, but does not extend the potential of the assay. A FISH technique that can detect SA with DNA probes in the absence of permeabilization with lysostaphin was developed. Lysostaphin is a signicant burden to the routine use of FISH to detect SA. It can be costly and its handling, storage and application are dicult. When lysostaphin was omitted, the permeabilization step was simplied. Usually when FISH was run, two permeabilization treatment arms were needed, one for SA and another for other Gram-positive bacteria. With DNA probes and this new technique, only one was required for the detection of Gram-positive bacteria. A FISH method was developed that detected SA in the absence of formamide with urea-based reagents. Urea is non-toxic and so its handling and disposal is simpler and
xii
Abstract
it can be used in both the hybridization and washing reagents. Previously, the washing step had to rely solely on NaCl to remove partly bound oligonucleotides. When urea was used, the FISH signal was more intense and non-specic binding was minimized. Possibly urea is partially permeabilizing the SA and more eectively removing unbound probe. Because of the attributes of urea, FISH could be run entirely on a hot-plate with a precise temperature control. This removed the need for the conventional dedicated incubator and water-bath. (iii) A FISH assay was developed that could detect SA in a complex autouorescent blood specimen using a europium chelate and time-gated luminescence microscopy (TGLM) (Chapter 5). Specimens were prepared for testing with TGLM by spiking fresh whole-blood with SA and incubating. The SA was then separated from most of the blood and detected with conventional oligonucleotide probes and FISH and with a europium (Eu3+) probe and time-gated luminescence microscopy (TGLM). Eu3+ probes and TGLM provided higher clarity than the conventional probe as most of the background signal or autouorescence from the specimen was suppressed. The technique developed for the separation of SA from the spiked blood sample was simple, rapid and accurate, collecting nearly all the intra and inter-cellular SA. The separated SA remained viable and could be cultured in nutrient broth. Cultures of the separated SA became turbid more rapidly than cultures of the unseparated spiked blood sample. The central aim of this research project, namely, the enhancement of the use of FISH for the rapid detection of SA, was achieved. The existing FISH methodology and techniques were greatly enhanced and new methods including a TGLM technique for the use of FISH in highly autouorescent specimens were successfully developed. Increased permeabilization of SA for FISH and DNA probes was achieved. As other bacteria need less or no permeabilization, the ndings are likely to be applicable to other pathogens. Accordingly, extension of these investigations and additional testing of patient specimens in clinical settings is the next important step.
Contents
Acknowledgements List of publications and awards Abstract List of Figures List of Tables 1 Introduction 1.1 1.2 1.3 Rationale for the present project . . . . . . . . . . . . . . . . . . . . . . Septicemia and S. aureus . . . . . . . . . . . . . . . . . . . . . . . . .
v vii ix xvii xix 1 1 3 4 4 6
Diagnosis and treatment of S. aureus septicemia . . . . . . . . . . . . . 1.3.1 1.3.2 1.3.3 Standard diagnostic pathway for septicemia and its limitations . Possible improvements to S. aureus septicemia diagnostics . . . The role of uorescence microscopy in diagnosing S. aureus septicemia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1.4
Improving the FISH for identication of S. aureus directly in blood cultures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.4.1 1.4.2 Recent developments in FISH . . . . . . . . . . . . . . . . . . . Limitations of FISH as applied to S. aureus . . . . . . . . . . . 8 11 14
1.5
Improvements required for the application of FISH in the detection of S. aureus 1.5.1 1.5.2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17 18
Re-engineering FISH for the detection of S. aureus . . . . . . . Issues concerning the use of FISH for the detection of S. aureus in complex samples . . . . . . . . . . . . . . . . . . . . . . . . .
18 24
1.6
Outline of the thesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . xiii
xiv
Contents
2 Methodology: FISH with rRNA-targeted oligonucleotide probes 2.1 Preparation of reagents, probes and S. aureus samples . . . . . . . . . 2.1.1 2.1.2 Hybridization and post-hybridization washing buer preparation In Silico Evaluation and Testing of FISH 16S rRNA Probes for S. aureus 2.1.3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
27 31 31
36
In situ probing of S. aureus with specic 16S rRNA targeted oligonucleotides . . . . . . . . . . . . . . . . . . . . . . . . . . . 40 41 41 42 43 43
2.1.4 2.1.5 2.2 2.3 2.4 2.5
Bacterial isolates . . . . . . . . . . . . . . . . . . . . . . . . . . Separation of S. aureus from an in vitro model of bacteraemia .
Step 1: Method for adhering specimens to slides . . . . . . . . . . . . . Step 2: S. aureus xation . . . . . . . . . . . . . . . . . . . . . . . . . Step 3: S. aureus permeabilization . . . . . . . . . . . . . . . . . . . . Step 4: In situ hybridization with rRNA-targeted, uorescently labeled oligonucleotides . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
45 47 47 49 51
2.6 2.7
Step 5: Specimen washing with buer . . . . . . . . . . . . . . . . . . . Direct visualization of microorganisms . . . . . . . . . . . . . . . . . . 2.7.1 FISH image and statistical analysis . . . . . . . . . . . . . . . .
3 Improvements to the existing FISH method 3.1 In silico evaluation and testing of uorescence in situ hybridization 16S rRNA probes for Staphylococcus aureus . . . . . . . . . . . . . . . . . . 3.2 Optimization of a two-step permeabilization uorescence in situ hybridization assay for the detection of Staphylococcus aureus . . . . . . . 3.3 Express uorescence in situ hybridization methods for the detection of Staphylococcus aureus . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 Development of new FISH methods 4.1 Detection of Staphylococcus aureus with a uorescence in situ hybridization that does not require lysostaphin . . . . . . . . . . . . . . . . . . . 4.2 Dimethyl formamide-free, urea-NaCl uorescence in situ hybridization (FISH) assay for Staphylococcus aureus . . . . . . . . . . . . . . . . . .
53
59
66 75
76
82
Contents
xv
5 Time-gated uorescence imaging of a europium chelate label 5.1 Time-gating of a europium probe rapidly labeled with luminescence in situ hybridization for the detection of Staphylococcus aureus . . . . . . 5.1.1 5.1.2 5.1.3 5.1.4 5.1.5 6 Conclusion A Appendix A: Other publications that emerged from the thesis A.1 In reference to targeted imaging modality selection for bacterial biolms Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
87
87 87 88 90 92 93 103 109
in CRS and dierent biolms, dierent disease? . . . . . . . . . . . . . 110 A.2 The simultaneous detection and dierentiation of staphylococcus species in blood cultures using uorescence in situ hybridization . . . . . . . . 114 B Appendix B: Analysis of common oligonucleotides used in the detection of S. aureus with FISH List of abbreviations References 117 123 125
xvi
Contents
List of Figures
1.1 1.2 2.1 2.2 2.3 5.1 5.2 5.3 5.4
Time-gated Giardia lamblia . . . . . . . . . . . . . . . . . . . . . . . . Schema of time-gated luminescence microscopy (TGLM) . . . . . . . . Probe melting temperature and eciency by formamide concentration . Binding anity of 18, 19, 22, 24 and 25 base oligonucleotides . . . . . . Melting temperature of the Staaur probe . . . . . . . . . . . . . . . . . SA cultures labeled with BHTEGS and visualized with TGLM . . . . . SA and SE incubated and labeled with the BHTEGS chelate in blood . SA labeled with BHTEGS and Alexa with Figure 5.4 plot locations . . Plots of the TGLM and conventional FISH signal . . . . . . . . . . . .
20 23 33 39 46 96 97 98 99
xvii
xviii
List of Figures
List of Tables
1.1 1.2 2.1 2.2 2.3 5.1
Advantages and limitations of uorescence in situ hybridization (FISH) FISH studies that have identied SA . . . . . . . . . . . . . . . . . . . FISH method typically used for the detection of bacteria . . . . . . . . Washing buer NaCl (M) by hybridization buer formamide (%) . . . . Guide to judging the performance of a probe sequence . . . . . . . . . .
10 13 30 35 38
S/N calculations of a BHTEGS and a conventional probe . . . . . . . . 100
B.1 Binding anity of the EUB338 probe . . . . . . . . . . . . . . . . . . . 118 B.2 Binding anity of the KT18-16S68 probe . . . . . . . . . . . . . . . . . 119 B.3 Binding anity of the Staaur probe . . . . . . . . . . . . . . . . . . . . 120 B.4 Binding anity of the Staphy probe . . . . . . . . . . . . . . . . . . . . 121
xix
xx
List of Tables
1
Introduction
1.1 Rationale for the present project
Staphylococcus aureus (SA) is a Gram-positive bacterium ubiquitous in the environment and in humans and is linked to infection with high rates of morbidity and mortality (9, 10, 11). It is persistent in the upper respiratory tract, is easily transmitted in hospitals (12) and is often resistant to many antibiotics (9, 13). SA is the most common cause of septicemia, that is, an infection of the blood (referred to as Staphylococcus aureus bacteremia or SAB) (14), and is also associated with invasive procedures (15). Identication of SA as the cause of septicemia is dicult (16). The symptoms of a SA infection can be inconsistent (17). The foci of infection may not be found and other coagulase negative staphylococci (CONS) such as S. epidermidis (SE), a common contaminant of blood cultures (18), can mimic its features (19). Rapid blood tests can conrm infection, but not identity of the pathogen (20). Tests that can identify SA are usually much slower (21) as they need culturing rst (22). Septicemia if severe, needs immediate treatment (16). The initial treatment is, therefore, based on presumptive diagnosis (23) and maybe incorrect (24) and the infection clearance delayed (25). A solution is to use diagnostic tests that are both rapid and accurate (26, 27, 28). 1
Introduction
Fluorescence in situ hybridization (FISH) is an accurate and rapid test for the identication of intact SA in specimens (29). The technique often involves hybridizing slide-based uorescent labeled DNA probes to in situ rRNA (30) sequences of SA in blood cultures (Table 1.2). Labeled SA is then visualized with uorescence microscopy (31). It can be applied either to cultures (32) or directly to specimens that are not cultured (33). Automation is simpler if peptide nucleic acid (PNA)-based probes are used and the SA detected with a ow-cytometer (34, 35). There are certain limitations to the use of FISH as a test for SA which may explain why it is not reported more often in routine diagnostics (23, 36, 31). Limitations include: the preparation of its reagents can be exacting and time-consuming (37, 38). The sensitivity of the assay is low (39, 40) and usually necessitates its application to blood cultures which take two days to complete (41). Material other than SA in the specimen (42, 43) can hinder access of the probes to SA and can obscure its signal (44, 45). The natural emission of the specimen (referred to as autouorescence) can interfere with the signal from the probe (46, 47). There are other tests for SA detection which, although not as accurate or quick as FISH and do not visualize SA, nonetheless are simple and inexpensive to perform (48, 49, 50, 51). The project investigates the use of FISH for the detection of SA and its dierentiation from the coagulase negative staphylococci (CONS) Staphylococcus epidermidis (SE) (19). There were three aims to this research. The rst was to improve the current FISH protocols for the identication of SA in blood cultures (37, 52, 32). Blood cultures was chosen as it is the most tested specimen (Table 1.2) (41, 18). The second aim of the project was to re-engineer the FISH procedure. Improvements to a conventional technique are useful, but are usually incremental. Radical alternatives to the conventional FISH reagents, equipment and procedure were tested in order to achieve signicant gains to its performance. The third aim was to reduce interference of the FISH signal from non-target material in the specimen (43, 47). The tests performed in the project and the changes made to the FISH assay were aimed at making its use in routine microbiology for the detection of SA more practical.
1.2 Septicemia and S. aureus
1.2
Septicemia and S. aureus
Septicemia is a common infection and a type of sepsis where pathogens have invaded the blood-stream (53, 54). It is a serious condition which can be fatal and SA is its most common cause (55). The frequency and role of SA in septicemia is related to its potential virulence (13). SA can remain viable both within the body and on surfaces for many months (12). Its highly cross-linked peptidoglycan and capsule layer makes it hardy and resistant to antibacterial reagents (12). SA is easily transmitted from surfaces to people and between people and can evade and inhibit the immune system (56). It can quickly develop antibiotic resistance and share this resistance with other stains of SA (27, 13). It has been suggested that because of its ubiquity, SA could serve as a hygiene indicator in laboratories that wish to maintain sterility (12). The diagnosis and treatment of SA related septicemia has improved with time (25), but its incidence remains high (53, 54). Its control in hospitals has proven dicult to achieve (10). A third of surfaces (12) and a third of otherwise healthy people tested were found to be positive for SA (57). The number of invasive procedures carried out in hospitals has risen (54) and patients with strains of SA resistant to rst-line antibiotics have become more common (55). This increase in resistance is related to the acquisition of genes that make SA less susceptible to antimicrobials (13). Strains of SA can be categorized as community acquired methicillin resistant SA (CA-MRSA) and hospital-acquired MRSA (HA-MRSA) (58). CA-MRSA is mostly acquired by the young in the community, transmitted via people and shared items, resistant to -lactams, but sensitive to other antibiotics, presents with skin and soft tissue infection and possesses the SCCmec gene (type IV or V) (13). HA-MRSA is mostly acquired by the elderly in health facilities, transmitted via patients and sta, resistant to most antibiotics, presents with bacteraemia, wound infections and infections of the respiratory and urinary tracts and possesses the SCCmec gene (type I, II or III) (13). The frequency, virulence and ability to resist treatment suggest that for now, SA related infections will remain a major health issue (59, 25).
Introduction
1.3
Diagnosis and treatment of S. aureus septicemia
High risk patients with suspected septic shock and septicemia need immediate treatment (54). Each hour of delay in its treatment substantially increases the rate of mortality (10, 60). The choice of initial antibiotics is occasionally hit or miss (23) with major adverse consequences if the treatment is incorrect (24, 25). Cefazolin, ucloxacillin, nafcillin and oxacillin are the antibiotics commonly given if methicillin-sensitive SA (MSSA) is suspected and vancomycin if MRSA is suspected (16). Treatment is continued for one to two weeks and is not stopped until the patient is symptom-free (25). If the response is poor, the antibiotic treatment is changed or rotated (16). At the start of treatment the identity the etiologic pathogen might be suspected, but is not usually known (20). The initial examination and empiric data is used to inform treatment (23), but this is not specic to the patient and cannot conrm the identity and susceptibility of the pathogen (26, 24, 17). Even with incomplete diagnosis, most antibiotic treatment is adequate against SA and other prevalent pathogens (23, 9). Misdiagnoses and incorrect treatment (23), however remain the most common causes of avoidable death due to sepsis (24, 17). Poor diagnosis can also contribute to increasing the resistance of SA to antibiotics (25). This suggests that early diagnosis of septicemia that can also identify the etiologic pathogen is important for eective treatment (26, 10).
1.3.1
Standard diagnostic pathway for septicemia and its limitations
If the patient is febrile and septicemia is suspected, blood is collected and antibiotic treatment started (26, 16). The blood can then be tested to conrm infection and the identity of the pathogen (21). Initial tests applied directly to whole-blood such as coagulation screening, C-reactive protein, full blood count, liver function and urea and electrolytes are rapid and simple to perform (27, 16). They can indicate an infection (16), but they cannot establish the identity of the etiologic pathogen.
1.3 Diagnosis and treatment of S. aureus septicemia
The role of blood culture in diagnosing septicemia
Further microscopy, culturing and a variety of tests help to identify the cause of septicemia and its susceptibility to antibiotic treatment (22, 61). Blood cultures can be run with an automated continuous-monitoring blood culture system (20, 41) to conrm an infection and increase its pathogen numbers (60). Other more accurate tests can then be applied to identify the pathogen (27, 22). Blood cultures are necessary for these conrmatory tests, but delay their start by two days and can be inaccurate (62, 28, 60, 21, 18). Blood cultures may not detect an infection if the pathogen in the blood is slow-growing and produces a false-negative result (63, 24) or they may detect a contaminant such as SE from skin ora inoculated at the time of blood collection (18) and produce a false-positive result (64, 65). Thus, the tests that follow a blood culture, although highly accurate and rapid themselves (22) such as FISH (32), are compromised somewhat by their necessity for blood cultures (60, 21, 18).
The role of Gram-stain for the detection of septicemia
Once it has become positive, blood culturing is followed by a Gram-stain (16). The Gram-stain uses reagents to stain the microbes so that they can be observed with a light microscope tted with a 40 or higher objective. (66). Gram-staining is simple and rapid (10 to 20 minutes) to complete and can be reasonably accurate, indicating the presence of bacteria (48). Gram-negative bacteria such as Escherichia coli (EC) stain red-pink and SA and other Gram-positive bacteria stain blue-violet (48). SA can be identied as it is observed as a 1 m diameter spheres and that regularly form tetrad clusters (48). However, because SE and other coagulase-negative staphylococci (CoNS) contaminants are similar in appearance and also stain blue-violet (66), they are often misidentied as SA (19). In spite of this drawback, if the patient is not responding well, antibiotic treatment for septicemia is modied on the basis of the Gram-stain report (23, 66, 61).
Introduction
The role of conrmatory and antibacterial susceptibility tests
To conrm the identity of SA, tests are run after the Gram-stain and completed the same day (65, 67). Tube coagulase (51) and DNase (51) biochemical tests are commonly performed as they are rapid and inexpensive (50); both tests can be completed with some accuracy (22) in two to four hours (67). These tests, however do not directly visualize the SA (49) and can be relatively inaccurate (22) unless performed in conjunction with other tests (67). Tests to determine the resistance of SA to antibiotics such as chromogenic media, Mueller-Hinton agar or the disc diusion test (22), are started after Gram-staining, but are not completed until the next day (27). The conrmatory and susceptibility tests that follow a blood culture rarely inform the current antibiotic treatment (23) or change its outcome (68). Rather the value of these tests is to conrm diagnosis and inform the treatment of future infections (26).
1.3.2
Possible improvements to S. aureus septicemia diagnostics
Blood cultures and Gram-stains are adequate for most septicemia diagnoses (18), but they do not identify SA or its susceptibility to antibiotics (66). Reliance on these two procedures may become less acceptable as the number of resistant strains of SA increases (55, 54). The tests that can conrm the identity of SA and its susceptibility cannot be completed fast enough after a blood culture to play a role in the patients treatment (67). Attempts have been made to address these shortcomings (69). Solutions are focused on developing tests for SA that are applied directly to whole-blood (70) or improving the conrmatory tests applied to blood cultures (65). Possibly, identication of etiologic pathogens in whole-blood has the most potential (21), but the problems are still technically complex and dicult to solve (70).
1.3 Diagnosis and treatment of S. aureus septicemia
1.3.3
The role of uorescence microscopy in diagnosing S. aureus septicemia
Although recently not the focus of diagnostics (71), because of the accuracy and simplicity of its procedures (28), uorescence microscopy might be a promising avenue for investigation (72). Fluorescent microscopes are more expensive than their equivalent bright-eld microscopes, but this cost is decreasing (73) and they are now common in microbiology laboratories (74). Non-specic uorescent stains, such as acridine-orange (AO) (Sigma, A6014) (1 g/ml of AO in 1 M of acetic acid and sodium acetate) (75), are simpler and faster (5 minutes) to apply than Gram-stains (10 to 20 minutes) as they can be completed in a single incubation step and can be more accurate (71). Nonetheless, uorescent staining has the same constraint as Gram-staining, namely these stains indicate, but do not distinguish SA from CoNS (71).
Assessment of the value of immunouorescence microscopy in the diagnosis Another uorescent technique, immunouorescence, usually takes longer than Gramstain to complete (15 to 30 minutes), but is as simple to apply as a general uorescent stain (76). Like the general uorescent stain, its procedure can include a single incubation step at room temperature followed by a quick rinse to remove unbound probe (77). Unlike Gram-staining and general uorescent staining, immunouorescence can positively identify SA. The technique binds uorochrome conjugated antibodies to antigens specic to SA on its cell wall (78). If the SA is in a suspension (referred to as planktonic) such as a blood culture (18), immunouorescence can be completed as rapidly as a Gram-stain (Virostat, 6883) (78). Despite its ability to directly visualize and identity SA, it may not be possible to apply immunouorescence consistently to SA and this might explain why it is reported infrequently. Virulence factors in SA disrupt the formation of antibodies to SA and the binding of antibodies to SA (56). SA antigen expression is inconsistent between strains and, with changes to its micro-environment or phase of growth, can dier within a single strain (56). SA inhibits formation and binding of antibodies by forming a capsular or
Introduction
slime layer (79), congregating in clusters (48) or biolms (80) and expressing Protein A (81). Initial work carried out during the project (data not shown) applied commercial monoclonal and polyclonal antibodies against SA to cultures of clinical isolates of SA. A single product, a rabbit polyclonal antibody conjugated to FITC (Virostat, 6883) (78) identied the SA tested and did not react with isolates of SE, a nding that was repeated elsewhere (82, 77). It was not known if this was a true antibody to antigen binding or a rabbit immunoglobulin G to Protein A binding (83, 77). Furthermore, these results were inconsistent; when the same product in a biotinylated (Virostat, 6887) and in an unconjugated (Virostat, 6881) form were tested, they failed to bind. For these reasons, the use of immunouorescence to identify SA in routine diagnostics might be impractical (56).
1.4
Improving the FISH for identication of S. aureus directly in blood cultures
At 45 minutes (32), uorescence in situ hybridization (FISH), takes longer to complete than immunouorescence, but its identication of SA can be more robust (76). Both assay types have similar characteristics for the determination of SA. They can conrm with certainty the presence of SA, detect SA in situ (with reference to the specimen) (19) and, although often performed, do not need culturing (33). Both methods have limitations, of which those for immunouorescence were already touched on. In the case of FISH, its reagent preparation and optimization can be complex and, if conventionally applied, cannot distinguish between sub-strains (31, 38). There is also a fundamental dierence between the two assays. Unlike immunouorescence, which labels cell-wall antigens exterior to the pathogen, FISH labels nucleic sequences interior to the pathogen (44). This simplies its interaction with SA and allows its labeling of SA to be consistent (76). The advantages and limitations of the identication of SA with FISH are detailed in Table 1.1.
1.4 Improving the FISH for identification of S. aureus directly in blood cultures 9 The FISH assay creates the conditions necessary for the hybridization of a probe sequence (referred to as an oligonucleotide) to its in situ complementary sequence (30). Flurophore conjugated DNA is hybridized to 16S rRNA to identify pathogens such as SA from the species-level through to the domain-level (29). FISH can detect unknown pathogens in situ, whose culturability is also unknown, without disturbing the matrix of the specimen (44, 84). The assay can thus provide in situ data of the relationship between SA, its host and other pathogens (85). Even if rst cultured, it is possible to identify SA by its growth patterns in the culture media as they usually form tetrad clusters demonstrable in Gram stained smears (48, 79). The slide and DNA-based FISH procedure commonly used to identify SA (32) is completed in ve steps: (i) specimen preparation (42, 86, 43), where slides are prepared, spotted with the collected (and possibly cultured) specimen; (ii) xation of the specimen, usually with an alcohol (32); (iii) permeabilization, where SA is permeabilized with lysozyme and lysostaphin enzymes (87); (iv) hybridization of the probe to SA (88); (v) and washing, where unbound probe is removed (87). If the nal slide rinse, cover-slip mounting and microscopy is also included, the assay is completed in six, not ve steps (44). Thus, the FISH assay itself is relatively simple to perform. What can complicate its routine use is its setup and quality control and the access of probes to targets in complex specimens (Table 1.1).
10
Introduction
Table 1.1: Advantages of using uorescence in situ hybridization (FISH) to detect SA and its limitations (36). Advantages Limitations
A range of frequently encountered mi- Microbe targets need to be predetercrobes can be targeted with FISH 16S mined. Probes for SE are limited in rRNA probes (64). their availability and accuracy (39, 40). SA can be dierentiated at the species Resistant strains of SA cannot be diflevel (87). ferentiated from non-resistant strains (32). SA can be tested for directly in whole- Sensitivity limit is approximately 103 blood (ISH) (62), stool (89), sputum to 104 cfu/ml (39, 91, 33, 40). (90) and urine (33) specimens without a culturing step. Assay is relatively reliable and robust Known SA and SE controls are needed (52). with each test batch (37). Multiple probes can be applied at the Probes need similar formamide concensame time (45, 64). trations to be applied together (92). Assay can detect SA from blood cul- Blood cultures on average delay FISH tures in 45 minutes (32). for 2 days (60). Simple tube coagulase (22) and DNase (49) tests can be completed in 2 to 4 hours (67). Assay simple to perform if reagents are Complex manual handling required for premixed and stored before start. reagent preparation and optimization (93) and, if slide-based, is dicult to fully automate (94). Expense per test is relatively low if Tube coagulase (22) and DNase (49) DNA probes are used (50). tests are less expensive (50). Small quantities of probes and lytic en- Probes and lytic enzymes are expensive zymes are used per slide. to rst source (95). Assay does not need a relatively large An (epi)uorescent microscope is reamount of bench-space. quired to visualize the cells.
1.4 Improving the FISH for identification of S. aureus directly in blood cultures 11
1.4.1
Recent developments in FISH
The disadvantages of the FISH assay listed in Table 1.1 were addressed to some extent by recent advances to its procedure and use in blood cultures for e.g. (18). An online resource for the optimization of probe sequences for SA (and other pathogens) as well as the conditions of their incubation was made available by Yilmaz et al. (92) (mathsh.cee.wisc.edu). This resource makes it possible to rapidly test probes in silico (performed on computer) (84, 96) against the 16S rRNA sequences of SA (97). Locations on the SA 16S rRNA sequence with the highest anity for binding can be identied (98) and then tested against complementary sequences of various lengths. Once the most ecient of these sequences is found, the ideal concentration of formamide and NaCl and temperature for their hybridization can also be calculated (99). With this tool, the characteristics of established and new probe sequences can be rapidly and accurately compared and the time spent optimizing their use with FISH in the laboratory can be reduced. If FISH can be applied to a specimen in the absence of culturing, the time to result after specimen collection is dramatically shortened and in situ data can be collected (85). SA in urine was recently detected directly with a FISH assay by Wu et al. (33). Conventional detection of pathogens in urine takes at least one day to be cultured and then detected. FISH applied directly to urine can detect and identify the pathogens present in two hours, thus informing their treatment the same day as specimen collection. Other specimens tested successfully with FISH for SA without rst culturing have included cerebrospinal uid (39), sputum (90), stool (89), and whole-blood with in situ hybridization (ISH) (100, 63, 62). Unfortunately, FISH cannot be applied directly to whole-blood without either a series of complex purication and blocking steps (100, 63, 62) or more commonly after completing a two day blood culture (32). The turnaround time for a diagnostic test is important as it determines its usefulness (101). A 45 minute FISH assay that successfully detected SA was reported by Poppert et al. (32). This was a signicant improvement as it was faster than the commonly used two hour assay (64). A conrmatory test that takes longer than one hour is usually
12
Introduction
of a lesser value to the clinician (101). Most septicemia treatment decisions are made at blood collection or after the report of a Gram-stain (66). At 45 minutes, the FISH assay is more useful after a blood culture (32), but it may still be too lengthy to inform treatment (23) because Gram-staining can be completed in 10 to 20 minutes (23). The introduction and use of PNA based probes for FISH instead of DNA probes has simplied and improved the assay (102). Multiple probes can be combined more easily if PNA is used as it is not as sensitive as DNA probes to the stringency of the buer (102). No permeabilization is required for SA as PNA probes do not carry a charge (103). For the same reason, the hybridization step is more ecient and can be shortened (104) and the use of a ow-cytometer is less hampered by material in the specimen (105, 34). With the use of PNA probes and the omission of permeabilization and improvement to hybridization, it is possible to run a FISH assay in one step instead of ve (106). Shrestha et al. (35) reported distinguishing MSSA from MRSA strains in approximately three hours using PNA probes and a FISH assay visualized with a owcytometer. Since FISH probes for SA cannot distinguish sub-stains (87), the determination of antibiotic susceptibility of SA with FISH was previously implied (107), but not thought practical until this report (35). The FISH procedure used was indirect (35); blood cultures were re-cultured in growth medium with or without antibiotics. Dierences in cell-counts and signal between the stains was then detected with a PNA based FISH assay and a ow-cytometer (35). Unlike other tests for susceptibility which take a day to complete (22), this study could determine susceptibility with FISH the same day as the Gram-stain result was available (35). The current high cost of PNA probes (Advandx, AC005) (50) and ow-cytometry may deter its routine use. This could change with the lapse of the original patent (108) and the development of inexpensive and easy-to-use desktop ow-cytometers (BD Accuri, C6).
1.4 Improving the FISH for identification of S. aureus directly in blood cultures 13
Table 1.2: FISH studies that have identied SA. Specimen source/type Blood culture Specimen form Planktonic Culturing be- Reference fore FISH Yes (88, 37, 109, 103, 104, 105, 110, 111, 112, 113, 50, 52, 114, 32, 40, 68, 35) (115) (116) (39) (117, 118, 119, 120) (28) (107, 102) (121) (79, 80) (122, 123, 124, 125, 126, 127, 128, 129, 130) (90) (89) (131, 132) (121) (33) ISH assay (100, 63, 62) (19, 87, 133, 85, 134, 135)
Brain abscess Bone
Non-planktonic Non-planktonic
No No Yes No No Yes No No No
Cerebrospinal uid Planktonic Ear Heart valve Non-planktonic Non-planktonic
Laboratory strains Planktonic Menses Milk Nose Planktonic Planktonic Non-planktonic
Sputum Stool Throat Tampon Urine Whole-blood Wound
Planktonic Planktonic Non-planktonic Non-planktonic Planktonic Planktonic Non-planktonic
No No No No No No No
Planktonic specimens contain free-oating pathogens in dilution. Non-planktonic specimens contain pathogens adhered to its matrix or tissue.
14
Introduction
1.4.2
Limitations of FISH as applied to S. aureus
In spite of the new developments to the FISH assay, its use is not often reported in routine microbiology. There could be a number of reasons for this. Most of the decisions about the treatment of septicemia are made at the time of blood collection or after its culturing (23). The FISH assay reported in blood culture studies cannot be applied to whole-blood and so cannot be used at that time to indicate SA. The sensitivity of the assay is limited to 103 to 104 cfu/ml (colony forming units) or more (39, 40) and the blood from septic patients contains SA at no more than 10 cfu/ml and often only 1 cfu/ml or less (41). An ISH assay can be applied to whole-blood (100, 63, 62), but its use is not widely reported as it is laborious and complex. The application of FISH to positive blood cultures is also problematic. Blood cultures delay the start of FISH by two days (60, 21) and remove most of the collectible in situ data (20). FISH can identify SA in 45 minutes, but this may be too long after Gram-staining, which can be completed in 10 to 20 minutes (23), for it to inform treatment (68). The delay to the start of FISH and the time taken for its completion (21) are disadvantages that other tests, performed after a blood culture to identify SA, share with FISH (22, 60).
Preparation of specimens and reagents Material in the specimen can interfere with the FISH procedure and its signal. The probe can bind non-specically to the specimen or be unable to access SA (42, 43). The signal from SA can be concealed by the specimen or be overwhelmed by its autouorescence (136, 47). Signal interference from debris in the blood cultures is usually not an issue (18), but can be if FISH is applied to blood cultures that are accelerated (137) or to specimens that are not cultured (121). There are several possible approaches to avoid interference. Separation and purication of the specimen can increase its ratio of SA to non-target material (42, 138, 43). The specimen can be pretreated with reagents that block its non-specic binding to the probe (100, 76). Selective lysis of the specimen can make SA more accessible to probes (19). The specimen can be illuminated at longer wavelengths to reduce its autouorescence (40).
1.4 Improving the FISH for identification of S. aureus directly in blood cultures 15 These additional treatments, however complicate the FISH procedure, disrupt the specimen matrix and, if overdone, can weaken and reduce the resolution of the signal from SA (100)
Aspects of permeabilization of S. aureus The use of a FISH assay with DNA-based probes applied to slides has drawbacks (139). If it is not done correctly, preparation of its reagents and the procedure at each step can lead to a poor signal from the probe (38). The formulation, storage of its reagents and their correct application is not simple (44). Determining the correct concentration involves the titration of reagents against reference strains of SA and testing with FISH (32). The concentration of the reagent is optimal when SA produces the highest signal and SE generates a weak or non-existent signal (140). A poor signal from the FISH assay is often a result of inadequate xation or permeabilization of SA. Insucient permeablization of SA is possibly the most common cause of a weak or non-detectable FISH signal and a false-negative result (103, 93). The xation step is important because its failure can cause the permeabilization step that follows it to also fail. Over-xed SA can be resistant to permeabilization, which then reduces the access of the probe to SA, its binding and the signal of labeled SA. In contrast, under-xed SA can lyse when permeabilized and its cells and signal are lost (39). Even if the xation of SA is correct, the permeabilization of SA that follows can still fail. As described, poorly permeabilized SA can result in no signal or loss of cells. To avoid an incorrect result, reference stains of SA can be tested with FISH and the assay adjusted if the signal is incorrect. This pretesting with FISH, however complicates and delays its implementation (32). Once it is optimized, the xation procedure is easily repeated. This is not the case with the SA permeabilization reagents lysozyme (141) and lysostaphin (95). When rst prepared, these enzymes require titration and testing with FISH against reference strains of SA to determine their correct concentration for permeabilization. If these lytic enzymes are applied again after their long-term storage, this testing is repeated.
16
Introduction
Duplex binding of DNA to RNA
The correct xation and permeabilization of SA is a prerequisite for the successful detection of SA with DNA-based FISH. Nonetheless, if the conditions for its hybridization and washing are not ideal, the probe signal can also be weak or non-specic (142). If the stringency of the hybridization and washing buer is incorrect, probes can either bind indiscriminately or not at all (140). Even if hybridization of SA is correct, the washing step may be incorrect and fail (143). A further complication is that probe sequences for SA dier in their capacity to dierentiate SA from SE (Appendix B) (52) and incorrect labeling of SE can be worsened by the conventional washing buer which relies on NaCl alone to adjust its stringency (142). Formamide is eective at denaturing nucleic acids (144), but it is absent from the washing buer as it is toxic, dicult to dispose of and thus cannot be used in the larger volumes of washing buer used to remove the unbound probe (142).
Steps can be taken to improve the signal dierentiation of SA from SE. The signal can be amplied by tyramide signal amplication and multiple labeling with probes, but this complicates the assay (145, 45). In silico calculations can be run to predict the optimal formamide and NaCl concentrations for the probes and incubation conditions (99). These calculations can reduce the time spent in the laboratory optimizing the hybridization and washing reagents and the likelihood of their incorrect application and a poor result (92). In silico calculations can also predict those probe sequences with the greatest capacity to dierentiate SA from SE (52) and can then optimize the assay to this chosen probe sequence (92). As well, an extra non-toxic denaturing reagent can be added to the washing buer to improve its stringency control (144).
In summary, DNA based FISH is simple and rapid to carry out, but the preparation of its reagents and their quality control complicates its implementation in routine diagnostics (37, 40).
1.5 Improvements required for the application of FISH in the detection of S. aureus
17
1.5
Improvements required for the application of FISH in the detection of S. aureus
This project addressed some of the deciencies of the FISH assay as a test for septicemia (146), by choosing SA as a target for its investigation. Apart from its clinical importance in septicemia and other infections (55), SA is easily misidentied with CoNS such as SE (19). The blood culture and Gram-stain tests indicate, but do not identify SA with certainty (18) and so a test is needed to conrm its identity (44). Furthermore, SA is peculiar in DNA-based FISH as it, unlike other Gram-positive bacteria, is resistant to the permeabilizing eect of lysozyme, but sensitive to the action of lysostaphin (147). Thus, a DNA-based FISH assay developed for SA, with its permeabilization simplied or omitted, could be applied to other pathogens (32). There were also practical reasons for selecting SA. The safe handling of clinical isolates of SA at a non-clinical location was not onerous. It could be stored long-term (86) and, when it was needed, quickly cultured for testing with FISH. Firstly, the project investigated the conventional slide and DNA-based FISH assay used to detect SA (Chapter 3). Established probe sequences for SA were tested. It was not known if these probes for SA were optimal or if new, more ecient probes could be identied (1). The conventional method for formulation of reagents was reassessed. Preparation of these reagents for FISH was lengthy and it was hoped that it could be shortened (2). It was not known if the conditions typically used were optimal or merely followed convention (2). The standard incubation conditions for permeabilization, hybridization and washing were optimized. These incremental improvements were then used to further shorten the turnaround time of the FISH assay. It was not known if shortening the FISH assay to less than 45 minutes (32) would also compromise its signal and accuracy (3). Since the investigation focused on basic aspects of FISH procedure, PNA and ow-cytometry were not tested in this project.
18
Introduction
1.5.1
Re-engineering FISH for the detection of S. aureus
Next, the project investigated new approaches to the identication of SA with DNAbased FISH (Chapter 4). Alternatives to the use of lysostaphin were tested (4). For a DNA-based FISH assay that detects SA as well as other pathogens, three permeabilization treatments are normally applied (52): (i) lysostaphin and lysozyme for SA (32), (ii) lysozyme for other Gram-positive bacteria and (iii) no treatment, apart from xation, for other pathogen types (37). If an alternative to lysostaphin were found, the FISH procedure would be simpler to carry out and its costs possibly halved. An alternative could also be to simplify the preparation for FISH as the initial preparation of lysostaphin is exacting and once diluted, its activity needs to be monitored as it declines with time (95). Alternatives to the formamide-based reagents, incubators and water-baths commonly used with FISH were tested. Functionally the hybridization and washing buers are similar (142) as both are used to denature nucleic acid. The use of formamide (142), however is restricted to the hybridization buer as it is toxic (144) and large volumes are used in washing (40). As a result, the washing buer may not be as ecient at removing unbound probe. The denaturing eciency of FISH might be increased and assay preparation simplied if a non-toxic alternative to formamide (142) were found which could be used in all incubations (144). With more robust FISH buers, it might become practical to carry out the assay without an incubator or water-bath. This equipment is usually purchased specically for FISH and can take up bench-space which might otherwise be better used.
1.5.2
Issues concerning the use of FISH for the detection of S. aureus in complex samples
Lastly, the project investigated solutions to the management of interference of the FISH procedure and signal from material in the specimen. Blood cultures do not usually suer this interference as the proportion of debris is low (32). Specimens that are directly tested (116) or rapidly cultured (137), however have a higher proportion of
19
background material or debris. This can then block access of the FISH probe to SA, can hide the SA and can autouoresce and overwhelm the FISH signal (44, 121, 39, 125). Two techniques for reducing interference were investigated: the purication of the specimen (138) and the time-gating of its autouorescence (46, 47). An example of time-gating is illustrated in Figure 1.1. Giardia lamblia cells were labeled with a europium long-lifetime probe (136) using an immunouorescence technique and then visualized by time-gating the signal (148).
20
Introduction
(a) Ungated uorescence image
(b) Time-gated luminescence image
Figure 1.1: (a) Micrographs of pond water containing occulation. Giardia lamblia cysts were immunouorescently labeled with a europium chelate and then inoculated in the water and illuminated at 365 nm; they uoresce a bright red. (b) The same view of the specimen with the UV emission time-resolved with a time-gated autosynchronous luminescence detector (GALD). Micrographs included with permission from Russell Connally (148).
21
Sample purication and preparation technique The aim of reducing specimen interference deserves more comment. As a rst approach, and before testing with an ISH assay, the project investigated purifying whole-blood spiked with SA (138). Purication increases the ratio of SA to non-target material (138). By removing non-target material, probe access is improved and autouorescence reduced (42, 138, 43). Purication has its own disadvantages; it disrupts the specimen, alters in situ data and can lengthen the time taken for the preparation of the FISH procedure (138). Of possibly greater concern is the potential purication has for removing SA with other material (42, 43). Separation and removal of non-target material from SA is only of use if it can be done accurately, rapidly and simply.
Reduction of autouorescence in uorescence microscopy As a second approach, the autouorescence signal was blocked or time-gated (referred to as time-resolved) so that it did not interfere with observation of the FISH signal (47). Time-gating the signal lessens the need to apply other treatments for autouorescence such as purifying the specimen or illuminating it at longer-wavelengths (136). These treatments can remove SA or reduce its resolution when viewed with a microscope. Time gating illuminates the specimen with short (800 s) pulses, blocks its rst emission, but captures emissions that follow after a predened gating period (Figure 1.2) (148). This time gated luminescence microscopy (TGLM) technique relies on probes with long lifetime emission. After the excitation pulse ends the initial short lifetime autouorescence (and conventional uorophore), emission (tens of nanoseconds) is blocked until its decays (47). The emission from the luminophore probe that lasts longer (10 to 100s of microseconds), is observed free of autouorescence (47). The detection of pathogens by time-gating cells labeled with luminophore probes using an in situ hybridization (ISH) assay is not often reported. The equipment needed is specialized (136) and its signal can be weak (149, 150). Its occasional use can be attributed to the probes (referred to as chelates) used, which have relatively poor stability and solubility (151). To overcome the limitations of the chelates, changes were
22
Introduction
made to the ISH assay that complicated and lengthened it. These included blocking steps, overnight incubations and signal amplication with streptavidin conjugates (149) or tyramides (150). This rendered the time-gated ISH assay unsuitable for most routine diagnostics (45). Immunouorescence might be well suited as its labeling is exterior to the cell (136), but as discussed, its use with SA is limited (83). As a possible remedy, a new europium chelate (BHTEGS), which had properties that were more desirable than those of earlier chelates (151), was developed by a research group at Macquarie University (personal communication with Russell Connally). This chelate was stable and soluble enough that it could be conjugated directly to DNA (KT18 5- GCAAGCTTCTCGTCCGTT -3) so that SA could be labeled with a rapid assay based on FISH. The labeled SA was then time-gated with a newly developed GALD device (148). This is the rst report on the application of the chelate, the LISH assay and GALD to the detection of SA.
23
Figure 1.2: The time-resolved technique uses the dierence in the emission lifetime of a europium chelate (BHTEGS) and the autouorescence of the specimen. The schema of TGLM shows time on the X-axis and the intensity of the luminescence from the pathogen is on the Y-axis. The specimen is illuminated with pulses, but the capture of its emission is delayed (referred to as gated) until the short-lived autouorescence has decayed. The luminescence from the europium chelate is then collected without this background signal. Illustration is included with permission from Russell Connally (148).
24
Introduction
1.6
Outline of the thesis
The Chapters in the thesis address, in order, the aims of the project. Chapter 2 describes the broad aspects of the methodology used in this project, structured around the ve steps of the whole-cell prokaryote FISH assay (30). Chapter 3 reports on improvements to the FISH assay commonly used to detect SA in blood cultures (32): 1. Established and new probe sequences for the identication of SA with FISH were assessed. This was published in a peer reviewed journal and included as such: Lawson TS, Connally RE, Vemulpad S, Piper JA. In silico evaluation and testing of uorescence in situ hybridization 16S rRNA probes for Staphylococcus aureus. Lab Med 2011;42:587-591 (1). 2. The preparation and storage of reagents for FISH was shortened. A FISH technique that used probes of large molecular-weight was optimized for the detection of SA. This was published in a peer reviewed journal and included as such: Lawson TS, Connally RE, Vemulpad S, Piper JA. Optimization of a two-step permeabilization uorescence in situ hybridization (FISH) assay for the detection of Staphylococcus aureus. J Clin Lab Anal 2011;25:359-365 (2) 3. The FISH procedure for the identication of SA was shortened so that it could be completed in half an hour. This was published in a peer reviewed journal and included as such: Lawson TS, Connally RE, Vemulpad S, Piper JA. Express uorescence in situ hybridization methods for the detection of Staphylococcus aureus. Clin lab 2011;57:789-794 (3). Chapter 4 reports on the re-engineering of the FISH assay for the identication of SA: 1. A novel FISH technique free of the SA permeabilizing reagent lysostaphin was developed for the detection of SA. This was published in a peer reviewed journal and included as such: Lawson TS, Connally RE, Iredell JR, Vemulpad S, Piper JA. Detection of Staphylococcus aureus with a uorescence in situ hybridization that does not require lysostaphin. J Clin Lab Anal 2011;25:142-147 (4).
1.6 Outline of the thesis
25
2. A novel FISH technique free of formamide, an incubator and a water-bath was developed for the detection of SA. This was published in a peer reviewed journal and included as such: Dimethyl formamide-free, urea-NaCl uorescence in situ hybridization (FISH) assay for Staphylococcus aureus. Lett Appl Microbiol 2012;10.1111/j.1472-765X.2011.03197.x:(in press) (5). Chapter 5 reports on an investigation into the reduction of specimen autouorescence which can overwhelm a FISH signal (47). Techniques were tested for removal of nontarget material from the specimen. A new europium chelate BHTEGS was trialled. The probe made it possible to apply a rapid in situ hybridization assay similar to FISH and which could rapidly detect SA in complex blood specimens which exhibited autouorescence. Chapter 6 summaries the ndings of the project and draws conclusions from its results. Appendix A includes the following two publications that also emerged from the thesis (6, 7): 1. Lawson TS, Connally RE, Vemulpad S, Piper JA. In reference to targeted imaging modality selection for bacterial biolms in chronic rhinosinusitis and dierent biolms, dierent disease? a clinical outcomes study. Laryngoscope 2011;121:20432044 (6). 2. Lawson TS, Connally RE, Iredell JR, Piper JA. The simultaneous detection and dierentiation of staphylococcus species in blood cultures using uorescence in situ hybridization: A comment. Med Princ Pract 2011;20:390-391 (7). These letters provide commentaries on contemporary SA FISH studies, in light of the ndings of this thesis. Appendix B provides technical details on the binding anity of established and new oligonucleotides specic for SA (98).
26
Introduction
2
Methodology: FISH with rRNA-targeted oligonucleotide probes
The uorescence in situ hybridization (FISH) method, used by this project to identify S. aureus (SA), is described in this Chapter. This method labels 16S rRNA in whole prokaryote cells such as SA with DNA probes conjugated to uorophores (38). DNA probes are less ecient at crossing the cell-wall and accessing their targets than peptide nucleic acid (PNA) based probes (102), but are better suited to routine work as they are far less expensive. The FISH method labels RNA; as this type of nucleic acid exists in high numbers within prokaryote cells and it can thus produce a signal of high intensity (140). A sub-type of rRNA, 16S rRNA is usually the target of most established FISH probes for SA (44) since knowledge of its prokaryote sequences is relatively comprehensive (88, 64) and accurate (84). The identication and dierentiation of SA from Staphylococcus epidermidis (SE) with FISH is the focus of this project. The labeling of SA with FISH is not as straightforward as the labeling of other pathogens such as Escherichia coli (EC). SA requires permeabilization with lysozyme and lysostaphin for DNA probes to cross the cell-wall (147, 52). The 16S rRNA sequence for SA is almost identical to that for SE (1). SE is a frequent contaminant of blood-cultures and its appearance in Gram-stains can 27
28
be indistinguishable from SA (48). In contrast, E. coli requires simple xation with alcohol and no permeabilization before it can be labeled with FISH and its 16S rRNA sequence is dissimilar to other common pathogens (52). SA was chosen as a target in part because its labeling with DNA probes and FISH is more complex than other pathogens (52). SE was chosen to act as a negative control as its appearance is similar to SA and its 16S rRNA is almost identical. If simplied, the methods developed for SA could be applied to other less demanding pathogens. The reverse scenario is less likely to be true. A single pathogen and not multiple pathogens was also chosen as it permitted a greater focus on the methodology of FISH. As the extra complexity associated with targeting more than one type of pathogen was avoided (32), a greater number of experimental iterations could be tested each day. A recent report by Poppert et al. (32), which developed a new FISH assay for SA (referred to as accelerated), was taken as the starting point for this project. This accelerated method was chosen as it had a 45 minute turnaround time, the fastest reported for the detection of SA and used DNA probes to test blood-cultures, the most common specimen type tested for SA (32). Apart from its turnaround time, other aspects of this FISH method were conventional. This is illustrated in Table 2.1 which lists the accelerated method (32) and another method (referred to as comprehensive) recently used by Gescher et al. (64). Although the accelerated method (32) is over two times shorter than the comprehensive method (64), both methods share the same components of the FISH assay. They both have ve steps (or six if microscopy is included): (i) specimen preparation, (ii) xation, (iii) permeabilization, (iv) hybridization and (v) washing. Both used slides for testing blood-cultures with DNA probes targeting 16S rRNA and were visualized with an epiuorescent microscope to nd SA. The accelerated FISH method (32) was not only used as a starting-point for the project, but also as a control throughout the project. If a new and enhanced FISH method was developed, it was not considered a practical improvement unless it demonstrated the same accuracy and signal intensity as the accelerated method (32). The FISH methods developed and tested in this project applied, like the two methods listed in Table 2.1, DNA probes to SA axed to slides and were visualized with
29
an epiuorescent microscope. This diers from other FISH studies that have used confocal microscopes (36) or ow-cytometer (105, 34) for the visualization of the probes. Confocal microscopy (36) has a high sensitivity and can be useful in tissues that have thickness. Flow-cytometer also has a high sensitivity, can collect quantitative data and be automated (105). They both can be costly and complex to carry out, however and were not thought necessary for an investigation of core aspects of the FISH procedure. It should be noted that the prokaryote FISH method tested by the project diers from FISH reported elsewhere that targets eukaryote chromosomes and their abnormalities (152).
30
Table 2.1: A comparison of the FISH methods described by Poppert et al. (32) and Gescher et al. (64) for the detection of SA. Accelerated FISH (32) Preparation: Blood culture isolates were diluted with PBS (1 min), spotted to slides (1 min), air-dried (5 min), xed with methanol (10 min) and air-dried (1 min). Permeabilization: Slides were spotted (1 min) with lysis reagent (2 mg/ml lysozyme, 100 g/ml lysostaphin (147, 52), 10 mM TrisHCl at pH 8.0) and incubated at 46 C (5 min), washed with methanol (3 min) and air-dried (1 min). Comprehensive FISH (64) Preparation: Blood culture isolates were xed with ethanol (1 min), spotted onto slides (1 min) and air-dried (5 min).
Permeabilization: Slides were spotted with 1 mg/ml lysozyme (1 min) and incubated at 30 C (10 min). Lysozyme was removed (1 min), slides were spotted with 1 mg/ml lysostaphin and incubated at 30 C (5 min) (32). Slides were washed with ltered (Milli-Q, MQ) water (1 min) and air-dried (5 min). Hybridization: Hybridization buer (40% formamide, 0.9 M NaCl, 20 mM Tris-HCl at pH 7.3, 0.01% SDS, 10 pM of probe and MQ water) was spotted to slides (1 min) and incubated at 49 C (90 min). Washing/Mounting: Slides were washed with water (1 min) and mounting media added with DAPI (1 min).
Hybridization: Slides were spotted with hybridization buer (30% formamide, 0.9 M NaCl, 10 mM Tris-HCl at pH 8.0, 0.01% SDS, 25 ng/ml probe and MQ water) (1 min) and incubated at 46 C (10 min).
Washing/Mounting: Slides were incubated with washing buer (0.112 M NaCl, 10 mM Tris-HCl pH 8.0, 0.01% SDS, 5 mM EDTA and MQ water) at 48 C (5 min) and air-dried (1 min) Total time: 45 minutes.
Total time: 127 minutes.
2.1 Preparation of reagents, probes and S. aureus samples
31
2.1
Preparation of reagents, probes and S. aureus samples
To save time, the hybridization buer and washing buer were prepared in advance (2). Hybridization buer (0.9 M NaCl (153), 20 mM Tris-HCl, 0.01% (w/v) SDS, and 1 g/ml DAPI) with no formamide or with 60% (v/v) deionized formamide were prepared and stored for up to a year at -20 C in 5 ml sterile plastic screw-top tubes (2). The hybridization buer contained DAPI. Many FISH studies counter-stain the cells with a general DNA intercalating uorescent dye such as DAPI (94, 36, 34) or Hoechst (85) as a control for visualizing target and non-target pathogens and for cell counting (85). When needed, the buers were thawed and mixed to the desired target formamide concentration (2).
2.1.1
Hybridization and post-hybridization washing buer preparation
NaCl (Sigma, S619) was prepared at a 5 M concentration as stock solution in MilliQ (MQ) water (Millipore), sterilized with a 2 m syringe-lter and stored at room temperature. NaCl was diluted to 0.9 M (153) and used in the FISH buers to increase the stability of nucleic acid duplexes (142). Hydrochloric acid (HCl) (Sigma, H1758) and Sodium hydroxide (NaOH) (Sigma, S8045) were used to adjust the pH of the buers and other reagents such as Tris-HCl. Most buering with Tris-HCl was in the physiological range of pH 7.0 to 8.0 and at concentrations of 10 to 100 mM (87). TrisHCl was prepared with Trizma hydrochloride (Sigma, T3253), MQ water and Trizma base (Sigma, T1503) and HCl was used to adjust the pH. It was sterilized with a 2 m syringe lter before use. Sodium dodecyl sulfate (SDS) (Sigma, L4390) was used at low concentrations (0.01 to 0.02% v/v) in hybridization and washing buers as a surfactant and as a mild permeabilizing agent (87). SDS was added to MQ water and the solution was mixed and heated to 68 C until the SDS dissolved. SDS was not autoclaved, but instead was
32
sterilized with a 2 m syringe lter.
Formamide and in situ hybridization Formamide was used to destabilize nucleic acid duplexes in the hybridization buer (87). The buers stringency was adjusted with the formamide against a xed 0.9 M concentration of NaCl (153, 142). No preparation of the formamide was necessary if it was already deionized (Applichem, A2156) and fresh (colorless). Fresh deionized formamide was aliquoted and stored at -20 C for up to one year before use. If de-ionization of the formamide was needed, wet mixed bed ion exchange resin 5% (w/v) (Sigma, Amberlite c MB-1 hydrogen and hydroxide form, 501999) was added, removed with a coee lter and the formamide supernatant stored as described above. Urea (153) was also used as an alternative denaturing agent for formamide (142) because formamide is toxic and dicult to dispose of (144). Stock solution of urea (Sigma, U6504) was prepared at 80 M and ltered before use. The ideal formamide concentration to use with a probe was predicted with in silico calculation and conrmed by testing with FISH (92). The melting temperature of an oligonucleotide probe binding to SA was calculated with the formula 81.5 + 16.6(log M [Na+]) + 0.41(%G+C) - 0.72(% formamide) or with a corresponding and easier to use online algorithm such as mathFISH (mathsh.cee.wisc.edu) (92) (Figure 2.1). G and C are the number of Guanine and Cytosine bases in the sequence. The melting temperature of a probe is when 50% of its sequence is annealed to its target (84). If the incubation temperature and NaCl concentration is kept constant, the melting temperature of a buer can be adjusted with formamide. As the formamide is increased so that the melting temperature of the nucleic acid is lower, the stringency of the buer also increases and the likelihood of mismatched DNA:RNA binding decreases. To conrm the ideal formamide concentration for a probe, the hybridization buer was prepared with formamide at 15% (v/v) increments from zero to 60%. A FISH assay was then applied, that used these dierent concentrations, to reference strains of SA axed to slides. The concentration with the highest signal intensity from the FISH probe was chosen. Most probes can maintain a signal over two increments of
33
formamide (140). If two of these formamide concentrations were optimal, the higher concentration was chosen as it is less likely to produce a non-specic signal. For most of the probes tested in the project, formamide at 30% (v/v) produced an adequate signal and was prepared by mixing the 60% prepared buer at 1:8 with the buer that contained no formamide. This is about 5% higher than the lowest formamide concentration for the probes calculated with mathFISH (92) in Figure 2.1. The calculations assumed 47 C incubation, 0.9 M NaCl (153) and 1 M of probe in the buer. The oligonucleotide could be added to this buer mix and stored at 4 C in 1.5 ml sterile plastic aliquots for a week before the FISH assay was run.
Figure 2.1: The hybridization eciency of EUB338, KT18-16S68, Staaur or Staphy probes to SA by the amount of formamide in the buer. [FA]m is the melting formamide concentration for the DNA:RNA duplex (92).
Buer type in the washing media In an approach similar to the preparation for the hybridization buer, washing buer without salt (20 mM Tris-HCl, 5 mM EDTA and 0.01% (w/v) SDS) and with 1.8 M NaCl was prepared and stored for up to a year at 4 C in one liter bottles (Schott,
34
GL45) (2). When needed, these buers were mixed to their target NaCl concentration in a 50 ml tube and preheated in a water-bath to 47 C. The concentration of NaCl used in the washing buer was a function of the concentration of formamide used in the hybridization buer (Table 2.2) (143). The formamide concentration was determined, as noted before, by the probe and target pathogen sequence used (Figure 2.1) (92). The NaCl concentration was conrmed by testing with FISH in the laboratory at 0.014, 0.04, 0.112, 0.318 and 0.9 M NaCl concentrations (143). The NaCl concentration was optimal when the ratio of SA signal to SE signal was at its highest (140). Low concentrations of ions can aect the stringency of the buer. To counter-act this, ethylenediaminetetraacetic acid (EDTA) (Sigma, EDS) was used as a chelate in the washing buers when the NaCl concentration was lower than 0.225 M (102). It was also used as a chelate in washing buers that contained sodium citrate buer (SSC) (116). In addition, it was added to the TE buer (TE is 10 mM Tris-HCl and 1 mM EDTA) to protect stock solutions of uorescent probes and to blood as an anticoagulant. Stock solution of EDTA was prepared at 0.5 M, sterilized with a 0.2 m syringe lter and stored at room-temperature before use.
35
Table 2.2: NaCl (M) in the washing buer as a function of formamide (%) in the hybridization buer (142, 143). Formamide(%) NaCl (M) 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 0.900 0.636 0.450 0.318 0.2250 0.159 0.112 0.080 0.056 0.040 0.028 0.020 0.014 -
The percentage of formamide is depended upon the particular probe(s) sequence to be hybridized as indicated in Figure 2.1.
36
2.1.2
In Silico Evaluation and Testing of FISH 16S rRNA Probes for S. aureus
FISH oligonucleotide probes that are unique to SA were identied and then assessed. Only 16S rRNA targets was considered. Its sequences for most pathogens are well documented, but there were no established probes that targeted the 18S or 23S rRNA of SA (84). To identify unique SA sequences, SA and other non-target pathogen 16S rRNA sequences were collected from the NCBI-Nucleotide database (ncbi.nlm.nih.gov/nuccore) (97). Pathogens that had a similar 16S sequence to SA were identied (rdp.cme.msu.edu) (154). When aligned with the online tool NCBI-Blast (blast.ncbi.nlm.nih.gov), SE had an almost identical 16S rRNA sequence to SA (97). SE is a benign microbe often found in blood-cultures as a contaminant and often misidentied as SA. The near perfect alignment of SA to SE meant that any mismatches identied between the two would probably be unique to SA and that their number would be small. For this project, a typical sequence for SA (GenBank: CP000253.1) and one for SE (GenBank: AF397060.1) were aligned and mismatches were identied at 69 to 89, 183 to 198, 452 to 477 and 999 to 1024 positions relative to E. coli 16S rRNA (97, 155). The uniqueness of the identied mismatched sequences to SA was then conrmed by reapplying it to other pathogen sequences (microbial-ecology.net/probecheck). The sequence 999 to 1024 was not unique to SA and so was not considered further. SA shared this sequence with Staphylococcus haemolyticus which is also occasionally detected in blood-cultures (65).
Quantitative assessment of oligonucleotides for S. aureus To assess the usefulness of an oligonucleotide, the Go
overall
(DeltaGo) and the hy-
bridization eciency of its sequence were calculated (92). DeltaGo indicates the probability of a probe to target binding (DNA:RNA) given the competing interactions of probe (DNA:DNA) and target (RNA:RNA) self-binding (156). The higher the negative number, the higher the binding potential of the probe to their targets. Hybridization
37
eciency indicates the predicted ratio of target molecules bound with probe to all the target molecules. A hybridization eciency of one is equal to saturation binding and zero to no binding. Several criteria can be used to judge the anity of a particular oligonucleotide to SA (Table 2.3). A DeltaGo between -17 and -13 kcal/mol for SA, a dierence in DeltaGo between SA and SE greater than 3 kcal/mol, a dierence in formamide concentration of 20% (v/v) and hybridization eciency greater than 0.8 indicates a highly sensitive sequence. A DeltaGo greater than -13 kcal/mol and less than -10 kcal/mol to SE and a hybridization eciency greater than 0.8 indicates a highly specic sequence (92).
38
Table 2.3: A guide to judging the performance of a probe sequence to SA and SE. Sensitivity Low G target (kcal/mol) G non-target (kcal/mol) G dierence (kcal/mol) FA dierence (%) HE target (ratio) HE non-target (ratio) HE dierence (ratio) < -17 < -13 <3 < 20 NA > 0.1 < 0.9 High -17 to -13 NA >3 > 20 > 0.9 NA > 0.9 Specitivity Low > -10 NA NA NA < 0.9 NA < 0.9 High NA > -10 NA NA NA < 0.1 > 0.9
Thermodynamic descriptor
Thermodynamic calculations assume a single DNA probe binding to a target 16S rRNA sequence (92). Sensitivity = TP/(TP+FP), where TP= true positive and FP = false positive. Specicity = TN/(TN+FN), where TN = true negative and FN = false negative. Low and high sensitivity and specicity cutos were based on Yilmaz et al. (92) Overall Gibbs binding potential of probe (DeltaGo kcal/mol) (156). The DeltaGo indicates the standard state overall Gibbs free energy of the probetarget hybrid: the probability of probe to target binding (DNA:RNA) given the competing interactions of probe (DNA:DNA) and target (RNA:RNA) self-binding. The higher the negative number, the greater the probe-target binding anity (156). NA: not applicable. G dierence = DeltaGo target - DeltaGo non-target (96). Melting formamide concentration (FA %) for the probe-target duplex (99). Hybridization eciency (HE) indicated the predicted ratio of target molecules bound with probe to all target molecules. A hybridization eciency of 1 indicated saturation and 0 no hybridization (98). HE dierence = HE target - HE non-target (92).
39
The sequences 183 to 193 and 452 to 477 were judged to have a low hybridization eciency (98). The 69 to 89 was analyzed in more detail with probes of 18, 19, 22, and 25 bases long (Figure 2.2). A pattern emerged where the 5 end of a potential probe was most ecient at the 65 to 67 positions. Probes from 15 to 30 bases were tested at this location using the mismatch feature of mathFISH (96), and a number of potential probe candidates were realized including all the established probes already reported for SA. These calculations assumed 47 C incubation, 0.9 M NaCl (153) and 1 M of probe in the buer.
Figure 2.2: The 5 end binding anity (Go overall ) of 18, 19, 22, 24 and 25 bases long oligonucleotides to the 54 to 73 SA 16S rRNA sequence.
40
2.1.3
In situ probing of S. aureus with specic 16S rRNA targeted oligonucleotides
The sequences that were identied as highly specic to SA were then tested as uorescent probes with FISH. This included two probes KT18 (16S68: 5- GCAAGCTTCTCGTCCGTT -3) (1) and STAAUR (16S69: 5- GAAGCAAGCTTCTCGTCCG -3) (87) specic for SA and STAPHY (16S697 5-TCCTCCATATCTCTGCGC-3) (87) specic for Staphylococcus. EUB338 (16S337: 5- GCTGCCTCCCGTAGGAGT -3) (157) specic for eubacteria was used as a positive control. More detailed information on the alignment and binding anity of these sequences to SA and SE is provided in Appendix B. The oligonucleotides were either directly conjugated to uorophores (157) or biotinylated (100) at the 5 end. The uorophores that were used were Dylight R 488 (Jackson), Alexa Fluor R 488 or 555 (Invitrogen) and FITC or Cy3 (Genworks) (2). For the time-gated luminescence microscopy (TGLM) visualization of the europium (Eu3+) BHTEGS chelate (developed by a Macquarie University research group), a member of this research team (Russell Connally) conjugated the new Eu3+ chelate BHTEGS to the sequence KT18 (1).
Oligonucleotide resuspension, and storage DNA oligonucleotides were supplied (Invitrogen or Geneworks) and stored dry for up to a year at 4 C. To use, these probes (as well as salmon sperm DNA) were diluted in TE buer at 100 M, aliquoted out at 100 l each to reduce freeze-thaw cycles and stored for up to a year at -20 C. Before use, an aliquot of the probe stock was thawed and stored at 4 C. To use, the probes were diluted 1:100 in the nal hybridization buer mix to make 1 M and stored at 4 C and applied within a week. Oligonucleotide probes used in FISH to detect SA can be synthesized from ribonucleic acid (RNA), deoxyribonucleic acid (DNA) or peptide nucleic acid (PNA) (102). RNA is rarely used as it can be easily degraded by the ubiquitous RNase. The use of PNA (Advandx, AC005) based probes is often reported (109, 105) as they do not
41
possess a charge and so do not need to SA to be permeabilized for hybridization and can bind rapidly to their targets with a high anity (102). As they are low in cost, the use of DNA based probes is also often reported (87, 32) and were used in this project, but do need SA to be permeabilized for hybridization before they can be applied.
2.1.4
Bacterial isolates
So that isolates could be tested at a non-clinical location, clinical patient isolates of SA, SE and E. coli were collected at a major hospital (Westmead Hospital, Sydney) on agar plates. To control for potential dierences between strains, 10 isolates of each type of bacteria were randomly collected. Initial testing observed no dierence in the FISH signal between methicillin-susceptible SA (MSSA) and methicillin-resistant SA (MRSA). To lower risk, only non antibiotic resistant strains were tested further. Isolate identity was conrmed with polymerase chain reaction (PCR) (158) and then de-identied for testing. To compare FISH procedures, collected isolates were re-cultured in 50 ml tubes until turbid, aliquoted, centrifuged for three minutes at 3000 rcf, supernatant removed, frozen and stored long-term (86). Before its use, the nutrient broth was sterilized with a 2 m syringe lter. Before testing with FISH, isolates were thawed and recultured, usually for 70 minutes, in the nutrient broth until turbid (0.5 McFarland). No dierence in the signals were observed if the isolates were tested by FISH directly from the collected agar plates.
2.1.5
Separation of S. aureus from an in vitro model of bacteraemia
For the TGLM detection of SA in whole-blood, cultures of SA were washed and diluted in saline to an optical density of 1.0 at 600 nm (159). NaCl at 0.9 % (v/v) was used to dilute SA so that when the diluted SA was added, the tonicity of the blood would be maintained. Venous blood was collected from a healthy volunteer in EDTA tubes (Becton Dickinson, 367863). A simple in vitro bacteraemia model was created by
42
spiking fresh whole-blood with SA and incubating (160). For 1 ml of blood, 10 l of the SA in saline was added (1.0 optical density at 600 nm) and the blood incubated with gentle agitation at 37 C for one hour. To simplify the procedure, the incubated blood was lysed with alkaline water which released intra-cellular SA (138). The SA could then be detected with FISH. This diers from the approach taken elsewhere that separated blood components with Dextran 500 and labeled intra-cellular SA in the leukocytes with an in situ hybridization (ISH) assay (100). Lysing the blood allowed the ratio of SA to blood cells to be increased, simplied and shortened the assay and reduced non-specic labeling of the FISH probe to leukocytes and other blood debris (data not shown). The alkaline water was prepared by adding 4 mM NaOH to Milli-Q (MQ) water at pH 10.0 (138). Blood and alkaline water were then mixed at a ratio of 1:10 (to make a pH of 8.5) by vortexing and then centrifuged at 3,000 rcf. The supernatant was removed and the treatment repeated before spotting and xing the pellet to slides for the FISH procedure.
2.2
Step 1: Method for adhering specimens to slides
SA adhesion to slides can be poor if it is air-dried (40). The adhesion of SA to the slides can be increased by heat xing the specimen to slides pretreated with agarose and then, after the SA is spotted and dried, xing with alcohol (139). The number of SA that remain adhered to the slide as well as the eectiveness of permeabilization can then be quickly determined with uorescent DAPI (Sigma, D9564) stain excited with UV light. To prepare the slide, an agarose (Bio-Rad, 162-0102) bed was applied to diagnostic glass slides (Menzel-Glaser, X1XER308B). The bed was prepared by adding 0.02% (w/v) agarose with 0.01% (w/v) sodium azide (Sigma, S2002) to Milli-Q water R (MQ) (Millipore) and dissolving it in water by heating in a microwave oven without boiling (139). This diluted agarose was spotted (10 l) to each slide well and dried on a 60 C hotplate. If cell loss persisted, the broth culture of the isolates could also be diluted 1:1 in
2.3 Step 2: S. aureus fixation
43
prewarmed 0.4% (w/v) agarose (139). The agarose-isolate dilute was then spotted (10 l) to slides not treated with agarose and xed with a 60 C hotplate until dry. For specimens that were heat-xed to plain glass slides, rinsing these slides in 1 M urea was more eective than agarose at reducing cell loss (data not shown). As a further improvement to the use of slides with FISH, the specimen or reagent run-o was contained by marking the slides with a wax-pencil (Staedtler R , Chinagraph).
2.3
Step 2: S. aureus xation
Fixation was necessary to inactivate the pathogens, avoid cell lysis in Gram-negative bacteria such as EC and to improve the consistency of permeabilization and hybridization of the FISH probes. To x as well as partly permeabilize pathogens, slides with were washed in 50 ml sterile tubes with either absolute methanol or ethanol for three minutes (32). Slides were removed and dried on a 60 C hot-plate. For more rapid xation, slides of SA were spotted with alcohol, left on the bench for one minute and then dried on the hot-plate. Fixation with methanol produced a more consistent FISH signal, but was toxic to use. Fixation with ethanol was less toxic and produced a higher, but also a less consistent FISH signal.
2.4
Step 3: S. aureus permeabilization
Gram-negative bacteria were xed with alcohol and did not need permeabilization. Permeabilization with enzymes was necessary for DNA probes to reach in situ targets in Gram-positive pathogens such as SA. Most Gram-positive bacteria lysed rapidly with lysozyme. SA permeabilizes slowly with lysozyme, but quickly with lysostaphin (147). To cut preparation time, stock solutions of 30 g/ml lysozyme (Sigma, L6876) and 2 g/ml lysostaphin (Sigma, L4402) (32) were prepared and stored in 1.5 ml sterile aliquots. These solutions were frozen and stored long-term at -20 C. Unless frozen, the enzymes gradually lost their permeabilizing activity. For use, the solutions were thawed, diluted 1:1 with MQ water and 40 M Tris-HCl
44
for buering and used within a week. Lysozyme was most active at pH 7.0 and at 37
C in the absence of NaCl (141). Lysostaphin was most active at pH 8.0 and at 47 C
in the absence of formamide (95). To permeabilize in a single step, 2 mg/ml lysozyme and 0.1 mg/ml lysostaphin (147) at pH 7.0 was spotted to the slides and incubated at 47 C for ve minutes in 50 ml tubes (Greiner, 210-261) (2) before rinsing the slides in absolute methanol (32). To permeabilize SA in two steps, 10 l of lysozyme at 15 mg/ml in MQ water (147, 4), was spotted onto the slide wells and incubated in 50 ml tubes (Greiner, 210261) for six minutes at 38 C (141). The lysozyme was rinsed o with PBS (Sigma, P4417) and the slides were rapidly dried with pressurized air (32) or by centrifuging in 50 ml tubes for one minute at 100 rcf. The order of their application mattered; lysozyme followed by lysostaphin permeabilization was more eective than in the reverse order (52). Permeabilization was stopped by rinsing the slides again in absolute methanol.
Permeabilization that does not require lysostaphin To permeabilize without lysostaphin, 10 l of freshly prepared 15 mg/ml lysozyme in unbuered MQ water (147) was spotted to the slides and incubated in 50 ml tubes at 47 C for 30 minutes before rinsing the slides in absolute methanol (4). If permeabilization was performed on a 47 C hot-plate, the treatment was the same except that the slides were covered with a clear plastic lid and the incubation was extended to 40 minutes (5). The hot-plate was developed by one of the authors (Russell Connally) and had an accuracy of 0.5 C at 47 C. If the permeabilization was applied to SA separated from blood, incubation was extended to one hour. After its permeabilization and before its hybridization, the SA rRNA can be degraded by endogenous RNase. To reduce loss from RNase, the equipment and most of the reagents can be treated with RNase-Zap (Ambion, AM9780), 0.1% diethylpyrocarbonate (DEPC) (Aldrich, 159220) or autoclaved. However, in this project, no dierence was observed in the FISH signal with or without this treatment if clean laboratory standards were maintained, pre-sterilized polypropylene plastic disposables and MQ water were used and gloves were regularly changed.
2.5 Step 4: In situ hybridization with rRNA-targeted, fluorescently labeled oligonucleotides 45
2.5
Step 4: In situ hybridization with rRNA-targeted, uorescently labeled oligonucleotides
Incubation in hybridization buer binds oligonucleotides to their complementary sequences. Incubation in the washing buer that follows, washes away probe that is not fully hybridized (84). The hybridization buer uses formamide at a NaCl concentration of 0.9 M (153) to adjust its stringency (Figure 2.3) (142). In contrast, the washing buer uses varying amounts of NaCl to adjust its stringency as formamide is toxic. The formamide concentration in the hybridization buer is dependent on its oligonucleotide sequence (Figure 2.1) (92). In turn, the NaCl concentration in the washing buer is dependent on the formamide concentration used in the hybridization buer (Table 2.2) (143). The FISH assay reported by Poppert et al. (32) was applied with changes. So that a single incubator or water-bath could be used, all steps in the assay were set to 47 C (2). To reduce the reaction time and the drying out of reagents, for slide incubations, preheated 50 ml centrifuge tubes with screw-caps (Greiner, 210-261) were used (3). To simplify reagent preparation, the hybridization buers in the project mostly used 30% formamide and a washing buer set to 0.225 M NaCl (1). For hybridization, 10 l of buer [30 % formamide (v/v), 0.9 mol/L NaCl (153), 20 mM Tris-HCl pH 8.0, 0.02 % (v/v) SDS, 0.5 g/ml DAPI, and Milli-Q water] with 1 M of oligonucleotide probe was spotted to the slides, the slides were tted in 50 ml tubes and placed in a 47 C incubator for 20 minutes (32). If urea was substituted for formamide (153), 30 l of urea-NaCl [1 mol l1 urea (Sigma, U6504), 0.9 mol l1 NaCl, 20 mol l1 Tris-HCl (pH 7.0) in MQ water] with 1 mol l1 of probe was spotted to each well (5) and the slides were incubated as before. If impure or uncultured specimens were tested and non-specic binding was high, a FISH assay that was more complex than the common assay for SA was used (116). The hybridization buer [35 mM Tris-HCl pH 7.5, 2.5 standard sodium citrate buer
46
(SSC), 5 mM EDTA, 0.05% SDS, 0.05% Na-Pyrophosphate, 0.45 M NaCl, 22.5% deionized formamide] also contained blocking agents [2.5Denhardts and 50 g/ml herringsperm-DNA]. The hybridization buer was incubated twice with the specimen. The rst time without the oligonucleotide probe to block non-specic binding, and the second time for hybridization with the probe. The washing buer that followed contained 2SSC.
Figure 2.3: The melting temperature (Tm) in C of 1 M of the Staaur probe to SA by formamide (Fa %) or NaCl (M) concentration (92).
2.6 Step 5: Specimen washing with buffer
47
2.6
Step 5: Specimen washing with buer
After hybridization, slides were immediately tted into 50 ml tubes of prewarmed washing buer [5 mM EDTA (Sigma, EDS), 0.64 M NaCl, 20 mM Tris-HCl and 0.02% (w/v) SDS in MQ water] (142). Tubes were then placed in a 47 C water bath for three minutes and agitated (4). This washing action was stopped by briey rinsing the slides at room temperature in a 50 ml tube of MQ water (32). Buers other than the conventional NaCl-based washing buer were also tested. Preheated PBS was used to remove unbound probes since PBS has a surfactant quality and its ionicity is approximately 0.15 M (2). The results were not as specic as a full washing buer, but were simple to apply and adequate for rapid testing (3). Preheated urea with NaCl was also tested to remove unbound probe [8 mol l1 urea, 0.9 mol l1 NaCl (153), MQ water and 20 mol l1 Tris-HCl (pH 7.0)] (5). After washing, the slides were mounted while wet for viewing with a cover-slip. If biotinylated oligonucleotides were used (2), after the washing step, the slides were dried with pressurized air and then spotted with 10 L of streptavidin conjugated to Alexa Fluor R 488 (Invitrogen, S-32354), DyLight R 488 (Thermo Fisher, 21832) or Alexa Fluor R 555 (Invitrogen, S-32355) at 10 g/ml in PBS (145, 45). Slides were incubated at 47 C for 10 minutes, rinsed with PBS and mounted as before for viewing. For time-resolved europium chelates labeled with FISH, the hybridization buer was rinsed o with MQ water, the slides air-dried and 10 l of uorescence enhancing buer (FEB) buer (148) containing 0.4 mM Eu3+ was spotted to each well. The slides were mounted while wet with a cover-slip and left at room temperature for 20 minutes before viewing.
2.7
Direct visualization of microorganisms
SA on the slides were observed with an epiuorescence microscope (Olympus, BX51) tted with a 40 or 60 dry objective (Olympus, UPLFLN) and FITC/DAPI lters (Olympus, U-MWU2, U-MWIB2). Images were acquired at a resolution of 13601024
48
with a color camera (Olympus, DP72) and software (Olympus, DP2-BSW v2.2) set to a gain of 200 ISO and an exposure of 0.5 to 2 seconds. Fluorophores that become excited at a particular wavelength, will always emit at a wavelength that is longer. A blue light excited uorophore will usually emit green, a green excited uorophore will emit red and so on (72). The signal intensity of the FISH probe is dependent on the type of uorophore and oligonucleotide used and the accessibility and abundance of the in situ rRNA (84). Alexa Fluor R (Invitrogen) and Dylight R (Jackson) uorochromes have a higher-yield than dyes such as Cy3 and Cy5 cyanine. PNA has a higher binding anity than DNA (102). SA in exponential growth phase has a higher number of rRNA than SA in stasis and the target rRNA sequence for EUB338 is more accessible than the target for Staaur (data not shown). SA could be identied by its specic oligonucleotide signal and by its arrangement on the slide even after rst culturing. Cultures of SA tended to cluster in tetrad arrangements and cultures of SE in staphylococci arrangements (48, 79). SA and SE diered also in their reaction to permeabilization treatments (32). SA is more sensitive to lysostaphin and SE to lysozyme (147). If only lysostaphin was applied, SA labeled brightly and SE did not. If only lysozyme was applied, SE labeled brightly and SA did not.
Time-gated bio-imaging of a europium chelate label For the TGLM visualization of SA, slides were viewed with an epiuorescence microscope (BX51, Olympus) and a 40 and 60 objective (UPLFLN, Olympus) tted with a time-gated auto-synchronous luminescence detector (GALD) held in its DIC prism slot (148). The short-lived background signal of the specimen was removed and the long-lifetime probe emission was detected by gating the emission signal. The GALD device was excited with 355 nm UV from a 100 mW YAG laser source. It used a rotating element that simultaneously pulsed the specimen, suppressed its short-lived autouorescence and allowed the passage of long-lived probe emission (148).
2.7 Direct visualization of microorganisms
49
2.7.1
FISH image and statistical analysis
A representative image of each FISH experiment, that had a SA count of at least 100, was selected for analysis. These images were analyzed using standard algorithms with ImageJ (NIH, v1.43u). Counts, morphology and permeabilization of the SA were assessed against a 50 m haemocytometer grid, the FISH signal and DAPI staining (2). The SA cells were then masked with automatic thresholding so that the mean FISH signal in 8-bit Grey-scale, the size of the cells and the ratio of cells with signal to those without, could be calculated with FISH and DAPI (3). For statistical analysis, parametric assumptions were tested with a histogram of the FISH signal and a P value of < 0.05 was considered signicant. The mean signal intensity in 8-bit gray-scale, standard deviation and its 95% condence interval were calculated. The summary statistics of a new FISH treatment were compared to a control (32) with either an unpaired two-tail t-test or with a one-way analysis of variance (ANOVA) to test for a signicant dierence (3).
50
3
Improvements to the existing FISH method
The project investigated the use of FISH for the detection of S. aureus (SA) (19, 32). This Chapter reports on improvements that were made to the FISH assay during its investigation. It includes an assessment of established and newly identied probes (often called oligonucleotides) specic for SA (1). The shortening of the preparation and storage of reagents for the FISH assay is described (2). It recounts an attempt to optimize the permeabilization of SA so that probes of large-molecular weight can access SA 16S rRNA (2) without lengthening the FISH assay beyond one hour (101). Finally, this Chapter reports on the identication of SA with a FISH assay that can be completed in half the time (3) of the previous fastest reported FISH assay (32). The Chapter comprises of three sections. Each of these sections was published in a peer reviewed journal and included as such. In the rst paper, an in silico evaluation and testing of FISH probes that target 16S rRNA SA is described: Lawson TS, Connally RE, Vemulpad S, Piper JA. In silico evaluation and testing of uorescence in situ hybridization 16S rRNA probes for Staphylococcus aureus. Lab Med 2011;42:587-591 (1). In the second paper, optimization of a two-step permeabilization technique for SA is described: Lawson TS, Connally RE, Vemulpad S, Piper JA. Optimization of a twostep permeabilization uorescence in situ hybridization (FISH) assay for the detection of Staphylococcus aureus. J Clin Lab Anal 2011;25:359-365 (2). In the third paper, the 51
52
procedure for substantially shortening the typical FISH assay for SA is described: Lawson TS, Connally RE, Vemulpad S, Piper JA. Express uorescence in situ hybridization methods for the detection of Staphylococcus aureus. Clin lab 2011;57:789-794 (3).
3.1 In silico evaluation and testing of fluorescence in situ hybridization 16S rRNA probes for Staphylococcus aureus
3.1
In silico evaluation and testing of uorescence in situ hybridization 16S rRNA probes for Staphylococcus aureus
Science
53
Submitted 2.25.2011 | Revision Received 4.25.2011 | Accepted 5.13.2011
In Silico Evaluation and Testing of Fluorescence In Situ Hybridization 16S rRNA Probes for Staphylococcus aureus
Thomas S. Lawson, MSc, Russell E. Connally, PhD, Subramanyam Vemulpad, PhD, James A. Piper, PhD (Faculty of Science, Macquarie University, New South Wales, Australia)
DOI: 10.1309/LMI4L6CF6HGFBGYA
Abstract
Background: Staphylococcus aureus is a clinically important pathogen. A small number of whole-cell fluorescence in situ hybridization (FISH) probes have been reported to detect S. aureus. New online computational tools for in silico design and testing make it possible to assess candidate FISH probes for S. aureus. Materials and Methods: Six online tools, NCBI-Nucleotide, Ribosomal Database Project, NCBI-Blast, Reverse-Complement, Probecheck, and mathFISH, were employed in a workflow
to evaluate FISH probes for S. aureus. A previously reported probe Staaur-16S69 was compared to a new probe KT18-16S68 predicted by mathFISH to have the same performance. Results: A number of new probes for S. aureus were predicted to perform as well or better in silico as those previously reported. When tested in a FISH assay, Staaur and a new probe KT18 were found to have the same performance.
Conclusion: Existing and new FISH probes for S. aureus were found to be accurately identified and characterized with online computational tools. In silico evaluation of probes has the potential to reduce the time spent evaluating probes in the laboratory. Keywords: fluorescence in situ hybridization, FISH, hybridization efficiency, mathFISH, probes, Staphylococcus aureus
Staphylococcus aureus is a clinically important pathogen.1-3 Whole-cell slide based fluorescence in situ hybridization (FISH) is a molecular assay that can reliably detect and differentiate S. aureus from S. epidermidis.4-6 Fluorescence in situ hybridization detection involves hybridizing small subunit ribosomal ribonucleic acid (16S rRNA) with DNA probes.7 The accuracy of FISH is dependent upon the hybridization efficiency (HE) of its probes to S. aureus and to non-targets such as S. epidermidis.5,6,8,9 The number of probes reported to be specific to S. aureus is small.3,6,8,10,11 Until recently, probe design calculations were limited to online software provided for polymerase chain reaction (PCR).12 With new online software tools available,13,14 and mathFISH specific for FISH probe design,15 it may be possible to predict and compare
Corresponding Author
Thomas S. Lawson, MSc [email protected], [email protected]
the accuracy of these existing probes as well as identify better probes that can target S. aureus. Staphylococcus aureus also provides a unique opportunity to test the accuracy of these tools. Because of the similarity between S. aureus and S. epidermidis 16S rRNA, there are few possible misaligned sequences that can be targeted by probes. This is evident in the overlap of all reported probes for S. aureus about the 16S69 5'- AAGCTTCTCGTCCG -3' sequence as illustrated in Figure 1. Even so, the number of possible probes per misaligned sequence can still be large; about 450 for the 16S69 sequence. Online tools such as NCBINucleotide,13 Ribosomal Database Project,16 NCBI-Blast,13 Reverse-Complement,12 Probecheck,14 and mathFISH15 are useful as they can rapidly characterize these sequences. The accuracy of the tools can be assessed thoroughly by comparing predicted results to those in the laboratory from this and previous studies for the 16S69 sequence. Where probe names are listed, the original author designation is chosen first, otherwise the common name or the authors initials with the number of bases is given.
Abbreviations
FISH, fluorescence in situ hybridization; HE, hybridization efficiency; PCR, polymerase chain reaction; PNA, peptide nucleic acid; CoNS, staphylococci; FITC, fluorescein isothiocyanate
Materials and Methods Identifying 16S rRNA S. aureus Probes In Silico The S. aureus and non-target 16S rRNA sequences were acquired from NCBI-Nucleotide (ncbi.nlm.nih.gov/nuccore),17 the Ribosomal Database Project identified closely
December 2011 Volume 42 Number 12 LABMEDICINE
labmedicine.com
Science
54

5 end Common sequence 3 end
Sau66-16S66 KT18-SA68 Staaur-16S69 Staur-16S69 WQ25-16S67 S. aureus S. epidermidis 3 end 5 end
Figure 1_Alignment of S. aureus probes with S. aureus and S. epidermidis sequence rRNA. Mismatches to S. epidermidis at 16S72, 16S79, and 16S88 are highlighted. As genome 16S rRNA was aligned, thymine (T), instead of RNAs uracil (U) is shown.
related microbes such as S. epidermidis (rdp.cme.msu.edu),16 NCBI-Blast aligned S. aureus and S. epidermidis sequences NCBI-Blast (blast.ncbi.nlm.nih.gov),13 and the cross-reactivity to other microbes of identified mismatch sequences was confirmed with Probecheck (microbial-ecology.net/probecheck) against the SILVA sequence collection.14 Staphylococcus
aureus (GenBank: CP000253.1) and S. epidermidis (GenBank: AF397060.1) 16S ribosomal RNA alignment was compared, and mismatches were identified at the 69 to 89, 183 to 198, 452 to 477, and 999 to 1024 positions relative to E. coli 16S rRNA.13,14 The sequence of 999 to 1024 was not considered further as it was found to hybridize with a number of Staphylococcus species including S. haemolyticus, which is frequently detected in blood cultures.2,3 Next, the mathFISH tool analyzed the HE of each mismatch 16S rRNA sequence (mathfish.cee.wisc.edu).15 The 183 to 193 and 452 to 477 sequences were assessed to have poor HE by the oligonucleotide walk-though feature of mathFISH set at 18 bases.18 The first mismatch 16S rRNA sequence at 69 to 89 was analyzed in more detail. The oligonucleotide walk-though feature of mathFISH was applied again at 18, 19, 22, and 25 bases lengths, which matched the lengths of previously reported S. aureus probes for this sequence.3,6,8,11 A pattern emerged where the 5' end of a potential probe was most efficient at the 65 to 67 positions. Probes from 15 to 30 bases were tested at this location using the mismatch feature of mathFISH,19 and a number of potential probe candidates were realized including probes already reported (Table 1 and Table 2). For the calculations, 0.9 NaCl in the hybridization buffer, 47C hybridization incubation, and 1 M of probe was assumed.20
Table 1_The Predicted Hybridization Efficiency of Previously Reported DNA Probe Sequences to S. aureus 16S rRNA and Not to S. epidermidis
Name* Sau66-16S663 WQ25-16S676 JG24-16S6810 Staaur-16S6911 Staur-16S698
*Probe Thermodynamic
DNA probe (5' 3') AAGCTTCTCGTCCGTTCG AGAGAAGCAAGCTTCTCGTCCGTTC AGAGAAGCAAGCTTCTCGTCCGTT GAAGCAAGCTTCTCGTCCG AGAGAAGCAAGCTTCTCGTCCG
FA % 29.9 42.3 41.9 23.7 30.6
SA G kcal/mol 14.1 14.8 15.0 12.1 12.2
SE G kcal/mol# 4.7 5.4 5.3 5.8 4.5
HE 1.00 1.00 1.00 0.99 0.99
designation (name) includes number of bases and 5 ' end location relative to the 16S rRNA sequence of E. coli. calculations assume a single DNA probe binding to a target 16S rRNA sequence. Formamide concentration (FA %) assume 1 M probe dissociation at 47C in 0.9 NaCl buffer. Overall Gibbs binding potential to S. aureus (SA DeltaGo kcal/mol). #Overall Gibbs binding potential to S. epidermidis (SE DeltaGo kcal/mol). Difference in hybridization efficiency (HE) was calculated by subtracting HE of the probe to S. epidermidis from the probe to S. aureus.
Table 2_The Predicted Hybridization Efficiency of DNA Probe Sequences Identified in This Study to S. aureus 16S rRNA and Not to S. epidermidis
Name* KT16-16S65 KT15-16S66 KT20-16S66 KT25-16S66 KT26-16S66 KT18-16S68 KT30-16S69
*Probe Thermodynamic
DNA Probe (5' 3') CTTCTCGTCCGTTCGC CTTCTCGTCCGTTCG GCAAGCTTCTCGTCCGTTCG GAGAAGCAAGCTTCTCGTCCGTTCG AGAGAAGCAAGCTTCTCGTCCGTTCG GCAAGCTTCTCGTCCGTT CTAACATCAGAGAAGCAAGCTTCTCGTCCG
FA % 33.7 20.2 38.3 43.3 44.5 35.3 47.0
SA G kcal/mol 14.5 12.0 15.0 15.0 15.3 14.8 17.3
SE G kcal/mol# 4.9 2.4 5.5 5.1 4.9 5.9 4.3
HE 1.00 0.99 1.00 0.99 1.00 0.99 1.00
designation (name) includes number of bases and 5 ' end location relative to the 16S rRNA sequence of E. coli. calculations assume a single DNA probe binding to a target 16S rRNA sequence. Formamide concentration (FA %) assume 1 M probe dissociation at 47C in 0.9 NaCl buffer. Overall Gibbs binding potential to S. aureus (SA DeltaGo kcal/mol). #Overall Gibbs binding potential to S. epidermidis (SE DeltaGo kcal/mol). Difference in hybridization efficiency (HE) was calculated by subtracting HE of the probe to S. epidermidis from the probe to S. aureus.
LABMEDICINE Volume 42 Number 12 December 2011
labmedicine.com
Assessing 16S rRNA S. aureus Probes In Silico Table 1 and Table 2 list the DeltaGo for S. aureus and the DeltaGo for S. epidermidis and the difference in HE for probes between S. aureus and S. epidermidis. The DeltaGo indicates the standard state overall Gibbs free energy of the probe-target hybrid: the probability of probe to target binding (DNA:RNA) given the competing interactions of probe (DNA:DNA) and target (RNA:RNA) self-binding.21 The higher the negative number, the stronger the potential probe-target binding. Hybridization efficiency indicated the predicted ratio of target molecules bound with probe to all target molecules. An HE of 1 indicated saturation and 0 no hybridization. A probes usefulness was usually defined by its predicted (and tested) sensitivity and specificity to its target and nontarget microbes.2,6,22 Sensitivity refers to how good a probe was at correctly identifying the target microbe S. aureus.23 Specificity, on the other hand, indicated how good the probe was at not binding to non-target microbes.23 Generally the predicted DeltaGo and HE indicates both sensitivity and specificity whereas the formamide dissociation indicates only sensitivity.15 A probe was predicted to have a high sensitivity if it has a DeltaGo between -17 and -13 kcal/mol to S. aureus, a difference in DeltaGo between S. aureus and a non-target such as S. epidermidis greater than 3 kcal/mol, a formamide dissociation concentration difference between S. aureus and S. epidermidis greater than 20% (v/v), an HE greater than 0.9, and a difference in HE between S. aureus and S. epidermidis greater than 0.8.15 A probe should have at least -10 kcal/mol DeltaGo to S. aureus to be sensitive, but it does not need to meet all of the other criteria. A S. aureus probe such as Staphy11 with no difference in DeltaGo and HE to non-targets, but a formamide difference greater than 20%, can still be useful. A probe was predicted to have a high specificity if the DeltaGo to S. aureus was greater than -13 kcal/mol, the DeltaGo to non-targets was less than -10 kcal/mol, and the difference in HE between S. aureus and S. epidermidis was greater than 0.8.15 Testing S. aureus 16S rRNA Probes With FISH The accuracy of the online tools was tested by comparing predicted results to results in the laboratory with FISH. Two probes were compared, Staaur (Invitrogen, Carlsbad, CA, Staaur-16S69: 5'- GAAGCAAGCTTCTCGTCCG -3')11 and a new probe KT18 (Invitrogen, KT18-16S68: 5'GCAAGCTTCTCGTCCGTT -3') (present study). Staaur is frequently cited in FISH studies of S. aureus.2,4,22 KT18 was chosen as it was predicted to match the HE of Staaur (Table 2). Specimens were collected from blood agar plates at a major hospital and stored so that 10 isolates of S. aureus and S. epidermidis could be rapidly tested with FISH at a nonclinical location. Isolate identity was confirmed with PCR24 and then de-identified for FISH. After culturing in nutrient broth (Oxoid, Hampshire, U.K., CM0001), isolates were aliquoted and pelleted for up to 3 months storage at -20C as described by Baldrich and colleagues.25 Before testing with FISH, isolates were thawed and re-cultured for 70 minutes in nutrient broth until turbid (0.5 McFarland).25 No difference was observed in the results when isolates were tested directly from agar plates.
labmedicine.com
Science
55
A FISH assay reported by Poppert and colleagues22 was applied with some modifications. To minimize reaction time, preheated 50 mL centrifuge tubes with screw-caps (Greiner, 210-261) were used for reagents and slides. As it simplified the assay without a reduction in HE, the hybridization and washing steps were set at 47C. The hybridization buffer contained 0.9 NaCl and probes at 1 M. The 2 S. aureus DNA probes tested and a control eubacteria probe EUB338 probe (Invitrogen, EUB338-16S337: 5'GCTGCCTCCCGTAGGAGT -3') were conjugated at the 5' end to Alexa Fluor 488 (Invitrogen). As the mathFISH calculations were based upon DNA probes, peptide nucleic acid (PNA) probes were not tested.15 With each experiment, the 2 slides with 5 wells each were tested (Menzel-Glser, Braunschweig, Germany, X1XER308B). To compare the 2 S. aureus probes, cells were observed with an epifluorescence microscope (Olympus, Tokyo, Japan, BX51) fitted with a 60 dry objective (Olympus, UPLFLN) and FITC/DAPI filters (Olympus, U-MWU2, U-MWIB2); images were acquired at a resolution of 1360 1024 with a color camera (Olympus, DP72) and software (Olympus, DP2-BSW v2.2) set to a gain of 200 ISO and an exposure of 400 ms; and analyzed with ImageJ using standard algorithms (NIH, v1.43u). Cell counts were estimated with a 50 m haemacytometer grid and a DAPI (Sigma, St. Louis, MO, D9564) counter-stain. Signal intensity was measured by segmenting images with the same threshold level. For statistical analysis, parametric assumptions were tested with a histogram of the signal and a P value of less than 0.05 was considered significant. The mean signal intensity 8-bit grayscale, standard deviation, and a 95% confidence interval for each probe image was calculated. Summary statistics were compared with an unpaired 2-tail t test. The ratio of cells with FISH and DAPI signal to those with just DAPI signal was also measured for both probes.
Results Assessing 16S rRNA S. aureus Probes In Silico A number of new probes for S. aureus were predicted to perform as well or better in silico than those previously cited. Table 1 lists probe sequences previously tested and found to be sensitive and specific to S. aureus. Table 2 lists probe sequences predicted in this study as sensitive and specific to S. aureus. Because of the single viable region on S. aureus for probe targeting (Figure 1), all the potential probes and the reported probes overlapped and, in some cases, were almost identical. It is apparent from Table 1 and Table 2 that KT15-16S66 is identical to KT16-16S65, except that the latter was missing the last base at the 3' end; and WQ25-16S67 is identical to KT26-16S66, except that the latter was missing the last base at the 3' end. A majority of probes in Table 1 and Table 2 had a predicted high sensitivity to S. aureus; DeltaGo to S. aureus was between -17 and -13 kcal/mol, the DeltaGo to S. epidermidis was less than -10 kcal/mol, a formamide difference greater than 20% (not shown) and an HE difference greater than 0.8. A majority of probes also had a predicted high specificity to S. aureus; DeltaGo to S. aureus was greater than -13 kcal/ mol, the DeltaGo to S. epidermidis was less than -10 kcal/mol, and the difference in HE was greater than 0.8. The reported
Science
56

culturing. The sensitivity and specificity of the WQ25-16S67 probe used to detect S. aureus was 100% and 98% respectively.6 When tested with a FISH assay in this study, Staaur16S69 and a new probe KT18-16S68 were found to have a similar signal intensity to S. aureus and similar specificity to S. epidermidis. The FISH experiment was performed twice. First, to ascertain the optimal formamide concentration, each probe was tested at 0%, 15%, 30%, 45%, and 60% formamide (v/v). The optimal formamide concentration was found to be 30% for both Staaur and KT18. Next, the signal intensity of the probes was compared at 30% formamide. No difference in signal was observed in Image 1. Lastly, S. aureus and S. epidermidis were mixed and analyzed in the same sample to determine interference, sensitivity, and the limit of detection. Staphylococcus aureus was clearly identified with either the Staaur or the KT18 probes at 10(3) density amongst S. epidermidis at 10(8). To ensure that S. epidermidis was not also labeled with these probes, a polyclonal antibody conjugated to fluorescein isothiocyanate (FITC) and specific to S. aureus (ViroStat, Portland, ME) was applied to the slides after FISH. The immunofluorescence signal labeled the outside of only those cells that had a FISH signal. The signal intensity was measured with ImageJ and found to be 28.201 0.59 for Staaur and 28.614 0.52 for KT18 (8-bit grayscale). An unpaired t test of the signal intensity for each probe was not significantly different (cell count >200; P=0.39). The ratio of cells with FISH signal to those without was also compared. No difference was measured between the 2 probes. For both FISH experiments, no crossreactivity was observed; S. aureus was positive for the Staaur and KT18 probes and S. epidermidis was not.
probes Staaur-16S69, Staur-16S69, and the newly identified probe KT15-16S66 had DeltaGo lower than -13 kcal/mol, which suggests they might be marginally prone to false negatives as compared to the other probes. Table 1 and Table 2 also list the predicted formamide melting concentration (v/v) as a percentage for each probe. This was the stringency at which half the probe has annealed (or dissociated) from the target. The melting point formamide concentrations ranged from 20.2% (v/v) for the shortest probe KT15-16S66 to 47.0% for the longest probe KT3016S69. It should be noted that the predicted formamide concentration is not the actual concentration used by the hybridization buffer and FISH for that probe. The hybridization buffer should have a lower stringency, and so the formamide concentration used is typically 5% to 10% higher than what was predicted.2,6,22 The washing buffer stringency (set with NaCl and not formamide) is higher than the hybridization buffer.2,6,22
Testing S. aureus 16S rRNA Probes With FISH Except for Staur-16S69, the reported sensitivity and specificity of S. aureus probes used in other studies were similar to the sensitivity and specificity predicted in this study. The studies by Jansen and colleagues,10 Tavares and colleagues,3 and Poppert and colleagues22 were completed in a clinical setting with blood cultures that contained S. aureus, coagulase-negative Staphylococci (CoNS), Micrococcus spp., and Rotia spp. Probe sensitivity and specificity to S. aureus were as follows: Sau66-16S66, 100% and 99%;3 JG24-16S68, no data available; Staaur-16S69, 100% and 100%;22 and Staur16S69, 68% and 100%.10 The poor Staur-16S69 findings in Jansen and colleagues10 were confirmed elsewhere26 and were attributed to either differences in the permeability5 of the S. aureus cell wall or steric hindrance.26 A study by Wu and colleagues6 was also completed in a clinical setting, but the study tested urinary tract infection samples containing S. aureus, Escherichia coli, and Enterococcus faecalis directly without first
Discussion We set out to test the efficacy of a number of online tools to evaluate FISH probes for S. aureus. Since S. aureus has a single sequence that can be targeted for FISH, it was considered
Image 1_S. aureus labeled with (A) Staaur probe and (B) KT18 probe were compared. Both probes were conjugated with Alexa Fluor 488. No difference was observed. Bar is 10 m.
labmedicine.com
unlikely that any new probes determined in silico would be as efficient as those previously reported (Table 1). It was therefore surprising that a number of new probes for S. aureus were predicted to perform as well or better in silico (Table 2). In particular, KT26-16S66 and KT30-16S69 were found to have a high predicted difference in DeltaGo and HE.18 When tested with a FISH assay, Staaur and a new probe KT18 were found to have similar HE18 and melting formamide point concentrations27 as predicted. In addition, a new online tool, mathFISH, was found to offer a number of advantages in the development of FISH probes.15 First it calculated the interactions observed in FISH between the probe and the target, self-folding within the probe itself and within the rRNA target. Next, it predicted the most efficient 5' end location for a DNA probe within a mismatch sequence,19 the HE for probes of different lengths at that location,18 and the melting formamide point concentration of selected probes.27 A general probe for Staphylococcus was also tested in silico. The results were more difficult to assess than with S. aureus as the number of probe possibilities and potential non-target microbes were larger and were complicated by mismatches spanning across more than 1 base. The speed advantage of mathFISH to walk an oligonucleotide of a set length across a sequence range became more apparent when more than 1 target sequence was analyzed.21 Potential target sequences were sought by aligning and analyzing mismatches between S. aureus and Streptococcus agalactiae (GenBank, HQ658089.1). Candidate probe sequences were also compared with Enterococcus faecalis (GenBank, FJ749378.1) and Micrococcus luteus (GenBank, HQ323416.1) as these gram-positive aerobic cocci are frequently encountered in blood culture and can be confused with S. aureus.1-3 A probe for Staphylococcus RB17-16S696 5'- CTCCATATCTCTGCGCA -3', was found to be at least as efficient as the reported Staphy probe (Staphy-16S697 5'TCCTCCATATCTCTGCGC -3').11 But further testing in the laboratory with FISH is needed to confirm its specificity. This study had a number of limitations. The large subunit rRNA was not assessed in silico,7 nor was a reported 23S rRNA probe Saur72 analyzed.9 A representative GenBank sequence was chosen for S. aureus and S. epidermidis. The in silico calculation assumptions were experimentally demonstrated on E. coli after an extended hybridization step by Yilmaz and Noguera,21 but the FISH assay in the present study verified the in silico results on S. aureus with a 10 minute incubation step.22 Hybridization efficiency calculations assumed no added formamide,18 but in practice formamide is rarely excluded.2,4,22 When confirming the computed predictions with a FISH assay, only 1 probe candidate KT18 was tested with FISH against a known probe Staaur. The FISH assay was run on pure cultures of patient isolates and not on reference strains or as is usually the case, with clinical FISH, directly from blood cultures.2,4,22 Since there was some variation in the signal observed between slides and between FISH experiments, representative images were chosen from slides treated the same day with FISH and from the same location on each slide. Image analysis was complicated by the inclusion of cells at a lower signal outside the focal plane and by DAPI bleeding. In conclusion, the characterization of existing and new probes for S. aureus was greatly enhanced by in silico testing. We were able to assess the HE of KT18-SA68 to S. aureus in silico and confirm these calculations with minimal FISH
labmedicine.com
Science
57
testing. To determine their applicability and reliability, the probe sequences predicted in this study as specific for S. aureus, warrant further testing with FISH in a routine clinical setting against positive blood cultures containing a variety of additional Staphylococcus spp. LM Acknowledgements: The study was supported by the Australian Research Councils Linkage Projects (LP0775196). Our thanks to the Australian Proteome Analysis Facility for laboratory access.
1. Kempf VA, Trebesius K, Autenrieth IB. Fluorescent in situ hybridization allows rapid identification of microorganisms in blood cultures. J Clin Microbiol. 2000;38:830-838. 2. Wang P. Simultaneous detection and differentiation of Staphylococcus species in blood cultures using fluorescence in situ hybridization. Med Princ Pract. 2010;19:218-221. 3. Tavares A, Incio J, Melo-Cristino J, et al. Use of fluorescence in situ hybridization for rapid identification of staphylococci in blood culture samples collected in a Portuguese hospital. J Clin Microbiol. 2008;46:3097-3100. 4. Gescher DM, Kovacevic D, Schmiedel D, et al. Fluorescence in situ hybridisation (FISH) accelerates identification of Gram-positive cocci in positive blood cultures. Int J Antimicrob Agents. 2008;32(suppl 1):S51-S59. 5. Jansen GJ, Mooibroek M, Idema J, et al. Rapid identification of bacteria in blood cultures by using fluorescently labeled oligonucleotide probes. J Clin Microbiol. 2000;38:814-817. 6. Wu Q, Li Y, Wang M, et al. Fluorescence in situ hybridization rapidly detects three different pathogenic bacteria in urinary tract infection samples. J Microbiol Methods. 2010;83:175-178. 7. Amann R, Fuchs BM. Single-cell identification in microbial communities by improved fluorescence in situ hybridization techniques. Nat Rev Microbiol. 2008;6:339-348. 8. Bentley RW, Harland NM, Leigh JA, et al. A Staphylococcus aureus-specific oligonucleotide probe derived from 16S rRNA gene sequences. Lett Appl Microbiol. 1993;16:203-206. 9. Veeh RH, Shirtliff ME, Petik JR, et al. Detection of Staphylococcus aureus biofilm on tampons and menses components. J Infect Dis. 2003;188:519-530. 10. Jansen G, Degener J, Welling G. Method for the rapid determination of bacteria. Eur pat. 1999. WO Patent WO/1999/054,502. 11. Trebesius K, Leitritz L, Adler K, et al. Culture independent and rapid identification of bacterial pathogens in necrotising fasciitis and streptococcal toxic shock syndrome by fluorescence in situ hybridisation. Med Microbiol Immunol. 2000;188:169-175. 12. Stothard P. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques. 2000;28:1102-1104. 13. Johnson M, Zaretskaya I, Raytselis Y, et al. NCBI BLAST: A better Web interface. Nucleic Acids Res. 2008;36:W5-W9. 14. Loy A, Arnold R, Tischler P, et al. probeChecka central resource for evaluating oligonucleotide probe coverage and specificity. Environ Microbiol. 2008;10:2894-2898. 15. Yilmaz LS, Parnerkar S, Noguera DR. mathFISH, a Web tool that uses thermodynamics-based mathematical models for in silico evaluation of oligonucleotide probes for fluorescence in situ hybridization. Appl Environ Microbiol. 2011;77:1118-1122. 16. Cole JR, Wang Q, Cardenas E, et al. The Ribosomal Database Project: Improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 2009;37:141-145. 17. Madden T. The NCBI Handbook. Bethesda, MD: National Center for Biotechnology Information; 2003;16:1-17. 18. Yilmaz LS, Okten HE, Noguera DR. Making all parts of the 16S rRNA of Escherichia coli accessible in situ to single DNA oligonucleotides. Appl Environ Microbiol. 2006;72:733-744. 19. Yilmaz LS, Bergsven LI, Noguera DR. Systematic evaluation of single mismatch stability predictors for fluorescence in situ hybridization. Environmental Microbiology. 2008;10:2872-2885. 20. Szweda P, Kotlowski R, Kur J. New effective sources of the Staphylococcus simulans lysostaphin. Journal of Biotechnology. 2005;117:203-213. 21. Yilmaz LS, Noguera DR. Mechanistic approach to the problem of hybridization efficiency in fluorescent in situ hybridization. Appl Environ Microbiol. 2004;70:7126-7139.
Science
58

26. Ikeda M, Yamaguchi N, Tani K, et al. Development of phylogenetic oligonucleotide probes for screening foodborne bacteria. J Health Sci. 2005;51:469-476. 27. Yilmaz LS, Noguera DR. Development of thermodynamic models for simulating probe dissociation profiles in fluorescence in situ hybridization. Biotechnol Bioeng. 2007;96:349-363.
22. Poppert S, Riecker M, Wellinghausen N, et al. Accelerated identification of Staphylococcus aureus from blood cultures by a modified fluorescence in situ hybridization procedure. J Med Microbiol. 2010;59:65-68. 23. Loong T. Understanding sensitivity and specificity with the right side of the brain. BMJ. 2003;327:716-719. 24. Thomas LC, Gidding HF, Ginn AN, et al. Development of a real-time Staphylococcus aureus and MRSA (SAM-) PCR for routine blood culture. J Microbiol Methods. 2007;68:296-302. 25. Baldrich E, Vigus N, Mas J, et al. Sensing bacteria but treating them well: Determination of optimal incubation and storage conditions. Anal Biochem. 2008;383:68-75.
labmedicine.com
3.2 Optimization of a two-step permeabilization fluorescence in situ hybridization assay for the detection of Staphylococcus aureus 59
Journal of Clinical Laboratory Analysis 25 : 359365 (2011)
3.2
Optimization of a two-step permeabilization uorescence in situ hybridization assay for the detection of Staphylococcus aureus
Optimization of a Two-Step Permeabilization Fluorescence In Situ Hybridization (FISH) Assay for the Detection of Staphylococcus aureus
Thomas S. Lawson, Russell E. Connally, Subramanyam Vemulpad, and James A. Piper
Macquarie University, Faculty of Science, Sydney, New South Wales, Australia
Background: Aspects of the uorescence in situ hybridization (FISH) method for the detection of clinically important bacteria, such as Staphylococcus aureus, Staphylococcus epidermidis, and Escherichia coli, were investigated for optimization. Methods: Various approaches to optimizing the FISH procedure were taken and different methods were compared. To save time, hybridization and washing buffers were prepared beforehand and stored at 201C and mixed to their nal formamide and NaCl concentrations just before use. The use of 50-ml tubes for hybridization
incubation reduced drying out, reagent wastage, and reaction times. Results: A two-step permeabilization FISH assay was developed that used phosphate-buffered saline as a buffer for lysostaphin. It could detect bacteria with DNA probes conjugated to uorophores with a higher signal intensity and the less expensive biotinylated DNA probes with minimal cell lysis in 1 hr. Conclusions: The two-step assay might be used when the FISH signal is weak, bacterial numbers are low or if there is a need to use other reporter molecules. J. Clin. Lab. Anal. r 2011 Wiley-Liss, Inc. 25:359365, 2011.
Key words: uorescence in situ hybridization; FISH; Gram-positive bacteria; molecular diagnostic techniques; Staphylococcus aureus; Staphylococcus epidermidis; Staphylococci
INTRODUCTION Following a positive blood-culture and Gram-stain, uorescence in situ hybridization (FISH) can be used to identify the bacteria present such as the clinically important Staphylococcus aureus (14). The FISH procedure typically uses a single permeabilization step (hereafter referred to as the one-step FISH assay) and DNA probes (also called oligonucleotides or oligos) conjugated to uorophores (1,58). To permeabilize S. aureus, the one-step FISH assay applies a lytic enzyme mixture of lysozyme and lysostaphin. As it can be more robust, FISH can also use a two-step permeabilization (two-step FISH assay) to detect S. aureus (2,4,914). To permeabilize S. aureus, two-step FISH assay applies a lysozyme step, and a quick water rinse followed by a lysostaphin step. The DNA probes conjugated to uorophores (hereafter, oligo-f) are relatively small in molecular weight and so can gain rapid access to in situ rRNA targets. The detection of S. aureus with FISH and biotinylated probes (hereafter, oligo-b) is rarely reported (1517).
c
Greater permeabilization is needed for streptavidin to gain in situ access to acteria as it has a high molecular weight. This can lengthen the assay time (1517) and lead to over-permeabilization or cell lysis. A rapid oligo-b FISH assay, however could offer cost savings. As far as we are aware, there are no reports of the detection of S. aureus with a two-step FISH assay and oligo-b in 1 hr or less. S. aureus was chosen for testing with oligo-b and FISH as it is an important pathogen and its permeabilization for DNA probes is more involved. Since S. epidermidis is phylogenetically similar to S. aureus and its rRNA nearly identical (7), it was included as a negative
Grant sponsor: Australian Research Councils Linkage Projects; Grant number: LP0775196.
Correspondence to: Thomas S. Lawson, Macquarie University, Faculty of Science, Sydney, New South Wales, Australia. E-mail: [email protected]
Received 29 April 2011; Accepted 21 July 2011 DOI 10.1002/jcla.20486 Published online in Wiley Online Library (wileyonlinelibrary.com).
2011 Wiley-Liss, Inc.
60
360 Lawson et al.

binding protein (PBP2)-negative S. aureus were selected. Isolate identity was conrmed with polymerase chain reaction (18) and was then de-identied for experimentation. To control for potential differences between strains, ten isolates of each type of bacteria were collected. To enable the isolates to be compared over a number of FISH experiments, the collected isolates were cultured in nutrient broth (CM0001; Oxoid, Hampshire, UK), centrifuged at 4,000 rcf, aliquoted and frozen as described by Baldrich et al. (19). An aliquot of S. aureus, S. epidermidis, and E. coli was thawed and recultured in nutrient broth for testing with FISH. As a control, isolates were tested directly from the plates and no difference in signal was observed. To test with FISH, cultures of clinical isolates in nutrient broth were spotted (10 ml) onto the slides (X1XER308B; Menzel Glaser, Braunschweig, DE), dried at 801C for 3 min, and then xed with absolute (m)ethanol for 1 min. Cell Permeabilization To reduce preparation time, stock solution of lysozyme (L6876; Sigma-Aldrich, St. Louis, MO) and lysostaphin (L4402; Sigma) were prepared up to a week in advance and stored as 1.5-ml aliquots in sterile plastic tubes. For the one-step permeabilization FISH assay, 15 mg/ml lysozyme and 0.1 mg/ml lysostaphin were applied in one-step as described by Poppert et al. (1). For the twostep permeabilization assay, 10 ml of lysozyme at 15 mg/ml in Milli-Qs (MQ) water (Millipore, Billerica, MA) (20,21) was spotted onto the slide wells and incubated in 50-ml tubes (210261; Greiner, Frickenhausen, Germany) for 6 min at 381C (22). The lysozyme was rinsed off with, PBS (P4417; Sigma), and the slides were rapidly dried with pressurized air (1) or by centrifuging in 50-ml tubes for 1 min at 100 rcf. Lysostaphin at 0.1 mg/ml in PBS was spotted (10 ml) onto the slides and incubated in 50-ml tubes at 471C for 6 min. Lysostaphin was removed by rinsing the slides in absolute (m)ethanol for 1 min and then drying at 801C for 1 min. When E. coli isolates were tested, permeabilization was omitted. Hybridization To save time, the hybridization buffer and washing buffer were prepared in advance. Hybridization buffer (0.9 M NaCl, 20 mM TrisHCl, 0.01% (w/v) SDS, and 1 mg/ml DAPI) with no formamide or with 60% (v/v) deionized formamide were prepared and stored for up to a year at 201C in 5-ml sterile plastic screw-top tubes. When needed, the buffers were thawed and mixed to the desired target formamide concentration. The concentration of formamide used in this study was 30% (v/v), about 5% higher than the lowest probe formamide dissociation concentration estimated with mathFISH
control. E. coli was also tested to ensure that the FISH assays developed could also detect Gram-negative bacteria (11). DNA rather than peptide nucleic acid (PNA) were used as they are less expensive. MATERIALS AND METHODS Two FISH assays were developed and tested. These are listed and compared in their optimized form in Table 1. The one-step permeablization FISH assay is a modied version of the FISH assay described by Poppert et al. (1). The two-step permeablization FISH assay extends the one-step assay by the addition of an extra permeabilization step and a streptavidin incubation step (15). Details for the optimized one-step and two-step FISH assays are not included in Table 1. Specimen Preparation So that isolates could be tested at a nonclinical location, clinical patient isolates of S. aureus, Staphylococcus epidermidis and Escherichia coli were collected on agar plates from a major hospital. Only penicillin
TABLE 1. Comparison of the Optimized One-Step or TwoStep Permeabilization FISH Assays
One-step (1) Two-step (This study)
Preparation: Cultures of clinical isolates were diluted with PBS, spotted, xed to slides at 801C, xed in methanol, and air-dried Permeabilization: Slides were Permeabilization: Slides were spotted with 15 mg/ml spotted with lysis reagent lysozyme with 20 mM (15 mg/ml lysozyme, TrisHCl at pH 7.0 in 0.1 mg/ml lysostaphin, MQ water and incubated 20 mM TrisHCl at pH at 381C, rinsed with PBS, 7.0 in MQ water) and incuand dried with bated at 401C, rinsed with pressurized air methanol, and air-dried Permeabilization: Slides were spotted with 0.1 mg/ml lysostaphin, 20 mM TrisHCl diluted in PBS and incubated at 471C, rinsed with methanol, and air-dried Hybridization: Slides were spotted with hybridization buffer (30% formamide, 0.9 M NaCl, 20 mM TrisHCl at pH 8.0, 0.01% SDS, a 1-mM probe, and MQ water), and incubated at 471C Washing: Slides were incubated with washing buffer (0.30.9 M NaCl, 20 mM TrisHCl pH 8.0, 0.01% SDS, 10 mM EDTA, and MQ water) at 471C, rinsed with PBS Mounting: Slides were Streptavidin/Mounting: mounted with a cover-slip Slides were spotted with while wet streptavidin-f and incubated at 381C, rinsed with PBS, and mounted with a cover-slip while wet
J. Clin. Lab. Anal.
Optimization of FISH for Staphylococcus aureus 361
(mathsh.cee.wisc.edu) (471C hybridization incubation, 0.9 M NaCl and 1 mM of probe) (23). The oligo (1 mM) could be added to the buffer mix and stored at 41C in 1.5-ml sterile plastic aliquots for a week before performing FISH. For hybridization, 10 ml of buffer with oligo (1 mM) was spotted onto the slides and incubated at 471C for 10 min. Oligos tested were STAAUR specic for S. aureus (STAAUR-16S69: 5- GAAGCAAGCTTCTCGTCCG -3) (12) (Invitrogen, Carlsbad, CA), STAPHY specic for Staphylococcus (STAPHY-16S697 5-TCCTCCATATCTCTGCGC-3) (12) (Invitrogen), and EUB338 specic for eubacteria (EUB338 16S337: 5- GCTGCCTCCCGTAGGAGT -3) (Sigma) (24) (Invitrogen). These oligos were biotinylated (oligo-b) or directly conjugated to Alexa Fluors 488 (Invitrogen), Alexa Fluors 555, FITC or Cy3 (Genworks, Adelaide, Australia) labeled on the 50 end (oligo-f). Specimen Washing In a similar fashion to the hybridization buffer, the washing buffer without salt (20 mM Tris-HCl, 5 mM EDTA and 0.01% (w/v) SDS) or with 1.8 M NaCl were prepared and stored for up to a year at 41C in 1 l bottles (GL45; Schott, Mainz, Germany). When needed, the buffers were mixed to the target NaCl concentration in a 50-ml tube, typically 1:4, to make approximately 0.3 M NaCl. So that the washing buffer could be reused multiple times, before immersing the slide in the 50-ml tubes of washing buffer for 3 min at 471C, the hybridization buffer was rinsed off with washing buffer. Streptavidin Conjugation The slides were removed from the washing buffer and rinsed in PBS. For the one-step FISH assay, the slides were mounted wet with PBS and cover-slips for microscopy. For the two-step FISH assay, the slides were dried with pressurized air and spotted with 10 ml of streptavidin conjugated to Alexa Fluors 488 (S-32354; Invitrogen) (hereafter, streptavidin-f), DyLights 488 (21832; Thermo Fisher, Waltham, MA) or Alexa Fluors 555 (S-32355; Invitrogen) at 10 mg/ml in PBS. Slides were incubated at 471C for 10 min, rinsed with PBS, and mounted as before, for microscopy. Microscopy and Statistical Analysis The FISH signal was observed with an epiuorescence microscope (BX51; Olympus, Tokyo, Japan) tted with a 60 dry objective (UPLFLN; Olympus) and FITC/ DAPI lters (U-MWU2, U-MWIB2; Olympus). Images were acquired at a resolution of 1,360 1,024 with an Olympus DP72 camera and software (DP2-BSW v2.2; Olympus) set to a gain of 200 ISO and an exposure of
400 msec. A representative image with a cell count of at least 100 was selected for each treatment from three experiment runs. Images were analyzed with ImageJ using its standard segmentation algorithms (v1.43u; NIH, Bethesda, MD). Cell numbers, morphology, and permeabilization were assessed with the FISH signal and 40 ,6-diamidino-2-phenylindole (DAPI) (D9564; Sigma). The mean signal intensity (8-bit gray-scale) and standard deviation for each FISH method were calculated. Summary statistics were compared with one-way analysis of variance (ANOVA) and a P value of o0.05 was considered signicant. RESULTS Effect of Different FISH Assays and Probe Types on Signal Two FISH assays were tested: the assay by Poppert et al. (1), which included a one-step permeabilization treatment and a modied version of that assay that included a two-step permeabilization treatment (Table 1). Each FISH assay was tested with two types of probes: Oligo-f probes that had DNA sequences conjugated to uorophores and oligo-b probes that had DNA sequences conjugated to biotin and visualized with streptavidin-f. Each probe type was tested with three probe sequences: the STAAUR probe that was specic for S. aureus and the STAPHY probe specic for Staphylococcus (12), and the EUB338 probe specic for eubacteria (24). As reported by Poppert et al. (1), the one-step permeabilization FISH assay successfully detected S. aureus and differentiated it from S. epidermidis with oligo-f probes in 45 min (Fig. 1A). The one-step assay (1), however produced a poor signal for S. aureus with the STAAUR oligo-b probe (Table 2) and a weak signal for S. epidermidis with the STAPHY oligo-b probe and streptavidin-f (data not shown). In contrast, the two-step permeabilization FISH assay successfully detected S. aureus with oligo-f, oligo-b probes, and streptavidin-f in 1 hr (Fig. 1B and D). Furthermore, the two-step assay produced a higher FISH signal with oligo-f probes than the one-step FISH assay (Table 2). The difference in oligo-f signal intensity was found to be signicant (One-way ANOVA; Po0.05). Effect of Different Slide and Fixation Preparation Other aspects of the FISH method were also investigated for optimization (data not shown). Heat xing the bacteria on the slides at 801C rather than air-drying shortened drying time from 10 to 3 min. Cell loss from the slides was observed after processing with FISH. Rinsing the slides with molten 0.2% (w/v) agarose (162-0102; Bio-Rad Laboratories, CA)
J. Clin. Lab. Anal.
62
362 Lawson et al.
Fig. 1. Staphylococcus aureus treated with (A) the one-step permeabilization FISH assay or (B) the two-step permeabilization FISH assay and then labeled with 1 mM/ml STAAUR oligo directly conjugated to Alexa Fluors 488. S. aureus treated with the two-step permeabilization FISH assay and (C) not washed with PBS before lysostaphin, and (D) washed with PBS before lysostaphin and then labeled with 1 mM/ml oligo-b STAAUR and 10 mg/ml streptavidin Alexa Fluors 488. (A) S. aureus treated with the one-step FISH assay. (B) S. aureus treated with the twostep FISH assay. (C) S. aureus not washed with PBS before lysostaphin. (D) S. aureus washed with PBS before lysostaphin. PBS, phosphatebuffered saline; FISH, uorescence in situ hybridization.
TABLE 2. Comparison of the Staphylococcus aureus SI and CI for One- and Two-Step Permeabilization FISH Methods Using a STAAUR Oligo
Treatment One-step FISH assay with oligo-fc One-step FISH assay with oligo-f and Tween 20s d One-step FISH assay with oligo-bc Two-step FISH assay with oligo-bc Two-step FISH assay with oligo-fe SIa 23.44 24.85 17.19 23.27 27.31 CIb 0.55 0.71 0.19 0.48 0.45
the signal was observed between isolates xed for 3 and 10 min. If xed for 1 min, the FISH signal was less than when xed for 3 min, but was used to shorten the assay. Ethanol xation was observed to produce a higher signal intensity, whereas methanol was observed to produce a more consistent signal. Diluting isolates in absolute (m)ethanol 1:1 and heating to 801C for 10 min did not improve the signal (27). For S. aureus, paraformaldehyde at 1% produced a weak signal (7,11). Effect of Lysozyme and Lysostaphin Permeabilization Treatments As reported by Poppert et al. (1), when 2 mg/ml lysozyme and 0.1 mg/ml lysostaphin in 10 mM Tris/HCl (pH 8) were combined and applied in a one 5-min step at 461C, the FISH assay was simple and rapid for oligo-f probes. This treatment was further shortened to 3 min by combining 15 mg/ml lysozyme with 0.1 mg/ml lysostaphin in 10 mM Tris/HCl (pH 7) and incubating for 3 min at 401C. Other variations of lysozyme and lysostaphin permeabilization were tested with oligo-f probes. If lysozyme was applied without lysostaphin, a 30-min incubation at 381C was necessary for STAAUR signal (21). If lysostaphin was applied without lysozyme, a 10-min incubation at
SI, signal intensity; CI, condence interval; FISH, uorescence in situ hybridization. Exposure time was the same for each image acquisition. The results were consistent across the ten isolates tested. a Mean signal intensity in 8-bit Gray-scale. b Condence interval was calculated at 95%. c As described in Table 1. d The one-step FISH assay with a 5-min, 1% Tween 20s step at room temperature before hybridization. e The two-step FISH assay using a oligo-f, without the streptavidin incubation step.
minimized this loss (25,26). A number of specimen xation techniques were tested. Alcohol xation of isolates during dilution or after drying onto a slide was found to be necessary for a consistent FISH signal or if the isolates were stored for later testing. No difference in
J. Clin. Lab. Anal.
Optimization of FISH for Staphylococcus aureus 363
471C was sufcient for S. aureus, but the S. epidermidis EUB338 signal was poor. If oligo-b probes and streptavidin-f was used, the one-step permeabilization treatment produced a weak signal (Table 2). To produce a satisfactory signal for oligo-b probes and streptavidin-f, lysozyme and lysostaphin were applied separately. The sequence of the lysozyme and lysostaphin steps was found to be important. As reported by Tavares et al. (2), lysozyme treatment before lysostaphin produced a higher and more consistent signal than vice versa. Buffering of the enzymes was also important. No difference was observed in STAAUR signal if lysozyme was buffered at pH 7.0, 8.0, or left unbuffered. Lysostaphin when unbuffered, however, led to over-permeabilization and cell lysis. When lysostaphin buffered in Tris-HCl pH 7.0 or 8.0 was applied, cell lysis was reduced but not completely abrogated (Fig. 1C). Cell lysis, however was minimized if a 1-min PBS wash step was added between the lysozyme and lysostaphin steps (Fig. 1D). The PBS treatment was further optimized by omitting the PBS wash step and instead diluting lysostaphin in PBS. Since the TrisHCl buffering was not needed in the lysozyme step and lysostaphin was buffered with PBS, the assay preparation was simplied. For the different permeabilization treatments tested, no differences were observed among the ten isolates of each of the three bacteria (S. aureus, S. epidermidis, and E. coli). Optimizing Hybridization A surfactant step before hybridization was not necessary, however, a 1% (v/v) Tween 20s or 0.1% (v/v) Triton X-100s with 1% (w/v) bovine serum albumin in MQ water spotted (10 ml) onto the slides and incubated for 5 min at room temperature increased the signal intensity by 6% (Table 2). A number of different oligo and stain treatments were tested with the hybridization buffer. No difference was observed in the signal if the oligos were tested at concentrations of 0.253 mM. Since it was easier to prepare, 1 mM was chosen for further FISH testing. If Alexa Fluors 488 and Alexa Fluors 555 rather than FITC and Cy3 uorophores were used, photo-stability increased from 10 sec to 1 min with a 100-W Olympus U-RFL-T burner. The use of 50-ml tubes for hybridization incubation reduced drying out, reagent wastage, and reaction times. By using 30% (v/v) formamide for all the oligos tested in this study, preparation was simpler and multiple oligos could be applied at the same time. Optimizing Specimen Washing and Streptavidin Conjugation The washing step could be substantially shortened if the NaCl concentration was increased from 0.3 to 0.9 M.
A 1-min PBS wash step at room temperature was also tested. This rapid and simple wash produced a high signal intensity, but also some nonspecic staining. If the nonspecic signal was unacceptable with a PBS wash, the wash could be repeated with regular washing buffer until the nonspecic staining was removed without adversely affecting the FISH signal. When oligo-b probes were used, an additional streptavidin-f incubation step was needed. Its signal was highest when streptavidin-f diluted in PBS was incubated at 381C for 10 min. A number of measures were taken to counteract the nonspecic background signal associated with streptavidin-f. NaCl concentration in the previous washing buffer was increased from 0.3 to 0.9 M and the washing time lengthened from 3 to 10 min. Before applying, streptavidin-f was centrifuged at 10,000 rcf for 1 min. Finally, the streptavidin concentration was minimized without losing signal by diluting to a range of 110 mg/ml. DISCUSSION The study set out to optimize FISH for the detection of S. aureus and differentiation from S. epidermidis. E. coli was also tested to ensure that the FISH assays developed would work for Gram-negative bacteria as well. A merit of the study is that it addresses some aspects of the FISH procedure concerning xation, permeablization, buffers and uroescent fluorescent dyes that were previously unquestioned. Although some of the study experiments did not result in major improvements to the assay, they may still be valuable for further studies, especially those that aim to optimize FISH. Preparing Buffers To test a range of FISH treatments, hybridization and washing buffers were prepared beforehand and stored long-term at 201C and mixed to their nal formamide and NaCl concentrations just before use. It was relatively straightforward to prepare large volumes of buffer and store. As far as the authors are aware, this approach to preparing FISH buffers has not been reported elsewhere and is useful and applicable to routine diagnostics where labor costs are important. Since it was not necessary to prepare the reagents for each batch of FISH experiments, time-savings were made. Preparing and storing buffers for up to an year did not affect their application in the FISH assay or its signal. Hybridization buffer prepared with oligos could also be used for up to a week without signal loss or nonspecic binding (data not shown). One-Step vs. Two-Step Permeabilization The biotinstreptavidin system is rarely used in clinical FISH studies. The oligo-b assays are more
J. Clin. Lab. Anal.
64
364 Lawson et al.

rapidly as the FISH assay that combined lysozyme and lysostaphin into one-step. The two permeabilization steps lengthen the assay, but provided optimal conditions for lysozyme and lysostaphin enzyme activity, better control over the process of permeabilization as well as a higher level of permeabilization. The two-step assay might be used when the FISH signal is weak, bacterial numbers are low or if there is a need to use other reporter molecules such as catalyzed reporter deposition (CARD)-FISH (26). Further testing of the ndings is warranted in a clinical scenario. ACKNOWLEDGMENTS The authors declare that no conict of interest exists. Our thanks to the Australian Proteome Analysis Facility for laboratory facilities. REFERENCES
1. Poppert S, Riecker M, Wellinghausen N, et al. Accelerated identication of Staphylococcus aureus from blood cultures by a modied uorescence in situ hybridization procedure. J Med Microbiol 2010;59:6568. 2. Tavares A, Inacio J, MeloCristino J, et al. Use of uorescence in situ hybridization for rapid identication of staphylococci in blood culture samples collected in a Portuguese hospital. J Clin Microbiol 2008;46:30973100. 3. Oliveira K, Brecher SM, Durbin A, et al. Direct identication of Staphylococcus aureus from positive blood culture bottles. J Clin Microbiol 2003;41:889891. 4. Kempf VA, Trebesius K, Autenrieth IB. Fluorescent in situ hybridization allows rapid identication of microorganisms in blood cultures. J Clin Microbiol 2000;38:830838. 5. Peters RPH, Savelkoul PHM, SimoonsSmit AM, et al. Faster identication of pathogens in positive blood cultures by uorescence in situ hybridization in routine practice. J Clin Microbiol 2006;44:119123. 6. Peters R, Agtmael MAV, SimoonsSmit AM, et al. Rapid identication of pathogens in blood cultures with a modied uorescence in situ hybridization assay. J Clin Microbiol 2006;44:41864188. 7. Krimmer V, Merkert H, Eiff CV, et al. Detection of Staphylococcus aureus and Staphylococcus epidermidis in clinical samples by 16S rRNAdirected in situ hybridization. J Clin Microbiol 1999;37:26672673. 8. Horvath A, Kristof K, KonkolyThege M, et al. Rapid identication of pathogens in blood culture with uorescent in situ hybridization (FISH). Acta Microbiol Immunol Hung 2010;57:225234. 9. Wang P. Simultaneous detection and differentiation of staphylococcus species in blood cultures using uorescence in situ hybridization. Med Princ Pract 2010;19:218221. 10. Gescher DM, Kovacevic D, Schmiedel D, et al. Fluorescence in situ hybridisation (FISH) accelerates identication of grampositive cocci in positive blood cultures. Int J Antimicrob Agents 2008;32:5159. 11. Jansen GJ, Mooibroek M, Idema J, et al. Rapid identication of bacteria in blood cultures by using uorescently labeled oligonucleotide probes. J Clin Microbiol 2000;38:814817. 12. Trebesius K, Leitritz L, Adler K, et al. Culture independent and rapid identication of bacterial pathogens in necrotising fasciitis
involved and take longer than those that use oligo-f. Multiple oligo-b probes applied to the same specimen for different microbes cannot be distinguished by streptavidin-f as it binds to all of them. This can be a major disadvantage since it is necessary in diagnostic FISH to combine the use of a species-specic probe with a eubacterial probe as an internal control. In addition, nonspecic background staining is higher when streptavidin-f is used. The study found, however that it is possible to detect bacteria quickly with a relatively simple oligo-b FISH assay. It was not possible to apply and distinguish between multiple oligo-b probes simultaneously with streptavidin-f. As a simple work-around, the same specimen was spotted to more than one slide well and a different oligo-b probe was applied to each well. The ip-side of this biotinstreptavidin system limitation is that only one streptavidin-f is required for visualization and the cost of an oligo-b probe is about a quarter of its oligo-f counterpart. Nonspecic background staining was controlled by more stringent washes, and minimizing the amount of streptavidin-f. An unexpected outcome of the study was that the 1-hr two-step FISH assay produced a higher signal intensity than the one-step assay when oligo-f probes were used. This suggests that permeabilization is a key factor in hybridization. The time-to-result is 15 min longer, but if the FISH signal is low or the background nonspecic signal is high, the two-step FISH assay might be a more practical choice. Study Limitations Cultures of clinical samples rather than clinical isolates were tested. Reference strains and other frequently encountered microbes were not tested. Since it was difcult to control for the variation when comparing the FISH signal intensity between treatments, representative images were used. Each treatment was repeated three times, an image was taken and if the variation between the three images was not signicant, one image was chosen as representative. The two-step FISH assay that was developed could not be shortened to less than 1-hr without loss of S. epidermidis EUB338 signal. The optimized protocols listed in Table 1 were a compromise to capture the varied responses of the microbes tested. S. aureus produced a higher and more consistent signal when treated with methanol and lysostaphin, whereas S. epidermidis produced a higher and more consistent signal with ethanol and lysozyme. CONCLUSION The study found that a FISH assay that used a lysozyme step followed by a PBSlysostaphin step had a higher STAAUR signal and could be applied almost as
J. Clin. Lab. Anal.
Optimization of FISH for Staphylococcus aureus
and streptococcal toxic shock syndrome by uorescence in situ hybridisation. Med Microbiol Immunol 2000;188: 169175. Hogardt M, Trebesius K, Geiger AM, et al. Specic and rapid detection by uorescent in situ hybridization of bacteria in clinical samples obtained from cystic brosis patients. J Clin Microbiol 2000;38:818825. Wu Q, Li Y, Wang M, et al. Fluorescence in situ hybridization rapidly detects three different pathogenic bacteria in urinary tract infection samples. J Microbiol Methods 2010;83:175178. Matsuhisa A, Saito Y, Ueyama H, et al. Detection of staphylococci in mouse phagocytic cells by in situ hybridization using biotinylated DNA probes. Biotech Histochem 1994;69: 3137. Shimada J, Hayashi I, Inamatsu T, et al. Clinical trial of insitu hybridization method for the rapid diagnosis of sepsis. J Infect Chemother 1999;5:2131. Kudo M, Matsuo Y, Nakasendo A, et al. Potential clinical benet of the in situ hybridization method for the diagnosis of sepsis. J Infect Chemother 2009;15:2326. Thomas LC, Gidding HF, Ginn AN, et al. Development of a realtime Staphylococcus aureus and MRSA (SAM) PCR for routine blood culture. J Microbiol Methods 2007;68: 296302. Baldrich E, Vigues N, Mas J, et al. Sensing bacteria but treating them well: Determination of optimal incubation and storage conditions. Anal Biochem 2008;383:6875.
365
13.
14.
15.
16.
17.
18.
19.
20. Cisani G, Varaldo PE, Grazi G, et al. High-level potentiation of lysostaphin anti-staphylococcal activity by lysozyme. Antimicrob Agents Chemother 1982;21:531535. 21. Lawson TS, Connally RE, Iredell JR, et al. Detection of Staphylococcus aureus with a uorescence in situ hybridization that does not require lysostaphin. J Clin Lab Anal 2011;25:142147. 22. Yan C, Ding B, Lan X, et al. The toxicity study on marine lowtemperature lysozyme. Food Chem Toxicol 2008;46:604609. 23. Yilmaz LS, Parnerkar S, Noguera DR. MathFISH, a web tool for the in silico evaluation of oligonucleotide probes for uorescence in situ hybridization based on thermodynamic models. Appl Environ Microbiol 2010;77:11181122. 24. Amann RI, Binder BJ, Olson RJ, et al. Combination of 16S rRNAtargeted oligonucleotide probes with ow cytometry for analyzing mixed microbial populations. Appl Environ Microbiol 1990;56:19191925. 25. Daims H, Ramsing NB, Schleifer KH, et al. Cultivationindependent, semiautomatic determination of absolute bacterial cell numbers in environmental samples by uorescence in situ hybridization. Appl Environ Microbiol 2001;67:58105818. 26. Pernthaler A, Pernthaler J, Amann R. Fluorescence in situ hybridization and catalyzed reporter deposition for the identication of marine bacteria. Appl Environ Microbiol 2002;68: 30943101. 27. Deere D, Vesey G, Milner M, et al. Rapid method for uorescent in situ ribosomal RNA labelling of Cryptosporidium parvum. J Appl Microbiol 1998;85:807818.
J. Clin. Lab. Anal.
66
Clin. Lab. 2011;57:789-794 Copyright
SHORT COMMUNICATION
3.3 Express uorescence in situ hybridization methods for the detection of Staphylococcus aureus
Express Fluorescence in Situ Hybridization Methods for the Detection of Staphylococcus Aureus
THOMAS S. LAWSON, RUSSELL E. CONNALLY, SUBRAMANYAM VEMULPAD, JAMES A. PIPER
Faculty of Science, Macquarie University, Sydney, Australia
SUMMARY Background: As a proof-of-concept, the feasibility of detecting Staphylococcus aureus faster than previous wholecell fluorescent in situ hybridization (FISH) methods was tested. Methods: Isolates of Staphylococcus were treated with three rapid slide-based FISH protocols and DNA probes. Protocols were shortened by optimizing, combining or omitting steps. Results: All FISH protocols detected S. aureus and not the phenotypically similar Staphylococcus epidermidis. The express FISH assay was completed in 24 minutes. The one-step FISH assay with NaCl and the one-step with phosphate buffered saline (PBS) assay took 19 minutes, but yielded a weaker signal. Conclusions: The exploratory study identified S. aureus two to three times faster than previous methods. Additional testing in a clinical laboratory scenario (for example with positive blood-culture bottles) is warranted. (Clin. Lab. 2011;57:789-794)
INTRODUCTION Faster detection of S. aureus in clinical diagnostics is desirable (1-3). FISH is a reliable method for detecting S. aureus and its time-to-result has been shortened from 127 minues (4,5) and 581,3 minutes down to 45 minutes (2). Peptide nucleic acid (PNA) probes can further reduce this time, but the cost is significant (Panagene) (6). FISH might be better utilized if its results were available in a similar time-frame as Gram-staining (7). We believed that the conventional FISH assay could be further shortened if it was optimized. FISH typically uses lysostaphin to permeabilize S. aureus for DNA probe access (2,4,5). Other diagnostic assays have also used lysostaphin (8,9) and so we reasoned that lysostaphin might allow certain FISH steps to be combined or omitted.
MATERIALS AND METHODS Three FISH methods were tested and assessed against a method reported by Poppert et al. (2). Details not listed in Table 1 are as follows. To rectify a report of cell loss (5), 0.02 % (w/v) agarose (Bio-Rad, 162-0102) was
spotted to diagnostic glass slides and heat fixed at 80 oC (10,11). Ten clinical isolates of S. aureus and S. epidermidis were randomly collected from blood agar plates at a major hospital. Identity of the isolates was confirmed with polymerase chain reaction (PCR) (12) and then deidentified for FISH. To allow up to 4 X daily FISH experiments at a non-clinical location, isolates were cultured in nutrient broth (Oxoid, CM0001), aliquoted, and then pelleted and stored for up to three months as described by Baldrich et al. (13). Before testing each FISH method three times, isolates were thawed and re-cultured in nutrient broth until turbid (70 minutes, 0.5 McFarland) (13). As a control, isolates were tested directly from agar plates with no difference in results. To minimize reaction time, reagents and slides were held in preheated 50 mL centrifuge tubes with screw-caps (Greiner, 210-261). A DNA probe specific for S. aureus (Invitrogen, Staaur 16S69: 5'- GAAGCAAGCTTCTCGTCCG -3) and a eubacteria probe EUB338 both conjugated at the 5' end to Alexa Fluor 488 (Invitrogen) were applied. A representational image (24-bit-RGB TIFF) of each FISH method was acquired (Olympus, BX51) and ana_____________________________________________
Short Communication accepted April 29, 2011
Clin. Lab. 9+10/2011
789
3.3 Express fluorescence in situ hybridization methods for the T. S. LAWSON et al. detection of Staphylococcus aureus
Table 1. Express, one-step and one-step with PBS FISH methods. Express FISH One-step One-step with PBS
67
Preparation: Isolates were cultured in nutrient broth until turbid, spotted (1 Preparation: Same as the express FISH minute), fixed to slides at 80 oC (3 minassay utes), methanol fixed (1 minute), and airdried (1 minute) Permeabilization: Slides were spotted (1 minute) with lysis reagent (15 mg/mL lysozyme, 100 g/mL lysostaphin, 20 No permeabilization step mM Tris-HCl pH 7.0) and incubated at o 40 C (4 minutes), rinsed with methanol, and air-dried (1 minute) Hybridization: Slides were spotted with buffer [20 % formamide (v/v), 0.9 mol/L NaCl, 20 mM Tris-HCl pH 8.0, 0.02 % (v/v) SDS, 2 M probe, 0.5 g/mL DAPI, and Milli-Q water] (1 minute), and incubated at 47 oC (8 minutes) Hybridization: Slides were spotted with buffer [100 g/mL lysostaphin, 1.2 mol/L NaCl, 0.02 % SDS, 20 mM Tris-HCl pH 7.0, 2 M probe, 0.5 g/mL DAPI, MilliQ water], and incubated at 47 oC (10 minutes)
Preparation: Same as the express FISH assay
No permeabilization step
Hybridization: Slides were spotted with buffer [100 g/mL lysostaphin, 8XPBS (Sigma, P4417) buffer, 1 % (v/v) Tween 20, 2 M probe, 0.5 g/mL DAPI, and Milli-Q water] (1 minute), and incubated at 47 oC (10 minutes)
Washing: Slides were incubated with washing buffer [0.318 mol/L NaCl, 20 mM Tris-HCl pH 8.0, 0.01 % SDS, 10 Washing: Slides were rinsed with PBS (1 Washing: Slides were rinsed with PBS (1 mM EDTA, and Milli-Q water] at 47 oC minute) minute) (1 minute), and rinsed with PBS (1 minute) Total time: 24 minutes Total time: 19 minutes Total time: 19 minutes
lyzed with ImageJ (NIH, v1.43u). Three image attributes were compared: the signal intensity, the size of the cell with FISH staining and the ratio of cells with FISH signal. To measure signal intensity, an image mask was created to delineate the cells for analysis. Threshold levels were set automatically for the control FISH image and kept constant for the other images. To measure the size of individual cells stained with FISH, the diameter of representative cells was measured and the area calculated. To measure the ratio of cells with FISH signal to those without, the FISH mask was inverted, formatted to a red channel (24-bit, RGB), and merged with a blue DAPI (Sigma, D9564) channel image, and the differences measured. Parametric assumptions were tested with a histogram of the signal and a p value of <0.05 was considered significant. The mean signal intensity grayscale, standard deviation and a 95 % confidence interval for each FISH method image were calculated (Table 2). Summary statistics were compared with one-way analysis of variance (ANOVA).
RESULTS The control (2) and express FISH methods had similar signal intensity, PBS FISH was weaker, and the onestep signal weaker again (Table 2). Image analysis was confirmed by observation (Figure 1). A one-way ANOVA of the mean signal intensity between methods was found to be significantly different (p <0.000). If agarose was not added to the slides, signal variance increased but its intensity did not change. A further control where molten 0.4 % (w/v) agarose and the broth culture of the isolates was diluted 1:1 and applied to slides (data not shown) (11) confirmed this result. No difference was observed in the diameter of cells with FISH signal. For the ratio of cells labeled with FISH, there were minor discrepancies, but these were attributed to the threshold setting filtering out cells outside the focal-plane with FISH signal and not those with DAPI signal. For all methods, no cross-reactivity was observed; S. aureus was positive for the Staaur probe and S. epidermidis was not. With the one-step and PBS FISH methods, however the S. epidermidis EUB338 signal was insufficient.
790
Clin. Lab. 9+10/2011
68
EXPRESS DETECTION OF S. AUREUS WITH FISH
Table 2. Comparison of the signal intensity for the three FISH protocols and a control FISH assay 2. FISH methods are listed in Table 1. Signal Intensity FISH assay Meana 2 Control FISH Express FISHc Express FISH without agarose One-step FISHe One-step with PBS FISH
f d
CIb 0.9 0.7 3.7 1.0 0.7
43.9 44.2 44.8 37.7 41.4
a Mean signal intensity was measured in 8 -bit Gray-scale. b Confidence interval was calculated at 95 % c A 2 minute permeabilization step, 2 mg/mL lysozyme and 0.02 mg/mL lysostaphin treatment was sufficient for S. aureus and Staaur, but not for S. epidermidis and the EUB338 probe d As a control no agarose was added to the slide before FISH e Buffer with 0.9 mol/L NaCl was optimal for EUB338 but not for the Staaur probe f Over-permeabilized if not treated with Tween 20 or a methanol bath
A)
Clin. Lab. 9+10/2011
791
B)
69
C)
Figure 1. S. aureus labeled with the Staaur probe conjugated to Alexa Fluor 488 after express (a), one-step (b) and one-step PBS FISH (c). Exposure time was kept constant and there was no processing after acquisition. Bar is 10 M.
792
Clin. Lab. 9+10/2011
70
DISCUSSION
EXPRESS DETECTION OF S. AUREUS WITH FISH

ment over the one-step FISH (Table 2). Assay time for the one-step PBS FISH remained at 19 minutes. The results have a number of limitations. Blood culture bottles, S. aureus reference strains, and other microbes were not tested (3,5). Pretreating slides with agarose was helpful, but not necessary. For comparison lysozyme and lysostaphin was set at 15 mg/mL and 0.1 mg/ mL, respectively, but was not optimal for every method (15). As both FISH probes were conjugated to the same fluorophore, they could not be applied simultaneously (5). For image analysis, some cells were measured outside the focal plane, a single representative image rather than multiple images was analyzed, and minor DAPI bleeding was observed. To conclude, shorter assay times are desirable, but longer hybridization times may still be necessary for reliable detection when patients are pretreated with antibiotics and pathogen rRNA is low (4). The findings warrant testing the applicability of these methods in a clinical laboratory scenario.
The proof-of-concept study set out to test the feasibility of shortening the conventional FISH assay (1-3). The differences observed in FISH staining between methods was found to be attributed to signal intensity and not to the size of the cells or the ratio of cells stained with FISH (Figure 1). The results suggest that a 24 minute express FISH assay can identify S. aureus without compromising the signal. By permeabilizing with only lysostaphin, the specificity of the one-step and PBS FISH methods increased and the washing step became unnecessary, but the signal was reduced. The weaker signal might be due to the limitation of using one instead of two lytic enzymes. Possibly PBS performed better than one-step FISH as its conditions are optimal for lysostaphin activity (14). To develop the three FISH methods, Poppert et al. (2) was taken as a starting point. We considered that optimizing the conditions for each FISH step might reduce its overall length. The express FISH assay is listed in Table 1. For the preparation step, air-drying time was shortened to 3 minutes by placing slides on an 80 oC heat-block and methanol fixation was reduced without signal loss to one minute. For the permeabilization step, S. aureus took 2 minutes, but S. epidermidis required 4 minutes with 15 mg/mL (15) or 600 U/G lysozyme (Sigma, L6876) and 0.1 mg/mL (5,15) or 0.3 U/G lysostaphin (Sigma, L9043) at pH 7.0 (14,16,17) and 40 oC (14,17). For the hybridization step, incubation was shortened to 8 minutes without signal loss and DAPI was added to avoid a separate counter-staining step. For the washing step, we found that washing could be shortened to one minute by increasing NaCl stringency until no signal was observed with S. epidermidis. As a result, the express FISH assay turnaround-time was reduced from 45 (2) to 24 minutes. We then tested if combining and omitting FISH steps to reduce the time further was feasible. The one-step FISH assay is listed in Table 1. The preparation step was the same as express FISH. For the combined permeabilization and hybridization buffer, we were unable to add lysozyme at a NaCl concentration above 0.1 mol/L or lysostaphin at a formamide (Applichem, A2156) concentration above 15 % (16). So only lysostaphin was added to the formamide-free buffer and tested at increments of 0.15 mol/L NaCl from 0.0 to 1.8 mol/L and found it to be optimal at 1.2 mol/L for the Staaur probe. Total turnaround-time was cut from 24 to 19 minutes but the signal was weaker. We recognized that PBS (Sigma, P4417) might provide ideal conditions for lysostaphin (14) and thought that using PBS buffer could overcome the weaker signal observed with one-step FISH. The one-step PBS FISH assay is listed in Table 1. For the buffer, an equivalent ionic concentration of PBS replaced NaCl, Tris-HCl was unnecessary and Tween 20 replaced SDS as it reduced over-permeabilization. As before, the washing step was omitted. The resulting signal was an improve-
Acknowledgment: The study was funded by the Australian Research Councils Linkage Projects (LP0775196). Declaration of Interest: There are no conflicts of interest for the authors.
References:
1. Peters RP, Agtmael MAV, Simoons-Smit AM, Danner SA, Vandenbroucke-Grauls CM, Savelkoul PH. Rapid identification of pathogens in blood cultures with a modified fluorescence in situ hybridization assay. Journal of Clinical Microbiology 2006;44: 4186-8. Poppert S, Riecker M, Wellinghausen N, Frickmann H, Essig A. Accelerated identification of Staphylococcus aureus from blood cultures by a modified fluorescence in situ hybridization procedure. Journal of Medical Microbiology 2010;59:65-8. Horvath A, Kristof K, Konkoly-Thege M, Nagy K. Rapid identification of pathogens in blood culture with fluorescent in situ hybridization (FISH). Acta Microbiologica et Immunologica Hungarica 2010;57:225-34. Gescher DM, Kovacevic D, Schmiedel D, et al. Fluorescence in situ hybridisation (FISH) accelerates identification of gram-positive cocci in positive blood cultures. International Journal of Antimicrobial Agents 2008;32 Suppl 1:51-9. Wang P. Simultaneous detection and differentiation of staphylococcus species in blood cultures using fluorescence in situ hybridization. Medical Principles and Practice 2010;19:218-21. Hermsen ED, Shull SS, Klepser DG, et al. Pharmacoeconomic analysis of microbiologic techniques for differentiating staphylococci directly from blood culture bottles. Journal of Clinical Microbiology 2008;46:2924-9. Munson EL, Diekema DJ, Beekmann SE, Chapin KC, Doern GV. Detection and treatment of bloodstream infection: laboratory reporting and antimicrobial management. Journal of Clinical Microbiology 2003;41:495-7.
2.
3.
4.
5.
6.
7.
Clin. Lab. 9+10/2011
793
8. Geary C, Stevens M. Rapid lysostaphin test to differentiate staphylococcus and micrococcus species. Journal of Clinical Microbiology 1986;23:1044-5. Tuncan EU, Martin SE. Lysostaphin lysis procedure for detection of Staphylococcus aureus by the firefly bioluminescent ATP method. Applied and Environmental Micro-biology 1987;53:8891.
71
14. Schindler CA, Schuhardt VT. Purification and properties of lysostaphin A lytic agent for Staphylococcus aureus. Biochimica et Biophysica Acta 1965;97:242-50. 15. Cisani G, Varaldo PE, Grazi G, Soro O. High-level potentiation of lysostaphin anti-staphylococcal activity by lysozyme. Antimicrobial Agents and Chemotherapy 1982;21: 531-5. 16. Davies RC, Neuberger A, Wilson BM. The dependence of lysozyme activity on pH and ionic strength. Biochimica et Biophysica Acta 1969;178:294-305. 17. Szweda P, Kotlowski R, Kur J. New effective sources of the staphylococcus simulans lysostaphin. Journal of Biotechnology 2005;117:203-13.
9.
10. Daims H, Ramsing NB, Schleifer KH, Wagner M. Cultivationindependent, semiautomatic determination of absolute bacterial cell numbers in environmental samples by fluorescence in situ hybridization. Applied and environmental microbiology 2001;67: 5810-8. 11. Pernthaler A, Pernthaler J, Amann R. Fluorescence in situ hybridization and catalyzed reporter deposition for the identification of marine bacteria. Applied and Environmental Microbiology 2002;68:3094-101. 12. Thomas LC, Gidding HF, Ginn AN, Olma T, Iredell J. Development of a real-time Staphylococcus aureus and MRSA (SAM-) PCR for routine blood culture. Journal of microbiological methods 2007;68:296-302. 13. Baldrich E, Vigues N, Mas J, Munoz FX. Sensing bacteria but treating them well: Determination of optimal incubation and storage conditions. Analytical Biochemistry 2008; 383:68-75.
Correspondence: Thomas S. Lawson Faculty of Science, Macquarie University Sydney, NSW, 2109, Australia Tel.: +61 2 9850-8938 Fax: +61 2 9850 8115. E-mail: [email protected]
794
Clin. Lab. 9+10/2011
72
Improvements to the existing FISH method: a summary The ndings reported in this Chapter are as follows: 1. The number of FISH probes that could potentially identify SA was doubled (1). 2. The newly identied probes were found to have characteristics that were superior to the established probes (1). 3. Reagent preparation for FISH was improved (2). Reagents were formulated beforehand and stored long-term so that, just before commencing the procedure for FISH, they could then be mixed rapidly to their nal concentration(2). 4. Permeabilization of SA for the access of high-molecular weight probes was optimized (2). 5. SA was suciently permeabilized so that FISH could be performed in one hour, but without the loss of its cell integrity (2). 6. Turnaround time for the FISH assay was shortened from the previous fastest time of 45 minutes (32) to 24 minutes (3). This suggests that it might be possible to detect SA within half an hour of a blood culture becoming positive (3). There were limitations to these ndings. The FISH methods tested (52, 32, 40) relied on lysostaphin to permeabilize SA. Lysostaphin is an enzyme that is eective at permeabilizing SA (147), but can be costly and can complicate the preparation and performance of the FISH assay (95). The FISH methods that were tested also used formamide, a standard denaturing reagent for the hybridization of FISH probes (45). Formamide, however is toxic to use and disposal can be dicult (144). The FISH methods also relied on an incubator and a water-bath to oer the conditions necessary for the hybridization and washing of the probes which, because they are usually dedicated to the FISH assay, are an extra cost and take up bench-space when not used. The concerns raised here are addressed in Chapter 4. It reports on the feasibility of permeabilizing SA for DNA probes with lysozyme alone (4), instead of with both
3.3 Express fluorescence in situ hybridization methods for the detection of Staphylococcus aureus
73
lysozyme and lysostaphin (52). Lysozyme is an inexpensive enzyme (141) commonly used to permeabilize most Gram-positive bacteria in FISH (64). The replacement of formamide with non-toxic urea is also described (5). Finally, the replacement of an incubator and water-bath with a hot-plate whose temperature can be precisely controlled is reported.
74
4
Development of new FISH methods
This Chapter recounts an investigation into the re-engineering of the FISH assay for the identication of S. aureus (SA). The feasibility of detecting SA with FISH that was not rst permeabilized with lysostaphin is reported (4). The Chapter then reports on the feasibility of performing a FISH assay without formamide, an incubator or a water-bath (5). The Chapter comprises of two sections. Each of these sections were published in a peer reviewed journal and included as such. In the rst, SA is detected with a DNA-based FISH assay that permeabilizes with lysozyme alone: Lawson TS, Connally RE, Iredell JR, Vemulpad S, Piper JA. Detection of Staphylococcus aureus with a uorescence in situ hybridization that does not require lysostaphin. J Clin Lab Anal 2011;25:142-147 (4). In the second, SA is detected with an urea-NaCl based FISH assay that uses a hot-plate with a precise temperature control for the incubation steps: Lawson T, Connally R, Vemulpad S, Piper JA. Dimethyl formamide-free, urea-NaCl uorescence in situ hybridization (FISH) assay for Staphylococcus aureus. Lett Appl Microbiol 2012;10.1111/j.1472-765X.2011.03197.x:(in press) (5).
75
76

Journal of Clinical Laboratory Analysis 25 : 142147 (2011)
4.1
Detection of Staphylococcus aureus with a uorescence in situ hybridization that does not require lysostaphin
Detection of Staphylococcus aureus With a Fluorescence In Situ Hybridization That Does Not Require Lysostaphin
Thomas S. Lawson,1,2 Russell E. Connally,1 Jonathan R. Iredell,2 Subramanyam Vemulpad,1 and James A. Piper3
2
Faculty of Science, Macquarie University, NSW, Australia Centre for Infectious Diseases and Microbiology, Westmead Hospital, Sydney, NSW, Australia 3 Department of Physics, Macquarie University, NSW, Australia
To detect with whole-cell uorescence in situ hybridization (FISH), Staphylococcus aureus is typically permeabilized with lyozyme and lysostaphin. We tested whether it was feasible to detect S. aureus and differentiate it from Staphylococcus epidermidis with lysozyme-only permeabilization. We compared lysozyme permeabilization
to S. aureus permeabilized with lysozyme in combination with lysostaphin. It was determined that S. aureus treated with agarose, methanol, and lysozyme could be detected with FISH. The 1 hr protocol is a useful alternative to conventional FISH. J. Clin. Lab. Anal. 25:142147, r 2011 Wiley-Liss, Inc. 2011.
Key words: early diagnosis; uorescent in situ hybridization; gram-positive bacteria; molecular diagnostic; Staphylococcus aureus; lysostaphin; lysozyme; techniques
INTRODUCTION Slide-based uorescence in situ hybridization (FISH) is a reliable method for detecting pathogenic Staphylococcus aureus and distinguishing it from the relatively benign Staphylococcus epidermidis (13). If DNA rather than the costly Peptide Nucleic Acid probes (Panagene) are applied, permeabilization is necessary to ensure access of probes to in situ ribosomal RNA (rRNA) (4,5). Usually, permeabilization is conducted with the enzymes lysozyme (Sigma, L6876; Sigma-Aldrich, St. Louis, MO) and lysostaphin (Sigma, L4402), either mixed together (6,7) or in two steps (2,8). Other permeabilization treatments, such as hydrochloric acid (9), nisin (10), proteinase K (9), staphylolysin (11) or Triton X100 (12) are only sometimes adopted (2,3,5,6,13). Permeabilization can complicate the application of FISH in routine laboratory diagnostics, as it has to be conducted precisely (2). Underpermeabilization can result in a low FISH signal and overpermeabilization in lysis and cell loss (4). A simplication of this step leading to more consistent outcomes is desirable. Lysozyme applied on its own for the detection of S. aureus was previously reported, but the assays described took a number of hours (14,15). We report
c
here the efcacy of applying a single enzyme (lysozyme) instead of two, to rapidly detect S. aureus with FISH. MATERIALS AND METHODS Preparation To reduce cell loss (16), an agarose (BioRad, 162 0102; Bio-Rad Laboratories, CA) bed was applied to diagnostic glass slides (MenzelGla ser, X1XER308B; Menzel Gla ser, Braunschweig, DE). The bed was prepared by adding 0.02% (w/v) agarose and 0.01% (w/v) sodium azide (Sigma, S2002) to Milli-Q waters (MQ) (Millipore, Billerica, MA) and dissolving it by heating without boiling in a microwave oven. The agarose dilute was spotted 10 ml to each slide well and dried on an 801C hotplate. Blood agar plates of clinical isolates
Grant sponsor: Australian Research Councils Linkage Projects; Grant number: LP0775196.
Correspondence to: Thomas S. Lawson, Department of Physics,
Macquarie University, NSW 2109, Australia. E-mail: [email protected] Received 16 November 2010; Accepted 14 January 2011 DOI 10.1002/jcla.20448 Published online in Wiley Online Library (wileyonlinelibrary.com).
2011 Wiley-Liss, Inc.
4.1 Detection of Staphylococcus aureus with a fluorescence in situ hybridization that does not require lysostaphin
S. aureus Detection With Lysozyme FISH
77
143
positive for S. aureus and S. epidermidis were randomly collected from a major hospital. Isolate identity was conrmed via polymerase chain reaction (17). For safe handling, the rst ten isolates of S. aureus negative for the mecA gene and the rst ten isolates identied as S. epidermidis were selected for further testing. Isolates were deidentied at collection and labeled numerically to ensure their identity was blinded when assessed. Isolates were cultured in 50 ml sterilized tubes of nutrient broth (Oxoid, CM0001; Oxoid, Hampshire, UK) and incubated at 371C with a gentle rotation until turbid. Broth dilutions for blood cultures were used, as it allowed shortened incubation times of 12 hr from frozen isolates as opposed to day or overnight incubations. To enhance probe signal and further reduce cell loss, prewarmed 0.4% (w/v) agarose and the broth culture of the isolates was diluted 1:1 (16). The agaroseisolate dilute was then spotted 10 ml to each slide well and xed with an 801C hotplate until dry. Permeabilization To further x and partially permeabilize the isolates, the slides were washed in 50 ml sterile tubes of absolute methanol for 3 min (6). Slides were removed and dried on a hotplate. The slides were cooled and 10 ml of freshly prepared 15 mg/ml lysozyme (18) in unbuffered MQ water (12,19,20) was pipetted to each well. Typically, lysozyme is buffered with TrisHCl at pH 8.0 (2,3,5,6,13), but for simplicity and to attain a more intense signal (21), we followed reports where buffering was omitted (12,19,20). Slides were tted in 50 ml tubes to prevent evaporation and then placed in a 371C (21) incubator for 30 min (12). The lysozyme action was stopped by immersion in absolute methanol for 1 min and then dried on a hotplate (6). The isolates were also permeabilized with a lysozyme lysostaphin mixture. The protocol was identical to the lysozyme-only treatment, but with the following modications. Lysostaphin (Sigma, L4402) at 100 mg/ml (3) was added to the lysozyme in MQ water (19) and
incubated at 401C (21,22) for 3 (6) instead of 30 min. As a control, lysozymelysostaphin was kept unbuffered, but we observed cell morphology was better preserved if it was buffered at pH 8.0 (2,3,5,6,13). As before, slides were immersed for 1 min in absolute methanol (6). Additional tests were performed to compare the quality and applicability of other reagents. Fixatives and permeabilizers were selected on the basis of previous reports and the signal intensity, cells stained with FISH, cell loss after FISH, time taken for the assay, and costs were compared (Table 1), for different permeabilization treatments. The lysozyme and lysostaphin and lysozymeonly treatments are already described. The treatment with lysostaphin excluded lysozyme (23). The treatment without agarose excluded agarose spotting to the slides or agarose in dilution with the isolates (16). The treatment with lysozyme after ethanol replaced the methanol xation step with absolute ethanol (2). The proteinase K treatment replaced the 30 min lysozyme step with 10 min incubation in 1 mg/ml proteinase K (P4850, Sigma) at 401C, a methanol rinse for inactivation, and 10 min incubation with 1 mg/ml lysozyme at 401C. The lysozyme after HCl acid treatment was the same as the proteinase K treatment, except proteinase K was replaced with 1 M HCL at 371C (24). The treatment with Tween 20 (P7949, Sigma) after lysozyme added a 5 min incubation step at room temperature with Tween followed by a water rinse. The treatment with Triton X100 (T8787, Sigma) after lysozyme (12) was the same as Tween, expect with Triton. The no permeabilization treatment omitted the personalization step. If not listed, other FISH steps were the same as the lysozyme-only treatment. FISH A hybridization buffer was prepared with 0.9 M NaCl (Sigma, S6191), 20 mM TrisHCl (Sigma, T1503, T3253), and 0.02% (w/v) SDS (Sigma, L4390) in MQ water (25). Either 15% (v/v) deionized formamide
TABLE 1. Comparison of Different S. aureus Permeabilization Treatments Concerning Quality and Robustness
Permeabilization treatment Lysozyme and lysostaphin Lysostaphin Lysozyme Lysozyme without agarose Lysozyme after ethanol Lysozyme without alcohol xation Lysozyme after proteinase K Lysozyme after HCl acid Tween 20 after lysozyme Triton X-100 after lysozyme No permeabilization Signal intensity 1111 1111 1111 11 11111 111 1111 11111 1111 1 Cells stained 1111 111 1111 11 111 11 1111 1111 1111 1 Cell adhesion 111 111 111 11 111 111 1 11 111 111 111 Time (min) 7 7 34 33 34 31 21 21 39 39 4 Cost ($) 10 9 5 5 5 5 6 5 5 5 4
J. Clin. Lab. Anal.
78
144 Lawson et al.
(Applichem, A2156; Applichem, Darmstadt, DE) and 2 mM of Sau probe (Sau 16S69: 50 -GAAGCAAGCTTCTCGTCCG-30 ) specic for S. aureus or 30% (v/v) formamide and 2 mM of EUB338 probe (EUB338 16S337: 50 -GCTGCCTCCCGTAGGAGT-30 ) specic for bacteria was added (Invitrogen, Carlsbad, CA). Both oligonucleotide (DNA) probes were conjugated to the fluorophore urophore fluorophore fluorophore Alexa Fluors 488 (Invitrogen). The buffer was spotted 10 ml to each well and the slides were tted in 50 ml tubes and placed in a 471C incubator for 20 min. After hybridization, slides were immediately tted in 50 ml tubes of prewarmed washing buffer containing 5 mM EDTA (Sigma, EDS), 0.64 M NaCl, 20 mM TrisHCl, and 0.02% (w/v) SDS in MQ water (25). Tubes were then placed in a 471C water bath for 3 min (6). Washing action was stopped by rinsing in a 50 ml tube of phosphate buffered saline (PBS) (Sigma, P4417) at room temperature and followed by drying with pressurized air (6). If required, isolates were counterstained with 15 ml of 1 mg/ml DAPI for 1 min and then rinsed with PBS (16). Cells were visualized with a uorescence microscope (Olympus, BX51; Olympus, Tokyo, Japan) equipped with a uorescein lter. Different permeabilization treatments are listed in Table 1. The ratios are indicated by 1111 for all, 111 for three quarters, 11 for half, and 1 for a quarter or less. A negative result is indicated by . The signal intensity (1) was measured relative to the lysozyme and lysostaphin FISH treatment. Cells stained (1) with FISH was measured from the ratio of cells with FISH to DAPI (Sigma, D9564) signal. Cell adhesion (1) was measured from the ratio of cells remaining after FISH to cells observed with DAPI before FISH. Time (Min) taken for each treatment included the sum of the agarose, xation, and permeabilization steps. The cost ($) was rounded to the nearest dollar for a daily run of four FISH experiments, each with two slides (Sigma, USD). All treatments were adjusted so that cell lysis was
minimal. The treatment was repeated in its nal form three times. For each experimental variable, two wells were tested and three elds of view with an objective of X60 were assessed. Two independent, blinded observers analyzed the images. Slight variation was observed between slide wells, but not between experimental runs. RESULTS Table 1 summarizes the results of different treatments in terms of quality and robustness. Both lysozyme-only and lysozymelysostaphin permeabilization detected S. aureus and differentiated it from S. epidermidis with the Sau probe. For the initial tests, all enzymes were left unbuffered. Lysozymelysostaphin had a brighter signal than lysozyme-only treated S. aureus. However, the lysozymelysostaphin left cells overpermeabilized and lysed. Once a buffer at pH 8.0 was added, the lysis was controlled, and S. aureus treated for 3 min with lysozymelysostaphin, which had a result equivalent to that of a 30 min lysozyme-only treatment. Figure 1 illustrates the ability to detect S. aureus with the Sau probe for both treatments. In addition, no crossreactivity was noted for the Sau probe; it was positive for S. aureus and negative for the S. epidermidis isolates. Likewise, both treatments detected S. aureus and S. epidermidis with the universal EUB338 probe. We could not obtain a signal rapidly with lysozyme alone unless the S. aureus isolates were diluted in agarose. This lengthened the assay, but it was only a slight encumbrance as the step was performed in 1 min. Agarose doubled the signal intensity, the ratio of cells with signal, and increased cell adhesion. Without the agarose dilution, similar signal intensity was realized if the cells were hybridized for 70 instead of 20 min. We tested cell loss of isolates in agarose spotted to slides prepared and unprepared with an agarose bed. We observed that agarose spotted slides further reduced cell
Fig. 1. S. aureus permeabilized with lysozyme (A), and S. aureus permeabilized with lysozymelysostaphin (B). S. aureus were labeled with the Sau probe conjugated to the uorophore Alexa Fluors 488. Bar is 10 mm. (A) S. aureus permeabilized with lysozyme. (B) S. aureus permeabilized with lysozyme and lysostaphin.
J. Clin. Lab. Anal.
79
145
loss. This might be an advantage if the number of target cells is low. As the bed can be applied before a FISH procedure, its preparation does not complicate or lengthen FISH. A number of different xation procedures were tested (Table 1). Applying 100% methanol to the slides was observed to be the most effective and rapid xation (6). Ethanol xation of slides produced a brighter signal, but was less consistent than with methanol. Omitting the alcohol xation step reduced both signal intensity and consistency. Tween 20 enhanced the signal, but it involved an additional assay step. Yet, when we tested lysozyme diluted with Tween, the signal did not differ from lysozyme-only permeabilization. In contradiction to previous reports (12), we saw no improvement with Triton X100. Permeabilization with hydrochloric acid produced poor results; it seemed to inhibit the action of the conjugated probe itself. As a control, FISH was performed with the permeabilization step omitted. Less than one quarter of the S. aureus cells had sufcient signal. As a further control, FISH was performed with only lysostaphin (19). High signal strength was observed, but the signal was less consistent than that of S. aureus treated with lysozyme lysostaphin or the proposed lysozyme-only method. Isolates were tested directly from blood agar plates with lysozyme-only and in combination with lysostaphin. The results were consistent with tests of S. aureus cultured in nutrient broth. Poor results were obtained with lysozyme-only permeabilization if agarose was omitted. Preliminary testing (data not shown) with a healthcare-associated meticillin-resistant S. aureus, (HA)MRSA isolate and a community-associated (CA)MRSA isolate, was comparable to the mecAnegative isolates (26). Lysoyme and lysostaphin are commonly applied at a pH of 8.0 (2,3,5,6,13). Buffering at pH 8.0 was found to reduce the loss of cell morphology with lysostaphin. However, we observed that lysozyme-only assay produced poor results unless the pH was reduced to 7.0. The lysozyme-only assay was tested and found to be effective without buffering, and so for simplicity, Tris-HCl buffer was omitted from the nal tests. We experienced some difculty applying Proteinase K. The precise concentration, incubation temperature, and time necessary for permeabilization but not overlysis was difcult to manage. Washing with 100% methanol reduced overpermeabilization, but an agarose bed and dilution in agarose did not stop the loss of up to half the cells. To minimize thickness and visual aberration, we tested the lowest concentration of agarose necessary to maintain cell adhesion and signal intensity (27). We found that an agarose concentration of 0.02% (w/v) was sufcient for the slide bed and 0.2% sufcient for the
isolate dilution. For simplicity, we diluted 0.4% (w/v) agarose 1:1 with the isolates. This may, however, have a negative effect on the assays sensitivity if microbe numbers are low. To reduce overdilution of cells, we trialled one part agarose at 0.8% to three parts of nutrient broth with isolates, without signal loss. An additional benet of agarose was that the probe concentration could be reduced by a factor of ve without loss of signal. Initially, experiments were performed at 5 mM probe concentrations, but after the addition of agarose, this was reduced to 1 mM. As a safety margin, the nal experiments were performed at 2 mM. DISCUSSION We set out to validate whether lysostaphin was necessary for detecting S. aureus with FISH. We demonstrated that S. aureus can be successfully permeabilized rapidly without lysostaphin. The ability of lysozyme-only to permeabilize S. aureus is likely owing to how the isolates were prepared after culturing and how they were xed and permeabilized. Isolates were diluted in agarose to enhance signal intensity (16,27); xed in mid-log phase when rRNA numbers were high (1,13); permeabilized by heat, methanol (6) and lysozyme (12); treated with a relatively high concentration of unbuffered lysozyme (12,1820); and nally incubated for an extended period of time (12) at an optimal temperature for lytic activity (21). There were some drawbacks to using an agarose bed and an agarose isolate dilution. For agarose stock dilution to mix properly with isolates in nutrient buffer, it needed to be prewarmed. When viewed with a uorescence microscope, the agarose did create visual aberrations and thickening of the specimen. To see all the cells in focus, it was necessary to adjust the microscope stage Z-axis up and down while viewing. Figure 1 illustrates FISH-labeled S. aureus inside and outside the focal plane. However, these encumbrances were offset by the doubling in signal intensity and cell adhesion. Rapid and effective FISH with only lysozyme was possible with this signal enhancement. When using bacteria from pure culture, cell loss was not a problem. However, it was felt that this study would have a wider utility if this parameter was optimized as well. Handling of lysostaphin was not straightforward. Minute amounts were involved (28) and upon weighing, the lyophilized powder (Sigma, L4402) readily absorbed moisture from the atmosphere, making exact measurement difcult. When diluted in water, its decline in activity was noticeable after 1 week. We saw some variation in S. aureus strain response to lysostaphin. These variables made the titration of lysostaphin necessary before each experiment to ensure that isolates
J. Clin. Lab. Anal.
80
146 Lawson et al.
were permeabilized optimally. Furthermore, lysostaphin was approximately 40 times more expensive by volume spotted than lysozyme (Sigma, L6876, L4402). In contrast, if only lysozyme was applied, the permeabilization step was more robust, less sensitive to variation in bacteria strains, less likely to overpermeabilize, and titration was unnecessary. Dilutions can be stored at 41C for 2 months before activity loss was noticeable. The weighing was relatively simple and did not require a microbalance scale housed in a draft-free enclosure. If preparation mistakes are made, the enzyme was reformulated quickly and without signicant expense. A limitation of the lysozyme-only FISH protocol was its turnaround time. At 1 hr, it was twice as long as the fastest reported lysozymelysostaphin protocol (6). However, this was still half the time of other presumptive tests for S. aureus (29,30). In conclusion, this study detected and differentiated S. aureus from S. epidermidis with a 1 hr FISH method that did not require lysostaphin. The procedure worked with Staphylococci taken directly from agar plates (data not shown), but further testing is required to assess the sensitivity and specicity of this practical method on blood cultures. ACKNOWLEDGMENTS The authors thank the Australian Proteome Analysis Facility and to Associate Professor Robert Willows at Macquarie University. REFERENCES
1. Krimmer V, Merkert H, Eiff CV, et al. Detection of Staphylococcus aureus and Staphylococcus epidermidis in clinical samples by 16S rRNA-directed in situ hybridization. J Clin Microbiol 1999;37:26672673. 2. Tavares A, Inacio J, Melo-Cristino J, Couto I. Use of uorescence in situ hybridization for rapid identication of staphylococci in blood culture samples collected in a Portuguese hospital. J Clin Microbiol 2008;46:30973100. 3. Wang P. Simultaneous detection and differentiation of staphylococcus species in blood cultures using uorescence in situ hybridization. Med Princ Pract 2010;19:218221. 4. Nistico L, Gieseke A, Stoodley P, Hall-Stoodley L, Kerschner JE, Ehrlich GD. Fluorescence in-situ hybridization for the detection of biolm in the middle ear and upper respiratory tract mucosa. J Methods Mol Biol 2009;493:191213. 5. Mallmann C, Siemoneit S, Schmiedel D, et al. Fluorescence in situ hybridization to improve the diagnosis of endocarditis: A pilot study. Clin Microbiol Infect 2010;16:767773. 6. Poppert S, Riecker M, Wellinghausen N, Frickmann H, Essig A. Accelerated identication of Staphylococcus aureus from blood cultures by a modied uorescence in situ hybridization procedure. J Med Microbiol 2010;59:6568. 7. Zautner AE, Krause M, Stropahl G, et al. Intracellular persisting Staphylococcus aureus is the major pathogen in recurrent tonsillitis. PLoS ONE 2010;5:9452. 8. Wu Q, Li Y, Wang M, Pan XP, Tang YF. Fluorescence in situ hybridization rapidly detects three different pathogenic bacteria in
9.
10.
11. 12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
urinary tract infection samples. J Microbiol Methods 2010;83: 175178. Moter A, Gobel UB. Fluorescence in situ hybridization (FISH) for direct visualization of microorganisms. J Microbiol Methods 2000;41:85112. Peters RP, Agtmael MAV, Simoons-Smit AM, Danner SA, Vandenbroucke-Grauls CM, Savelkoul PH. Rapid identication of pathogens in blood cultures with a modied uorescence in situ hybridization assay. J Clin Microbiol 2006;44: 41864188. Zwirglmaier K. Detection of prokaryotic cells with uorescence in situ hybridization. J Methods Mol Biol 2010;659:349. Cimino M, Alamo L, Salazar L. Permeabilization of the mycobacterial envelope for protein cytolocalization studies by immunouorescence microscopy. BMC Microbiol 2006;6:35. Kempf VA, Trebesius K, Autenrieth IB. Fluorescent in situ hybridization allows rapid identication of microorganisms in blood cultures. J Clin Microbiol 2000;38:830838. Kipp F, Ziebuhr W, Becker K, et al. Detection of Staphylococcus aureus by 16S rRNA directed in situ hybridisation in a patient with a brain abscess caused by small colony variants. Br Med J 2003;56:746. Hoa M, Tomovic S, Nistico L, et al. Identication of adenoid biolms with middle ear pathogens in otitis-prone children utilizing SEM and FISH. Int J Pediatr Otorhinolaryngol 2009;73:12421248. Pernthaler A, Pernthaler J, Amann R. Fluorescence in situ hybridization and catalyzed reporter deposition for the identication of marine bacteria. Appl Environ Microbiol 2002;68: 30943101. Thomas LC, Gidding HF, Ginn AN, Olma T, Iredell J. Development of a real-time Staphylococcus aureus and MRSA (SAM-) PCR for routine blood culture. J Microbiol Methods 2007;68:296302. Cisani G, Varaldo PE, Grazi G, Soro O. High-level potentiation of lysostaphin anti-staphylococcal activity by lysozyme. Antimicrob Agents Chemother 1982;21:531535. Oliveira M, Bexiga R, Nunes SF, et al. Biolm-forming ability proling of Staphylococcus aureus and Staphylococcus epidermidis mastitis isolates. Vet Microbiol 2006;118:133140. Gescher DM, Kovacevic D, Schmiedel D, et al. Fluorescence in situ hybridisation (FISH) accelerates identication of grampositive cocci in positive blood cultures. Int J Antimicrob Agents 2008;32:5159. Yan C, Ding B, Lan X, Guo S, Xie Y, Wang C. The toxicity study on marine low-temperature lysozyme. Food Chem Toxicol 2008;46:604609. Szweda P, Kotlowski R, Kur J. New effective sources of the Staphylococcus simulans lysostaphin. J Biotechnol 2005;117: 203213. Veeh RH, Shirtliff ME, Petik JR, et al. Detection of Staphylococcus aureus biolm on tampons and menses components. J Infect Dis 2003;188:519530. Macnaughton SJ, ODonnell AG, Embley TM. Permeabilization of mycolic-acid-containing actinomycetes for in situ hybridization with uorescently labelled oligonucleotide probes. Microbiology 1994;140:2859. Manz W, Amann R, Ludwig W, Wagner M, Schleifer KH. Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: Problems and solutions. Syst Appl Microbiol 1992;15:593600. Millar BC, Loughrey A, Elborn JS, Moore JE. Proposed denitions of community-associated meticillin-resistant Staphylococcus aureus (CA-MRSA). J Hosp Infect 2007;67:109113.
J. Clin. Lab. Anal.
27. Gijlswijk RPV, Wiegant J, Raap AK, Tanke HJ. Improved localization of uorescent tyramides for uorescence in situ hybridization using dextran sulfate and polyvinyl alcohol. J Histochem Cytochem 1996;44:389392. 28. Trebesius K, Leitritz L, Adler K, Schubert S, Autenrieth IB, Heesemann J. Culture independent and rapid identication of bacterial pathogens in necrotising fasciitis and streptococcal toxic shock syndrome by uorescence in situ hybridisation. Med Microbiol Immunol 2000;188:169175.
81
147
29. Lagace-Wiens PR, Alfa MJ, Manickam K, Karlowsky JA. Thermostable DNase is superior to tube coagulase for the direct detection of Staphylococcus aureus in positive blood cultures. J Clin Microbiol 2007;45:34783479. 30. Sturm PDJ, Kwa D, Vos FJ, Bartels CJM, Schulin T. Performance of two tube coagulase methods for rapid identication of Staphylococcus aureus from blood cultures and their impact on antimicrobial management. Clin Microbiol Infect 2008;14: 510513.
J. Clin. Lab. Anal.
82

Letters in Applied Microbiology ISSN 0266-8254
4.2
Dimethyl formamide-free, urea-NaCl uorescence in situ hybridization (FISH) assay for Staphylococcus aureus
NOTE TO THE EDITOR
Dimethyl formamide-free, urea-NaCl uorescence in situ hybridization assay for Staphylococcus aureus
T.S. Lawson, R.E. Connally, S. Vemulpad and J.A. Piper
Faculty of Science, Macquarie University, NSW, Australia
Keywords detection, identication, infection, rapid methods, staphylococci. Correspondence Tom Lawson, Faculty of Science, Macquarie University, NSW 2109, Australia. E-mail: [email protected]
Abstract Aims: To test the feasibility of identifying Staphylococcus aureus with a uorescence in situ hybridization (FISH) assay that uses a single hot-plate and ureaNaCl reagents. Methods and Results: Slides spotted with S. aureus and treated with methanol and lysozyme were incubated with urea-NaCl reagents on a hot-plate with a precise temperature control and identied with specic DNA probes. Conclusions: Staphylococcus aureus was detected and differentiated from Staphylococcus epidermidis in 1 h with a novel FISH method that used a single hot-plate and in the absence of dimethyl formamide. Signicance and Impact of Study: A rapid hot-plate FISH assay with ureaNaCl and without toxic dimethyl formamide might be useful if FISH is run infrequently or where resources are limited.
2011 1642: received 27 September 2011, revised 1 December 2011 and accepted 2 December 2011
doi:10.1111/j.1472-765X.2011.03197.x
Slide-based uorescence in situ hybridization (FISH) is a robust assay for characterizing intact bacteria in clinical specimens. It is usually run with an incubator and a water-bath and with dimethyl formamide (referred to as formamide) and NaCl buffers (Wang 2010). Occasionally a specialized hot-plate is used for hybridization with DNA (Poppert et al. 2010) or PNA probes (AC005; AdvanDx, Wobum, MA) followed by washing with a thermo-mixer (Poppert et al. 2010) or water-bath (AC006; AdvanDx). A regular hot-plate has not been used, however, for the entire FISH assay with DNA probes. This report identied Staphylococcus aureus with a novel FISH assay performed on a single hot-plate using DNA probes. Staphylococcus aureus is a clinically signicant Gram-positive bacteria (Wang 2010) and if DNA probes are used, its permeabilization can be more complex than other bacteria (Poppert et al. 2010). The new assay tested is modied from an assay reported by the authors (Lawson et al. 2011). Improvements include marking the slides with a wax pencil, replacing the formamide-NaCl buffers with urea-NaCl reagents and using a hot-plate with a plastic cover instead of 50 ml tubes, an incubator and a water-bath (Lawson et al. 2011). To compare the signal strength of the new assay, the previous assay (Lawson et al. 2011) was run in parallel as a control.
2011 The Authors Letters in Applied Microbiology 2011 The Society for Applied Microbiology
If a hot-plate is used for incubations, reagents can dry out and the temperature can uctuate, both of which can result in a weaker hybridization signal. Possible solutions to enhance the signal were tested including using urea as an alternative denaturing reagent to formamide (Soe et al. 2011). Unlike formamide, urea is non-toxic (Simard et al. 2001), can inhibit RNase degradation (Simard et al. 2001) and can act as an additional permeabilizer with the result that the FISH signal could be increased (Huang et al. 2011). In preparation for FISH, 10 clinical isolates of PBP2negative S. aureus and 10 of Staphylococcus epidermidis previously identied with PCR (Thomas et al. 2007) were randomly collected at a hospital and cultured in nutrient broth to an optical density of 10 at 600 nm (CM0001; Oxoid, Basingstoke, UK). Cultures were diluted 1 : 10 in broth, and 10 ll aliquots were spotted to slide-wells (X1XER308B; Menzel-Glaser, Braunschweig, Germany), dried at 47C on a hot-plate and xed with absolute methanol for 1 min. Wells were marked with a wax pencil to restrain reagents to the wells. Two FISH assays were tested, an incubator-bath assay described in Lawson et al. (2011) and a hot-plate FISH assay (this report). Two sets of hybridization and washing reagents were tested with each assay. The rst used conventional hybridization (formamide-NaCl) and NaCl
1
4.2 Dimethyl formamide-free, urea-NaCl fluorescence in situ hybridization (FISH) assay for Staphylococcus aureus
FISH on a hot-plate with urea
83
Lawson et al.
washing buffers (Poppert et al. 2010; Lawson et al. 2011). The second used urea with NaCl (urea-NaCl) for both hybridization and washing (this report). With all treatments, two DNA probes Staaur (16S69: 5-GAAGCAAGCTTCTCGTCCG -3) and EUB338 probe (16S337: 5GCTGCCTCCCGTAGGAGT -3) conjugated at the 5 end to Alexa Fluor 488 identied S. aureus and eubacteria, respectively. The rst FISH assay was tested with an incubator-bath and formamide-NaCl reagents (Poppert et al. 2010; Lawson et al. 2011). To permeabilize the bacteria, wells were spotted with 30 ll of 15 mg ml)1 lysozyme (pH 70). The slides were tted into 50 ml tubes (210261; Greiner Bio-One, Frickenhansen, Germany), incubated at 47C for 30 min and then rinsed with methanol and dried. For hybridization, wells were spotted with 20 ll of formamide-NaCl buffer [30% (v v) formamide (A2156; Applichem, Darmstadt, Germany), 09 mol l)1 NaCl (S6191; Sigma-Aldrich, St Louis, MO), 20 lmol l)1 TrisHCl (pH 70), 001% (w v) SDS (4390; Sigma, L4390) in Milli-Q (MQ) water; Millipore, Bedford, MA] containing 1 lmol l)1 of probe. The slides were tted into 50 ml tubes and placed in a 47C incubator for 20 min. After hybridization, slides were rinsed with prewarmed NaCl washing buffer [064 mol l)1 NaCl, 20 lmol l)1 TrisHCl (pH 70) and 001% SDS in MQ water] and tted into 50 ml tubes containing 25 ml of prewarmed washing buffer and placed in a gently agitated 47C water-bath for 5 min. Slides were removed and rinsed with MQ water and mounted wet with a cover-slip for viewing. The second FISH assay used a hot-plate and was optimized with urea-NaCl (this report). The permeabilization step was the same as before except that it was performed on a 47C hot-plate, and the slides were covered with a clear plastic lid (78 78 mm, 123160; Decor, Melbourne, Australia) to minimize temperature change and reagent drying. The hot-plate was developed by one of the authors (Russell Connally) and had an accuracy of 05C at 47C. A platinum resistance probe was used with a microcomputer display for accurate temperature control. Slides were rinsed with methanol and were dried before 20 ll of urea-NaCl [1 mol l)1 urea (U6504; Sigma), 09 mol l)1 NaCl, 20 lmol l)1 Tris-HCl (pH 70) in MQ water] with 1 lmol l)1 of probe was spotted to each well. Slides were incubated on the 47C hot-plate for 20 min before rinsing twice with prewarmed 250 ll of urea-NaCl [8 mol l)1 urea, 09 mol l)1 NaCl, MQ water and 20 lmol l)1 Tris-HCl (pH 70)]. Slides were placed on the hot-plate and 30 ll of prewarmed urea-NaCl was spotted immediately to each well. Slides were incubated with the plastic cover for 5 min, rinsed twice with ureaNaCl again before a nal rinse with MQ water and mounting as before.
2
Slides were visualized with an epiuorescence microscope (BX51; Olympus, Tokyo, Japan) tted with a 60 objective (UPLFLN; Olympus) and FITC DAPI lters (U-MWU2, U-MWIB2; Olympus). Images were acquired at a resolution of 1360 1024 with an Olympus DP72 camera and software (DP2-BSW v22; Olympus) set to a gain of 200 ISO and an exposure of 2 s. Images from three experimental runs were analysed with ImageJ (v143u; NIH, Bethesda, MD). Summary statistics were compared with one-way analysis of variance (anova) and a P value of 005. A summary of the results for the two FISH assays and their reagents is listed in Table 1 and shown in Fig. 1(a d). Staphylococcus epidermidis was negative for the Staaur probe (Fig. 1f), and S. aureus and Staph. epidermidis were both positive for the EUB338 probe. The incubator-bath assay produced a higher signal than the hot-plate. The incubation temperature and humidity were observed to vary more on a hot-plate as it was not sealed. The ureaNaCl produced a higher signal than the formamide-NaCl. Urea might be acting as an additional premeabilizer for S. aureus (Huang et al. 2011). No difference in signal was observed between the 10 isolates of each bacteria tested. The one-way anova found a signicant difference (P < 0000) for the four treatments listed in Table 1. The hot-plate assay was initially developed with the conventional formamide-NaCl hybridization and washing buffers. The signal was observed to be weaker than the same assay run with an incubator and a water-bath (Table 1). To increase the signal, urea was tested as a substitute for formamide in the hybridization buffer at 05, 1, 2, 4 and 8 mol l)1 (Kourilsky et al. 1970; Simard et al. 2001; Soe et al. 2011) with NaCl at 09 mol l)1 (Poppert et al. 2010; Lawson et al. 2011). The signal was highest at 1 and 2 mol l)1 urea, and 1 mol l)1 was chosen for further testing. A number of washing treatments were tested with the 1 mol l)1 urea and 09 mol l)1 NaCl hybridization reagent.
Table 1 A comparison of the Staaur probe signal intensity for each of the FISH treatments tested with Staphylococcus aureus.
Signal intensity FISH treatment Incubator-bath FISH assay Formamide-NaCl and NaCl buffers Urea-NaCl reagents Hot-plate FISH assay Formamide-NaCl and NaCl buffers Urea-NaCl reagents Mean* CI
3609 495 327 452
062 123 052 113
*Mean signal intensity was measured in 8-bit Gray-scale. Condence interval was calculated at 95%. Incubator-bath FISH protocol (Lawson et al. 2011) as described in this report. Hot-plate FISH protocol as described in this report.
84
Lawson et al.

(a)
(b)
(c)
(d)
(e)
(f)
(g)
Figure 1 Staphylococcus aureus visualized with Alexa Fluor 488 after performing an incubator-bath FISH assay with (a) formamide-NaCl (Lawson et al. 2011) or (b) urea-NaCl reagents (this report). Staphylococcus aureus after performing the hot-plate FISH assay (this report) with (c) formamide-NaCl or (d) urea-NaCl reagents. The same S. aureus visualized with (e) DAPI. Staphylococcus epidermidis after performing the hot-plate assay with urea-NaCl and visualized with (f) Alexa or (g) DAPI. Bar in lower right corner is 5 lm.
A conventional wash containing 09 mol l)1 NaCl was applied for 1 min as described previously (Lawson et al. 2011), but the signal was inconsistent. Urea was reported by Hutton (1977) to reduce melting temperature by approx. 225C with each 1 mol l)1 increase in its concentration whereas melting temperature was reduced by approx. 06C with each 1% (v v) increase of formamide.
To improve the signal and to simplify the assay, the washing buffer was replaced with the urea-NaCl reagents used in the hybridization step. The stringency of this new washing regime was adjusted with urea rather than with the conventional NaCl and was set higher than that used for hybridization so that duplexes with mismatches would be removed. The
3
4.2 Dimethyl formamide-free, urea-NaCl fluorescence in situ hybridization (FISH) assay for Staphylococcus aureus
85
Lawson et al.
urea wash was tested at 0, 1, 2, 4 and 8 mol l)1 with NaCl at 09 mol l)1 (Kourilsky et al. 1970; Simard et al. 2001; Soe et al. 2011). The non-specic signal for Staph. epidermidis was the weakest at 4 and 8 mol l)1 urea. To minimize background signal, the 8 mol l)1 concentration was chosen (Kourilsky et al. 1970). Increasing urea from 1 mol l)1 in the hybridization step to 8 mol l)1 in the washing step decreased the melting temperature by about 26C (Hutton 1977). The ndings suggest that if urea-NaCl reagents are used, it is feasible to control hybridization conditions and produce a sufcient signal with the hot-plate FISH method. There are, however, some limitations to the nding. The relationship between urea and formamide concentrations and ureas action as a permeabilizer was not established. Although it was not observed after the 20 min hybridization step, urea can have a slower rate of denaturation than formamide (Hutton 1977). Other bacteria were not tested, and the specicity and sensitivity of the assay were not assessed. In conclusion, we described a novel FISH assay that does not require an incubator, water-bath, formamide, lysostaphin or PNA probes (the latter two are expensive). UreaNaCl reagents were simple to prepare and unlike formamide, non-toxic. The exclusion of formamide may open up new applications, such as simplied FISH analysis using cell sorters or FISH procedures using beacon probes without an additional washing step. The ndings warrant further specicity and sensitivity testing in a clinical scenario. Acknowledgements The authors acknowledge the Australian Research Councils Linkage Projects (LP0775196) for funding this research and the Australian Proteome Analysis Facility (APAF) for providing laboratory facilities.
References
Huang, E., Talukder, S., Hughes, T.R., Curk, T., Zupan, B., Shaulsky, G. and Katoh-Kurasawa, M. (2011) BzpF is a CREB-like transcription factor that regulates spore maturation and stability in dictyostelium. Dev Biol 358, 137146. Hutton, J.R. (1977) Renaturation kinetics and thermal stability of DNA in aqueous solutions of formamide and urea. Nucleic Acids Res 4, 35373555. Kourilsky, P., Manteuil, S., Zamansky, M.H. and Gros, F. (1970) DNA-RNA hybridization at low temperature in the presence of urea. Biochem Biophys Res Commun 41, 1080 1087. Lawson, T.S., Connally, R.E., Iredell, J.R., Vemulpad, S. and Piper, J.A. (2011) Detection of Staphylococcus aureus with a uorescence in situ hybridization that does not require lysostaphin. J Clin Lab Anal 25, 142147. Poppert, S., Riecker, M., Wellinghausen, N., Frickmann, H. and Essig, A. (2010) Accelerated identication of Staphylococcus aureus from blood cultures by a modied uorescence in situ hybridization procedure. J Med Microbiol 59, 6568. Simard, C., Lemieux, R. and Cote, S. (2001) Urea substitutes toxic formamide as destabilizing agent in nucleic acid hybridizations with RNA probes. Electrophoresis 22, 2679 2683. Soe, M.J., Moller, T., Dufva, M. and Holmstrom, K. (2011) A sensitive alternative for MicroRNA in situ hybridizations using probes of 2-O-Methyl RNA+ LNA. J Histochem Cytochem 59, 661672. Thomas, L.C., Gidding, H.F., Ginn, A.N., Olma, T. and Iredell, J. (2007) Development of a real-time Staphylococcus aureus and MRSA (SAM-) PCR for routine blood culture. J Microbiol Methods 68, 296302. Wang, P. (2010) Simultaneous detection and differentiation of staphylococcus species in blood cultures using uorescence in situ hybridization. Med Princ Pract 19, 218221.
86
Development of new FISH methods: a summary A summary of the ndings reported in this Chapter follows. SA was suciently permeabilized after methanol xation and incubation with lysozyme so that it could be detected with DNA probes and FISH in one hour (4). The lysozyme-only FISH assay was repeated, but with changes. Formamide typically used in the hybridization buer was replaced with non-toxic urea and the incubator and water bath with a precision temperature controlled hot-plate. SA was detected as rapidly as by the conventional assay, but with a higher signal intensity when urea was used (5). There were limitations to these ndings. The earlier FISH assays tested cultures of isolates of SA. If the same FISH procedure was applied to blood samples that contained a high proportion of non-target material, these materials interfered with the access of the FISH probe and its signal. When the urea-NaCl assay was repeated in puried blood samples that contained SA, it was not possible to detect SA without interference from the autouorescence in the blood-debris that remained. The following Chapter reports on methodological improvements for reducing signal interference from non-target material in the specimen. Two approaches were investigated, the non-target material was removed and the emission signal was time-resolved. A simple blood bacteremia model was tested by spiking whole-blood with SA and incubating the blood. To remove most of the non-target material, the separation of intra and inter-cellular SA from the blood was attempted with a lysis and purication procedure. A number of in situ hybridization (ISH) techniques were tested to label the separated SA in the remaining blood-debris. This included a luminescence in situ hybridization (LISH) assay, based on the lysozyme-only permeabilization FISH assay developed in the project (4), to label SA with a long-lifetime luminescent probe. Autouorescence from the specimen could then be suppressed by visualizing the probe with time-gated luminescence microscopy (TGLM).
5
Time-gated uorescence imaging of a europium chelate label
This Chapter reports on the time-resolved visualization of S. aureus (SA) labeled with europium probes using a luminescence in situ hybridization (LISH). A description is oered of a novel technique that was developed for the separation and purication of SA that was spiked and incubated in whole-blood (138). A report is then made on the detection of SA labeled with a europium chelate probe. The signal of the probe was time-resolved to suppress the autouorescence of the remaining blood debris.
5.1
Time-gating of a europium probe rapidly labeled with luminescence in situ hybridization for the detection of Staphylococcus aureus
5.1.1
Abstract
Aim: To identify SA in whole-blood with a europium (Eu3+) chelate, luminescence in situ hybridization (LISH) assay and time-gated luminescence microscopy (TGLM). 87
88
Time-gated fluorescence imaging of a europium chelate label
Methods and Results: Whole-blood was spiked with SA and incubated for one hour. SA was separated from the blood by lysis and centrifugation. SA was detected with a Eu3+ chelate (BHTEGS) conjugated to a DNA (KT18) using a LISH assay. The SA signal to noise ratio improved by a factor of at least 5 relative to SA detected with a conventional non time-resolved uorophore. Conclusions: It was possible to rapidly identify SA with a Eu3+ chelate, a LISH assay and TGLM in two-hours. Signicance and impact of study: Bacteria can be more readily identied with TGLM, in specimens that are highly auto-uorescent. Keywords: autouorescence, chelate, europium, in situ hybridization (ISH), lanthanide, luminescence in situ hybridization (LISH), Staphylococcus aureus, time-gated luminescence microscopy (TGLM), time-resolved, whole-blood
5.1.2
Introduction
Fluorescent techniques such as uorescence in situ hybridization (FISH) can accurately and rapidly detect microbes in blood-cultures. The results from FISH can be poor if it is applied to specimens with complex matrices such as whole-blood. The natural background uorescence of the specimen can overwhelm the signal from a FISH probe (44, 121, 39, 125). One solution is to time-resolve the signal using time-gated luminescence microscopy (TGLM) (46). By gating the emission signal, the short-lived background signal of the specimen is removed and the probe emission remains for detection (149, 161). The technique uses an excitation pulse to create an emission signal from the specimen. While the detector is in the o position, the pulse is terminated abruptly. After the short-lived specimen uorescence has decayed, the detector is turned on and a target signal acquired, that is free of background noise (46). Although it is useful, TGLM is not often used with in situ hybridization (ISH) assays (149). It requires probes and microscopy equipment that are specialized and can be complex to use (162, 149). Lanthanide trivalent ions (Eu3+, Dy3+, Sm3+ and
5.1 Time-gating of a europium probe rapidly labeled with luminescence in situ hybridization for the detection of Staphylococcus aureus 89 Tb3+) are commonly used as the luminophores in TGLM. Ln3+ ions produce narrowspectrum emissions with long-lifetimes in the visible to infra-red spectrum (163). Because Ln3+ have low absorption coecients they require chelating to produce a high signal emission (164). The chelates absorb most of the light and transfer it to the Ln3+ for emission. The chelates are complex and thus dicult to synthesize and are reactive and prone to insolubility (151). Water from the specimen can also access the chelate and quench the Ln3+ signal (47). For a high emission signal, the chelates require UV excitation at wavelengths around 330 nm prolonged exposure of which can damage the specimen (165). Even with chelating and short wavelength excitation, the signal from in situ assays can still be too weak for routine diagnostics. Attempts have been made to improve these shortcomings (47). Ln3+ ions such as Eu3+ chelates can produce enough signal after excitation at the longer wavelengths of 350 to 365 nm (47). New chelates have been developed such as europium (Eu3+) BHHST, a derivative of BHHCT, tetradentate -diketone (151). To increase its solubility and stability, it uses a hydrophilic molecular tether attached to a BHHCT molecule. This allows BHHST to be conjugated to biomolecules without inducing precipitation from solution (136). BHHST has improved solubility and stability (161), but it is only a partial solution. It is still not stable or soluble enough to be applied as a streptavidin conjugate to in situ hybridization assays (data not shown) (145, 45). To remedy this, another BHHCT derivative Eu3+ chelate BHTEGS was developed by members of the candidates research group (Russell Connally and Nima Sayyadi, manuscript in preparation). Initial tests suggest that it is more soluble and less reactive than BHHST (151) and that it can be directly conjugated to DNA sequences and it does not interfere with its hybridization (data not shown). Specialized equipment and a modied microscope is typically required for the timeresolution of the chelates (162). The pulsed excitation and time-resolution of the emission signal has to be precisely synchronized. In this study, however, a simple-touse time-gated auto-synchronous luminescence detector (GALD) device (developed by
90
Russell Connally) was used (148). This device may make it simpler to carry out TGLM in routine diagnostics. The pocket-size device tted into the dierential interference and contrast (DIC) slot of the microscope and had its own UV light source. The device simultaneously blocked the short-term uorescence and transmitted the delayed luminescence (148). To compensate for the reactivity and low emission signal of early chelates (165), early TGLM ISH studies were complicated and lengthy (149, 150). Usually the signal was not visible through the eye-piece and could only be detected with a sensitive camera (149). To amplify the weak signal (45), the ISH assays used biotinylated DNA probes (150) or ran incubations over-night for probe hybridization (149). The weak chelate signal could then amplied with a streptavidin (149) or tyramide conjugate (150). These solutions, however complicated and lengthened the ISH assay making its use in diagnostics limited (149, 150). If directly labeled chelates such as BHTEGS could be applied to ISH with sucient signal, a simpler, more rapid assay could be used. Direct conjugation of chelates with DNA is possible. Ln3+ chelates have already been conjugated directly to oligonucleotides and these bio-conjugates used in Forster resonance energy transfer (FRET) assays where reactivity is less of a problem (165). The aim of this study is to test the feasibility of rapid SA detection in a blood sample with an ISH assay that is visualized with TGLM. SA is a frequent cause of bacteraemia and severe sepsis (55) and blood can be highly autouorescent (100). The study proposed to spike blood with SA and then incubate it so that the SA undergoes phagocytosis. The blood will be lysed and centrifuged to separate and collect the SA. A slide-based LISH assay will be performed with the novel Eu3+ BHTEGS DNA probe and an Alexa Fluor R 488 (Invitrogen) (Alexa) probe as a control. To the candidates knowledge, this is the rst report of the time-gated luminescence detection of bacteria hybridized to a luminescent probe.
5.1.3
Method
SA isolates identied with PCR (158) and sourced from clinical specimens were cultured in nutrient broth (Oxoid, CM0001) Figure 5.1 (3). Cultures were washed and diluted
5.1 Time-gating of a europium probe rapidly labeled with luminescence in situ hybridization for the detection of Staphylococcus aureus 91 in saline to an optical density of 1.0 at 600 nm (159). Venous blood from a healthy volunteer was collected in EDTA tubes (Becton Dickinson, 367863). A simple in vitro bacteraemia model was created by spiking the whole-blood while fresh, with SA and incubating (160). For 1 ml of blood, 10 l of SA prepared in saline was added (1.0 optical density at 600 nm). The blood was then incubated with gentle agitation at 37
C for one hour. Rather than labeling SA in intact blood with LISH or FISH as reported elsewhere
(100, 63, 62), the SA was rst separated from the blood with alkaline water (138). The alkaline water was prepared by adding 4 mM NaOH to Milli-Q (MQ) water (pH 10.0). Blood and alkaline water at a ratio of 1:10 were mixed by vortexing (to make a nal pH of 8.5) and then centrifuged for ve minutes at 3,000 rcf. The supernatant was removed and this alkaline water lysis treatment repeated. The vortexed pellet was spotted to slide-wells (Menzel-Glaser, X1XER308B) and dried with a 60 C hot-plate. Wells were marked with a wax-pencil (Staedtler R , Chinagraph) to reduced run-o and specimen contamination. SA samples were xed with absolute methanol for one minute and the slides dried again on the 60 C hotplate (2). One of the Candidates research team (Russell Connally) conjugated the novel Eu3+ BHTEGS chelate to a DNA sequence KT18 (Geneworks, 16S68: 5GCAAGCTTCTCGTCCGTT -3) (1) specic for SA 16S rRNA. An in situ hybridization assay was applied (4). SA was permeabilized with lysozyme at 37 C for one hour, rinsed with absolute methanol and incubated at 47 C with hybridization buer containing the probe for 30 minutes. The buer was then rinsed o with MQ water, the slides air-dried and 10 l of uorescence enhancing buer (FEB) (148) containing 0.4 mM Eu3+ was spotted to each well. The slides were mounted while still wet, with a cover-slip and left at room temperature for 20 minutes before viewing. Slides were viewed with an epiuorescence microscope (BX51, Olympus) tted with a 60 objective (UPLFLN, Olympus) and a time-gated auto-synchronous luminescence detector (GALD) held in its DIC prism slot (148). The GALD device used a 355 nm UV from a 100 mW YAG laser as the excitation source. Time-resolved images were acquired after a two second exposure with an Olympus DP72 camera and software (Olympus,
92
DP2-BSW v2.2) set to 200 ISO and a resolution of 1,3601,024. When Alexa was visualized without TGLM, the GALD was locked into the open position (148). The mean signal intensity (8-bit gray-scale) for BHTEGS and Alexa were compared and analyzed with ImageJ using standard algorithms (NIH, v1.43u) (Figure 5.4).
5.1.4
Results
In this study, the feasibility of detecting SA with a europium chelate conjugated to DNA, luminescent in situ hybridization (LISH) assay and time-gating of the luminescent signal (TGLM) was tested. SA was separated from blood along with other debris in the blood. A LISH assay with BHTEGS conjugated to K18 DNA (1) was completed in two hours. SA was identied with minimal background signal (Figure 5.3) and S. epidermidis (SE) (a negative control) was not detected (Figure 5.2). SA was also identied with BHTEGS in cultures containing no observed debris (Figure 5.1). As a control the assay was tested with Alexa Fluor R 488 (Alexa) also conjugated to the K18 oligonucleotide (Figure 5.1 and 5.3). The SA cells had an Alexa signal and the SE cells had a partial signal. A comparison of the signal to noise ratio (S/N) for BHTEGS and Alexa is shown in Figure 5.4 and in Table 5.1. The S/N ratio for BHTEGS was over ve times higher than the same oligonucleotide conjugated to Alexa. Although it is meant to be viewed under pulsed and not constant UV illumination, BHTEGS was more photo-sensitive than Alexa. Its signal faded within 30 seconds of UV excitation, whereas the Alexa signal was still visible after one minute. BHTEGS was initially tested with a FISH assay reported earlier by the candidate (4). The buer contained reagents typically used in FISH washes (0.2818 M NaCl, 20 mM Tris-HCl pH 8.0, 0.01% SDS, 10 mM EDTA, and MQ water). The Eu3+ signal was weak, so the EDTA was removed and the LISH assay was repeated. The signal remained low until this washing buer was replaced with a gentle MQ water rinse. To compare the S/N of BHTEGS, Alexa was also tested (Figure 5.3). Although a signal was not observed with BHTEGS and the negative control SE after a MQ water rinse, weak Alexa signal was observed with SE. No improvement in the signal was observed when the hybridization buer with formamide, but without the probe, was applied as
5.1 Time-gating of a europium probe rapidly labeled with luminescence in situ hybridization for the detection of Staphylococcus aureus 93 a ve minute wash. The MQ water rinse was used in the nal LISH assay. The BHTEGS signal was further improved by extending incubation times from 30 minutes (4) to one hour for permeabilization and from 20 minutes (4) to 30 minutes for the hybridization. The accuracy of the blood model was also conrmed. Blood was separated with Dextran 500 (Pharmacosmos) (166) and intra-cellular SA was observed when the leukocytes were lysed with water. A comparison of inter-cellular and intra-cellular SA with 0.285 g/ml DAPI (Sigma, D9542) staining suggested that a majority of the SA underwent phagocytosis, but remained intact (19, 132) and, when separated from leukocytes and placed in nutrient broth, was still viable and could be cultured rapidly. When the blood was lysed by diluting in alkali (138) instead of with MQ water, debris was minimized and the detection of SA with ISH was unhampered.
5.1.5
Discussion
We set out to test the ecacy of a novel TGLM Eu3+ probe, the chelate BHTEGS, and a novel LISH assay. The assay was modied from a FISH assay (4) and was applied to SA separated from whole-blood. The study found that BHTEGS and LISH suppressed a majority of the autouorescence of blood-debris. The S/N ratio of SA labeled with BHTEGS was over ve times greater than for SA labeled with Alexa Fluor R 488 (Alexa) conjugated to the same DNA probe (Figure 5.3) (Table 5.1). An earlier report applied an in situ hybridization method to label and detect viruses with a time-resolved chelate BHHCT (149). In that study, europium was conjugated to the streptavidin molecule and the oligonucleotide was biotinylated. The hybridization buer contained 50% formamide with 2SSC (0.28 M NaCl and 0.28 M sodium citrate, pH 7.2), 10% dextran sulfate and 0.4 mg/ml salmon sperm DNA. The DNA-biotin conjugate was hybridized to its mRNA or DNA targets overnight at 42 C and then bound the next day to the europium conjugate streptavidin by incubating at room temperature for 30 minutes. This study also used an in situ hybridization method, but diered signicantly in its approach. SA was permeabilized with lysozyme and not proteinase K, an enzyme
94
whose use can lead to loss of specimen and cells from the slide. The in situ hybridization method used a uorochrome or europium chelate (BHTEGS) conjugated directly to DNA. The hybridization buer used also contained formamide and NaCl, but did not contain sodium citrate, dextran sulfate or salmon sperm DNA. Hybridization time for the assay was much shorter, 30 minutes instead of overnight. No biotin-streptavidin incubation step was required (145, 45). The washing was a simple MQ rinse rather than a series of 2 x SSC washes for one hour. Specimens were available for viewing within two hours. Unlike Alexa, BHTEGS was more likely to produce a weak signal if the ISH assay was not optimized. Blood-debris possibly obstructed permeabilization, hybridization and visualization of SA. The use of lysozyme simplied the assay, but did produce a lower level of permeabilization than if lysostaphin was used. To maximize this signal, blood debris was more completely removed by diluting in alkaline water (138) twice and the lysozyme incubation was lengthened from half to one hour (4). Initially a conventional washing buer with NaCl and EDTA buer was applied (2). NaCl and EDTA buer was observed to weaken the Eu3+ signal and was replaced with a simple MQ water rinse. The MQ water wash was sucient for the BHTEGS probe, but was less eective at removing partially bound Alexa probe. Without NaCl and EDTA there was less control over the stringency of the wash which resulted occasionally in an inconsistent signal. Other problems were encountered with the BHTEGS and the ISH assay. Unlike an earlier study that produced an immediate signal when Eu3+ was applied to chelates exterior to the cells (136), in this study LISH required slides to be left for 20 minutes before an Eu3+ signal could be seen. The ve fold increase in the S/N ratio with TGLM was not as high as in a previous report that tested pond water (136). The smaller improvement in the S/N ratio might be due to a dierence in the type of specimens tested. There was a noticeable reduction in signal if the GALD TGLM was used instead of a regular excitation source and lter (Olympus, U-RFL-T, U-MWIB2) to illuminate the
5.1 Time-gating of a europium probe rapidly labeled with luminescence in situ hybridization for the detection of Staphylococcus aureus 95 BHTEGS. Connally et al. (148) calculated that GALD applied with a 260 m gatedelay reduced the signal by at least a third. To detect this lower signal, hybridization of the BHTEGS chelate to SA needed to be optimal. Variation in the blood specimens, however made this dicult to meet, with every experimental run. The lysis protocol used to separate SA from whole-blood (138) was necessary for the removal of the bulk of the non-target material in the blood so that SA could be labeled with LISH. There maybe, however, other applications for this purication technique. The viability of the SA that was separated was conrmed by culturing the pellet in nutrient broth with all specimens becoming turbid within two hours. A recent study determined the antibiotic susceptibility of SA with FISH, PNA probes and owcytometry (35). It may be possible to combine these two techniques: the separation of SA from blood (this study) and the detection of antibiotic susceptibility with FISH (35), so that SA bacteraemia in whole-blood and its resistance to antibiotics can be determined without rst having to perform a two-day blood-culture. There were limitations to the ndings. Clinical isolates, reference strains and other commonly encountered bacteria were not tested. Because tests were performed at a non-clinical location, sensitivity and specicity tests were not performed. An in vitro bacteremia model was used to simulate an auto-uorescent specimen. It would not be expected that SA counts in the blood of sepsis patients would be high enough for detection with LISH or FISH (20) without rst culturing the bacteria. In conclusion, it was possible to separate SA from whole-blood for identication with TGLM using a Eu3+ chelate. The LISH assay used for hybridizing the probe was similar to the method used in other clinical microbiology FISH studies (32, 40). Further investigations of BHTEGS, LISH and TGLM against a range of bacteria and highly auto-uorescent specimens might be warranted.
96
(a) BHTEGS
(b) Alexa Fluor
Figure 5.1: SA in pure cultures of nutrient broth labeled with (a) BHTEGS and (b) Alexa Fluor R 488. The BHTEGS signal is time-resolved and the Alexa Fluor signal is not. Bar is 5 m.
5.1 Time-gating of a europium probe rapidly labeled with luminescence in situ hybridization for the detection of Staphylococcus aureus 97
(a) SA bright-eld
(b) SA TGLM
(c) S. epidermidis bright-eld
(d) S. epidermidis TGLM
Figure 5.2: Staphylococci separated from whole-blood and SA labeled with KT68 and BHTEGS and visualized with (a) bright-eld and (b) LISH and TGLM. S. epidermidis labeled with KT68 and visualized with (c) bright-eld and (d) LISH and TGLM. Bar is 5 m.
98
(a) BHTEGS
(b) Alexa Fluor
Figure 5.3: SA separated from whole-blood labeled with (a) BHTEGS and (b) Alexa Fluor R 488. The BHTEGS signal is time-resolved and the Alexa Fluor signal is not. P indicates plot locations in Figure 5.4. Bar is 5 m.
(a) BHTEGS TGLM
(b) Alexa Fluor R
Figure 5.4: Plots of the 8-bit Grey scale signal of SA labeled with (a) BHTEGS and (b) Alexa Fluor 488. Plots correspond to the line sample that transects at P in Figure 5.3. Bar is 5 m.
100
Table 5.1: Signal-to-noise ratio (S/N) of SA labeled with BHTEGS or Alexa Fluor R 488 conjugated to KT68. The BHTEGS signal is time-resolved and the Alexa Fluor signal is not. SA Reporter Mean BHTEGS Alexa Fluor R 488 44.5 43.8
Background S/N
S/N
CI
Mean 5.4 28.6
CI 0.03 0.03 8.3 5.5 1.5
2.7 0.8
LISH method and visualization is described in the Methods section. Figure 5.3 was used for sampling. Mean signal (8-bit Grey scale) and 95% condence interval. S/N = Mean (SA)/Mean (Background). S/N = S/N (BHTEGS)/S/N (Alexa).
Acknowledgements This study was supported by the Australian Research Councils Linkage Projects (LP0775196), the Australian Proteome Analysis Facility (APAF), Douglass Hanly Moir Pathology (Macquarie University Hospital), Hunters Hill Medical Practice and Macquarie University Medical Centre.
Time-resolved uorescence imaging: a summary The ndings outlined in this Chapter were as follows: 1. SA was incubated in whole blood and was shown to undergo phagocytosis. 2. SA was eciently separated from most of the blood by lysis with alkali water and centrifuging. 3. The separated SA could then be either detected with FISH and a conventional DNA-based uorophore or rapidly cultured to increase its numbers for detection again with FISH. 4. To overcome the background signal from the remaining blood-debris, a luminescence in situ hybridization (LISH) assay that was similar to FISH that used a long-lifetime probe was applied and the probe was visualized with time-gated luminescence microscopy (TGLM). 5. The signal to noise ratio of the time-resolved long-lifetime probe was higher than the conventional DNA-based uorophore and minimal background signal was observed. There were limitations to these ndings. The synthesis and purication of the europium chelate probe was not robust and its conjugation to DNA was not optimized (151). The conditions best suited to the hybridization and washing of the probes were not fully determined (5). In the technique that was used, a simple wash with MQ water was applied and unbound probe was suciently, but not fully removed. There were also shortcomings to the TGLM (46). The signal intensity of the excitation source used with the gated auto-synchronous luminescence detection (GALD) device was low and because of this, the TGLM signal was weak unless the probe was applied at a high concentration and the permeabilization was optimal (148). Further investigation into the ideal use of this novel europium probe and improvements to the excitation source of the GALD were beyond the scope of the current project (151, 148).
102
6
Conclusion
The central aim of this project was the development of laboratory techniques which oer (i) specic identication of an important pathogen and (ii) rapid results. These aims were achieved. The well-known and serious pathogen Staphylococcus aureus (SA) was chosen as the model for a series of experiments relevant to these aims. The reason for choosing SA was because it is an ubiquitous pathogen which commonly infects humans, it has lethal potential and it has an unrivaled capacity to develop resistance to most antibiotics (55, 54). There were three main outcomes of this project. Firstly, current methods for the conduct of FISH analyses were rened and improved. These advances were achieved by a range of technical changes to existing methods plus the development of a series of novel innovations. These changes and innovations included (i) the development of new probes (specic DNA sequences) for use with FISH techniques (1), (ii) the use of new high-yield uorophores (1), (iii) the development and use of pre-mixed materials and reagents for FISH techniques (2), (iv) use of sealable 50 ml centrifuge tubes to hold slides in order to reduce the time needed for the permeabilization, hybridization and washing incubation steps in FISH procedures (2) and (v) the development of a rapid one-step (in place of a multi-step) permeabilization treatment to signicantly reduce 103
104
Conclusion
the time required for FISH procedures (3). The details are as follows: 1. Development of new probes - new FISH probes specic for SA were developed (1). The number of potential probes for the identication of SA has doubled. The new probes still targeted the same region of the SA 16S rRNA as the existing probes, but had the advantage of greatly increasing the accuracy and specicity of the FISH techniques. 2. High-yield uorophores were found to label SA with a higher, more consistent and photo-stable signal (140) than the uorophores that are currently used (1). In particular, Alexa Fluor R (Invitrogen) and Dylight R (Jackson) probes were found to be superior to uorescein, cyanine and other conventional uorescent dyes (2). Although these new high yield uorophores were more costly than existing reagents, because of their higher signal intensity they could be used at lower concentrations and hence a reduced cost. 3. Use of pre-mixed materials and reagents for FISH techniques (2). New preparation techniques were developed to make it more straightforward to apply FISH routinely in the microbiology laboratory. The approach of preparing and storing stock solutions and then mixing them just before use is standard practice in laboratories. However, the use of pre-mixed materials for use in FISH has not been previously reported. This procedure has three advantages, (i) reduction in the time required for completion of FISH analyses, (ii) a signicant improvement in the consistency of FISH based analytical outcomes and (iii) repeated control FISH tests only need to be run (using reference strains of pathogens) with each new batch of the basic reagents. 4. Use of sealable centrifuge tubes (2). The use of sealable 50 ml centrifuge tubes (Greiner, 210-261) to hold slides substantially reduced the time needed for the permeabilization, hybridization and washing steps of incubation. Permeabilization or hybridization activity of reagents was higher, the drying out of reagents minimized and the results were more consistent.
105
5. The adhesion of the specimens to the slides was improved (2). Additional improvements to standard techniques for FISH included the use of agarose which when applied and dried to the slides before spotting SA reduced their loss and the use of urea, either diluted in the specimen or applied to specimen already dried on the slide, also reduced cell loss (5). 6. A two-step permeabilization treatment was developed (2). This is useful when high molecular weight probes are used to identify SA by FISH techniques. This two-step permeabilization approach had additional advantages including very fast outcomes and maintenance of the biological integrity of SA. Finally, because the level of permeabilization was high, the time needed for high molecular weight oligonucleotide hybridization was shortened. 7. A series of changes to the current FISH techniques has allowed a reduction in the time to detect SA, to 24 minutes (3). This compares to an earlier time of 45 minutes to achieve this identication (32). In some clinical circumstances this reduction in time taken to conrm the identity of SA can be life saving as the use of particular antibiotics can be dependent on an accurate identication of the pathogen. These advances in techniques will make it possible to complete both Gram-stain and FISH analyses within an hour of a positive blood-culture. Secondly, novel FISH procedures were investigated for the detection of SA. This was achieved by developing FISH techniques that do not require lysostaphin permeabilization (4). Usually, lysostaphin permeabilization is a requirement for DNA oligonucleotide probes to gain access to the SA bacteria (52). The use of lysostaphin can complicate FISH analyses (32). A FISH assay that detects SA without requiring lysostaphin makes its use more practical in routine diagnostic laboratories. A novel FISH technique free of formamide that used a hot-plate with a precise temperature control was developed (5). Urea was used to denature and hybridize an oligonucleotide to SA (153). The assay did not need a dedicated incubator or water-bath (thus saving expense and bench-space) because it could be performed on a hot-plate. Urea was less toxic (144) than formamide (142) and produced a more
106
Conclusion
intense signal (153). The same hybridization reagent mix could be used in both the hybridization and washing steps. This simplied the assay and meant that the washing step was less likely to produce a non-specic signal. Collectively these technical developments have greatly simplied FISH analyses. Thirdly, SA was identied with a luminescence in situ hybridization (LISH) assay in complex blood-specimens (Chapter 5). A simple procedure was developed for the creation of an in vitro bacteraemia model with SA (160) and then separating the SA from the model for testing with FISH and LISH. SA were separated from the sample by lysing the blood with alkaline water (138), centrifuging to remove the supernatant and repeating the procedure. Most of the SA in the whole-blood was separated and collected. The separation technique was accurate, rapid and simple to perform. It was found to be not only useful for the immediate detection of SA, but also for its rapid culturing (137). Its application might be useful in other assays such as polymerase chain reaction (PCR) for the detection of SA (39, 158, 69). Separated SA from the blood was detected with a FISH and a LISH assay (Chapter 5). The LISH assay visualized the SA with TGLM which, unlike the FISH assay, suppressed most of the background autouorescence signal from the blood debris that remained. A previous study detected viruses labeled with europium (Eu3+) chelates using an in situ assay and visualized with TGLM, but this ran over-night (149). Unlike the assay used in this project, it did not use directly conjugated oligonucleotide probes to detect the clinically important bacteria SA in two hours. It was not possible to apply all the newly developed FISH techniques at the same time. The express FISH assay could not be completed in 24 minutes without the enzyme lysostaphin (4). Similarly, the two-step permeabilization FISH assay (2) required the enzyme lysostaphin (4) and could not be completed in 24 minutes (3). Labeling of europium probes with a LISH assay was not possible with the urea-NaCl based hybridization reagents (5) and required formamide.
107
Future research directions The research described in this thesis is ongoing and could take several directions. 1. There is a need to test the newly developed FISH techniques for SA in clinical settings (40, 33). This is entirely feasible. As a rst step these new techniques could be used in parallel with the existing conventional FISH techniques. This was shown to be practical as conventional FISH techniques were used as controls (32) in this current project. It is not expected that the FISH assays would be less accurate than the conventional FISH techniques used in other studies as they performed as well as a control (32) with SA collected from whole-blood (Chapter 5). 2. There is also a need to test the new FISH techniques for SA with other pathogens often detected in clinical microbiology (64). Since the detection of SA with FISH is more complex, it may be expected that the new methods would be compatible with these other types of pathogens (88, 52). If tested, a reduction in the permeabilization treatment would be needed as these other pathogens are usually more sensitive than SA to such treatment (32). Some of the new FISH methods might also be applicable and useful with ow-cytometric visualization (157, 105, 34, 35). 3. The new FISH techniques for SA were conned to the detection of SA with a single probe since all SA probes target the same overlapping sequence of the SA 16S rRNA (1). A probe sequence (KT26-1002: 5- AAGGCTCTATCTCTAGAGTTGTC -3) found to have a high binding anity to SA, but not overlapping with other probes, could be used simultaneously with an established probe for SA (40). Although the probe also binds to Staphylococcus haemolyticus, it would be more specic than the Staphy probe which binds to most Staphylococci (40). 4. Probes that target 18S or 23S rRNA could be tested for specicity to SA. Although not as well documented as 16S rRNA, 23S rRNA may prove to have
108
Conclusion
sequences that have a high accuracy and anity to SA or to S. epidermidis (167). 5. It is also possible to apply the newly enhanced FISH techniques directly to shortturnaround blood cultures to determine the identity and antibiotic susceptibility of pathogens (107, 35). The SA separation from whole-blood was accurate and did not inactivate the SA. Cultures of this SA could be performed with and without antibiotics and FISH used to determine the susceptibility of the strain (107, 35). 6. Specimens other than blood remain to be tested directly with the enhanced FISH techniques. For example, intravenous and intra-arterial catheters are a signicant focus of infection and are a common cause of septicemia (168). The density of the SA at these foci is high enough for direct testing with FISH, because they can act as reservoirs for SA (19). Possibly identication of SA and other microbes of catheter specimens could potentially be completed within an hour of collection using the new FISH methods developed in this project. Since peptide nucleic acid (PNA) probes are expensive (Advandx, AC005), they were not investigated in this project. However, with the recent expiry of the original patent (108), it would be expected that PNA probes would become more aordable. A signicant advantage of PNA probes is that SA can be detected without rst having to be permeabilized (102). With this step omitted, it becomes possible to combine the remaining steps in the FISH procedure into one step, thus greatly simplifying and shortening the assay (106). A one step FISH assay could be applied to the detection of SA separated from the blood (this study) of sepsis patients and grown in rapid blood cultures (137), some of which contain antibiotics (107, 35). Strains of SA could be identied and their antibiotic susceptibility ascertained the same day as blood-collection with a one-step PNA FISH assay and an automated ow cytometer (105, 35) that could also be timeresolved (169, 170).
A
Appendix A: Other publications that emerged from the thesis
Appendix A is composed of two sections. Each of these sections was published in a peer reviewed journal and included as such. In the rst section, the FISH methodology of two chronic rhinosinusitis studies by Foreman et al. (129, 128) were assessed in light of the new FISH methodology developed in this project: Lawson TS, Connally RE, Vemulpad S, Piper JA. In reference to targeted imaging modality selection for bacterial biolms in chronic rhinosinusitis and dierent biolms, dierent disease? a clinical outcomes study. Laryngoscope 2011;121:2043-2044 (6). In the next section, the FISH method of the blood-culture study by Wang (40) was assessed, also in light of the ndings of the project: Lawson TS, Connally RE, Iredell JR, Piper JA. The simultaneous detection and dierentiation of staphylococcus species in blood cultures using uorescence in situ hybridization: A comment. Med Princ Pract 2011;20:390-391 (7). Foreman et al. (171) and Wang (7) have given permission for their response to be included in this thesis.
109
110
The Laryngoscope
C 2011 The American Laryngological, V
Rhinological and Otological Society, Inc.
A.1
In reference to targeted imaging modality selection for bacterial biolms in CRS and dierent biolms, dierent disease?
Letter to the Editor
In Reference to Targeted Imaging Modality Selection for Bacterial Biofilms in Chronic Rhinosinusitis and Different Biofilms, Different Disease? A Clinical Outcomes Study
Dear Editor: We read with interest two recent reports on biofilms in chronic rhinosinusitis (CRS) by Foreman et al.1 and Foreman and Wormald.2 We agree with the authors that future studies of species-specific biofilms such as Staphylococcus aureus would be an effective approach to identifying CRS patients who may progress poorly after surgery.2 Thus, we will limit our comments to the methodologies used to detect biofilms with S aureus. In Foreman et al.,1 the authors astutely adopted two assays, LIVE/DEAD BacLight (Invitrogen, Carlsbad, CA) and fluorescence in situ hybridization (FISH) (PNA FISH; AdvanDx, Woburn, MA), in parallel with confocal laser scanning microscopy (CLSM) to detect CRS biofilms. The emphasis by the authors on testing specimens with complementary assays is welcome, but we question why other techniques were not considered. Hematoxylineosin staining has reliably detected biofilm in CRS patients in parallel with FISH.3 Gram staining has evaluated CRS biofilms with FISH in conjunction with culturing to determine viability.4 The authors mentioned the necessity of CLSM for biofilm analysis.1 We remark that if detection rather than analysis is the aim of the study, an epifluorescent microscope with an adjustable stage would be sufficient and less costly.5 For both studies,1,2 a FISH kit (AdvanDx) was run to identify microbes in the CRS biofilms. A kit is convenient but can be limiting. Because it is commercial, the FISH method was relatively short on detail; the fixation alcohol, probe sequences, fluorophores, and number of probes applied simultaneously were not stated and therefore were difficult to evaluate. For a larger cohort of patients, the cost of a kit can be prohibitive (KT005; AdvanDx,). We remark that the efficacy of AdvanDx FISH was confirmed with positive blood cultures6 of S aureus, but not with biofilm, intramucosal, and intracellular S aureus.7 The authors commented that they anticipated what microbes were present before testing and used a limited number of probes.1,2 We note that a study, similar to Swidsinski et al.,8 has yet to be done with CRS biofilms to comprehensively determine their flora. Differentiating between S aureus in biofilm or in planktonic form may not be as straightforward as the authors implied. A more rigorous criterion for detection9 may be required as planktonic S aureus regularly Laryngoscope 121: September 2011 adheres and clumps.10 We found this was further exasperated by the alcohol-fixation step in FISH. The authors reliance on a less intense blush of autofluorescence surrounding the microbes to represent the matrix of the biofilm1 was suggestive, but may not confirm the presence of biofilm. Other assays could be used in tandem with BacLight and FISH to confirm S aureus biofilms.4,10,11 We concede that some of these confirmatory assays are problematic, as CRS patients commonly yield negative sinus cultures.12 We also note that the sensitivity and specificity of the BacLight and FISH were not tested in the studies against positive controls of biofilm producing S aureus strains.1,2 In Foreman et al.,1 the authors recognized the inability to process a single sample with both BacLight and FISH assays. We agree it would be beneficial if biofilms could be visualized and species identified within the same specimen. The potential surface area for each specimen would be increased13 and the disparity between different assays reduced.1 To address this, we were surprised that the nucleic acid stains DAPI (D9542; Sigma, St. Louis, MO) or Hoechst (94403; Sigma,) were not used with the BacLight or FISH assay.8 We recognize that a limitation of multiple staining is the potential to remove a fraction of any biofilm present.14 Nevertheless, we are not aware of a CRS biofilm study that has taken advantage of combining DAPI, FISH probes at 488 nm excitation, and wheat germ agglutinin conjugated to Alexa Fluor at 555 nm (W32464; Invitrogen).4 Such an assay cannot test for viability, but could visualize the majority of microbes present, identify the species of microbe, and positively delineate the biofilm4 within a single field of view. Typically, CRS biofilm studies harvest sinonasal mucosa surgically from the ethmoid cavity.1,2 The confirmation in Foreman and Wormald2 that cultures collected at the same time as surgery predicted postinfection, suggest a role for nonsurgical tests of S aureus biofilm.15,16 We observed that Keen et al.17 reported collecting specimens from nasal bottles and identifying S aureus biofilms, and that Foreman et al.1 and Foreman and Wormald2 prepared tissue for biofilm testing by washing to remove planktonic bacteria. It may be informative to test for S aureus biofilms suspensions in such a wash directly11 or indirectly, by testing wash contaminants for strains of S aureus that produce
2043
A.1 In reference to targeted imaging modality selection for bacterial biofilms in CRS and different biofilms, different disease?111
biofilms.4,10,11 We congratulate the authors on increasing our understanding of the role of biofilm with S aureus in CRS. THOMAS LAWSON RUSSELL CONNALLY SUBRAMANYAM VEMULPAD JAMES PIPER
Macquarie University Sydney, Australia
7. Clement S, Vaudaux P, Francois P, et al. Evidence of an intracellular reservoir in the nasal mucosa of patients with recurrent Staphylococcus aureus rhinosinusitis. J Infect Dis 2005;192:10231028. 8. Swidsinski A, Goktas O, Bessler C, et al. Spatial organisation of microbiota in quiescent adenoiditis and tonsillitis. J Clin Pathol 2007;60: 253260. 9. Parsek MR, Singh PK. Bacterial biofilms: an emerging link to disease pathogenesis. Annu Rev Microbiol 2003;57:677701. 10. Kouidhi B, Zmantar T, Hentati H, et al. Cell surface hydrophobicity, biofilm formation, adhesives properties and molecular detection of adhesins genes in Staphylococcus aureus associated to dental caries. Microb Pathog 2010;49:1422. 11. Oliveira M, Bexiga R, Nunes SF, et al. Biofilm-forming ability profiling of Staphylococcus aureus and Staphylococcus epidermidis mastitis isolates. Vet Microbiol 2006;118:133140. 12. Sanderson AR, Leid JG, Hunsaker D. Bacterial biofilms on the sinus mucosa of human subjects with chronic rhinosinusitis. Laryngoscope 2006; 116:11211126. 13. Hoa M, Tomovic S, Nistico L, et al. Identification of adenoid biofilms with middle ear pathogens in otitis-prone children utilizing SEM and FISH. Int J Pediatr Otorhinolaryngol 2009;73:12421248. 14. Hall-Stoodley L, Hu FZ, Gieseke A, et al. Direct detection of bacterial biofilms on the middle-ear mucosa of children with chronic otitis media. JAMA 2006;296:202211. 15. Veeh RH, Shirtliff ME, Petik JR, et al. Detection of Staphylococcus aureus biofilm on tampons and menses components. J Infect Dis 2003;188: 519530. 16. Homoe P, Bjarnsholt T, Wessman M, et al. Morphological evidence of biofilm formation in greenlanders with chronic suppurative otitis media. Eur Arch Otorhinolaryngol 2009;266:15331538. 17. Keen M, Foreman A, Wormald PJ. The clinical significance of nasal irrigation bottle contamination. Laryngoscope 2010;120:21102114.
BIBLIOGRAPHY
1. Foreman A, Singhal D, Psaltis AJ, et al. Targeted imaging modality selection for bacterial biofilms in chronic rhinosinusitis. Laryngoscope 2010; 120:427431. 2. Foreman A, Wormald PJ. Different biofilms, different disease? A clinical outcomes study. Laryngoscope 2010;120:17011706. 3. Hochstim CJ, Masood R, Rice DH. Biofilm and persistent inflammation in endoscopic sinus surgery. Otolaryngol Head Neck Surg 2010;143: 697698. 4. Kania RE, Lamers GE, Vonk MJ, et al. Characterization of mucosal biofilms on human adenoid tissues. Laryngoscope 2008;118:128134. 5. Corriveau MN, Zhang N, Holtappels G, et al. Detection of Staphylococcus aureus in nasal tissue with peptide nucleic acid-fluorescence in situ hybridization. Am J Rhinol Allergy 2009;23:461465. 6. Gonzalez V, Padilla E, Gimenez M, et al. Rapid diagnosis of Staphylococcus aureus bacteremia using S. aureus PNA FISH. Eur J Clin Microbiol Infect Dis 2004;23:396398.
Laryngoscope 121: September 2011
2044
112
The Laryngoscope
C 2011 The American Laryngological, V
Rhinological and Otological Society, Inc.
In Response to Targeted Imaging Modality Selection for Bacterial Biofilms in Chronic Rhinosinusitis and Different Biofilms, Different Disease? A Clinical Outcomes Study
Dear Editor, We acknowledge Lawson et al.s synthesis of our recent work investigating the role of biofilms in chronic rhinosinusitis (CRS), which in essence highlights the relative infancy of this field of research. This is particularly true when compared with the current depth of knowledge surrounding other biofilm-associated diseases such as otitis media with effusion. Clearly, there is much work still to be done before the role of biofilms in CRS is completely understood. Staphylococcus aureus demonstrates an extraordinary repertoire of virulence factors that enable it to both attack and evade the human host, of which biofilm formation is but one. The various roles of planktonic, intracellular, small colony variant, and biofilm forms of S. aureus are still to be clearly defined, and our current understanding of this disease does not allow us to differentiate the pathologic importance of each. Further study in this area coupled with nucleic acid stains, as suggested by Lawson et al. and previously performed by Corriveau et al.,1 to localize the bacterial communities relative to the sinonasal epithelium may shed light on the multiplicity of existence many bacteria demonstrate in human disease. We are firm believers in the biofilm definitions proposed by Costerton et al.,2 and use this to guide us in delineating planktonic and biofilm S. aureus, which we believe is possible by demonstrating adherent bacteria (the washing step removes planktonic clones) that congregate in a three-dimensional structure (in our opinion, replacement of the confocal microscope with an epifluorescent microscope does not allow appreciation of the characteristic three-dimensional structure) and surround themselves with an exopolysaccharide matrix (the less intense blush). This has been successfully applied in both human and animal work from our department.35 Furthermore, although not expressly stated in our article, S. aureus biofilms do conform to at least the first five out of six rigorous criteria set out by Parsek and Singh6 for determining a biofilm infection (we are yet to investigate the final criteria, colocalizing bacterial cell clusters with host inflammatory cells), highlighting the utility of current diagnostic techniques. Clearly, there are multiple methods for detecting biofilms in surgical specimens, of which only two, FISH and BacLight, were used in the studies in question.7,8 It Laryngoscope 121: September 2011 is important to recognize that all microscopic techniques rely on the identification of a morphologic appearance characteristic of biofilm formation, which in itself is a potentially flawed diagnostic approach. H&E staining and Gram staining may well complement our currently used techniques, but neither could overcome this deficiency. The only truly reliable method of detecting biofilm bacteria will be to demonstrate the genotypic changes that herald a transition to the biofilm phenotype. This is not currently possible. We accept that the requirement for preselection of FISH probes is a limitation of our species-specific biofilm diagnostic work to date. Molecular diagnostics have since been employed in CRS patients, both by our group (unpublished data) and others,9 confirming the relative abundance of S. aureus in this group of patients. The role of anaerobic bacteria has been raised by molecular studies, although not specifically investigated in CRS as yet. Finally, we would like to draw the attention of the readership to another of our articles investigating biofilms in CRS,10 which answers a number of the other methodologic queries raised by Lawson et al. Furthermore, it does seem somewhat contradictory that on one hand the use of confocal microscopy would be criticized as being superfluous and adding to the complexity of the protocol, whereas the use of a methodology-simplifier such as a commercially available FISH kit is also questioned. In summary, the parallel development of biofilm diagnostic modalities and our understanding of their role in CRS represent an exciting time for Rhinology researchers. Open discussion of and analysis of the current literature will undoubtedly enhance the quality and validity of future endeavors in this area.
DR. ANDREW FOREMAN, BMBS (Hons) PETER-JOHN WORMALD, MD

Department of SurgeryOtorhinolaryngology, Head and Neck Surgery University of Adelaide and Flinders University Adelaide, Australia
BIBLIOGRAPY
1. Corriveau MN, Zhang N, Holtappels G, Van Roy N, Bachert C. Detection of Staphylococcus aureus in nasal tissue with peptide nucleic acid-fluorescence in situ hybridization. Am J Rhinol Allergy 2009;23:461465. 2. Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science 1999;284:13181322.
Foreman: Letter to the Editor
2045
A.1 In reference to targeted imaging modality selection for bacterial biofilms in CRS and different biofilms, different disease?113
3. Ha KR, Psaltis AJ, Tan L, Wormald PJ. A sheep model for the study of biofilms in rhinosinusitis. Am J Rhinol 2007;21:339 345. 4. Psaltis AJ, Ha KR, Beule AG, Tan LW, Wormald PJ. Confocal scanning laser microscopy evidence of biofilms in patients with chronic rhinosinusitis. Laryngoscope 2007;117:13021306. 5. Singhal D, Psaltis AJ, Foreman A, Wormald PJ. The impact of biofilms on outcomes after endoscopic sinus surgery. Am J Rhinol Allergy 2010;24: 169174. 6. Parsek MR, Singh PK. Bacterial biofilms: an emerging link to disease pathogenesis. Annu Rev Microbiol 2003;57:677701. 7. Foreman A, Singhal D, Psaltis AJ, Wormald PJ. Targeted imaging modality selection for bacterial biofilms in chronic rhinosinusitis. Laryngoscope 2010;120:427431. 8. Foreman A, Wormald P. Different biofilms, different disease? A clinical outcomes study. Laryngoscope 2010;120:17011706. 9. Stephenson MF, Mfuna L, Dowd SE, et al. Molecular characterization of the polymicrobial flora in chronic rhinosinusitis. J Otolaryngol Head Neck Surg 2010;39:182187. 10. Foreman A, Psaltis AJ, Tan LW, Wormald PJ. Characterization of bacterial and fungal biofilms in chronic rhinosinusitis. Am J Rhinol Allergy 2009; 23:556561.
Laryngoscope 121: September 2011
Foreman: Letter to the Editor
2046
114
Letter to the Editor Appendix A: Other publications that emerged from the thesis
Received: November 1, 2010 Accepted: November 29, 2010
A.2
The simultaneous detection and dierentiation of staphylococcus species in blood cultures using uorescence in situ hybridization
Med Princ Pract 2011;20:390391 DOI: 10.1159/000324875
The Simultaneous Detection and Differentiation of Staphylococcus Species in Blood Cultures Using Fluorescence in situ Hybridization: A Comment
ThomasS.Lawsona , RussellE.Connallya , JonR.Iredellb, JamesA.Pipera of Physics, Macquarie University, and b Centre for Infectious Diseases and Microbiology, Westmead Hospital, Sydney, N.S.W., Australia
aDepartment
Wang [1] reported a useful slide-based fluorescence in situ hybridization (FISH) protocol that involved applying two oligonucleotides with different fluorophores simultaneously. Compared to applying the Staphylococcus aureus probe [2] alone, the author demonstrated that using it in conjunction with the Staphylococcus spp. probe [3] increased the sensitivity and specificity of S. aureus detection and differentiation from coagulase-negative staphylococci (CoNS) [1]. We note that the multicolor dual-probe FISH method took at least 2 h to finish. However, it is possible to detect S. aureus with FISH in less than 1 h [4]. The author described difficulties in cell adhesion to the slides. We found that slides spotted with agarose [5] reduced cell loss and that S. aureus permeabilization responds better to methanol than ethanol [4]. Spotting specimens onto a 10-well diagnostic glass slide (Menzel-Glser, X1XER308B) rather than smearing was also more effective. A greater concentration of cells was heat-fixed to a smaller slide area, less reagents were needed throughout the FISH protocol and more accurate comparisons could be made between specimens and FISH treatments on the same slide. The lysis enzyme conditions stated may have resulted in the permeabilization time of at least 20 min. We observe that the optimal permeabilization temperature is not 30 C but approximately 35 C for lysozyme (Sigma, L6876) and 45 C for lysostaphin (Sigma, L4402). If specimens were fixed with methanol and then permeabilized at 46 C with a lysozyme and lysostaphin mixture, the permeabilization time can be shortened to 5 min [4]. We agree that using a Staphylococcus spp. and an S. aureus probe together may be the most robust probe option as the S. aureus and CoNS 16S rRNA are conserved, but we observe that an untested CoNS probe is available (CoNS 16S1442: 5-CGACGGCTAGCTCCAAATGGTTACT-3). The EUB338 probe is a necessary control as it confirms if the protocol is effective, but we believe that the non-EUB338 probe is not necessary; we are not aware of any instances where it has failed as a negative control in the detection of staphylococci with FISH [2, 3, 5].

The author modified the commonly accepted FISH protocol [24]. It might have been simpler, however, to only adjust the hybridization buffers formamide concentration and the washing buffers NaCl concentrations rather than increasing the incubation temperature to 50 C as well [6]. Using 46 C with a 0.9 M NaCl hybridization buffer has the advantage of allowing stringency to be optimized to formamide concentrations between 0 and 60% for most probes [24, 6]. Similarly, a 48 C washing buffer step allows stringency to be optimized to NaCl concentrations between 0.014 and 0.9 M for most probes [3, 4, 6]. FISH protocol turnaround is more likely to be shortened by effective specimen preparation and permeabilization rather than stringency adjustments [4]. We found that the fluorescein isothiocyanate fluorophore, and to a lesser extent Cy3, suffers from poor signal, bleaching and spectral overlap. In our experience, Alexa Fluor (Invitrogen) or DyLight Fluor (Thermo Fisher) probes are superior in signal strength, photostability and spectral flexibility. For instance, fluorescence output could be doubled and potential photobleaching and bleed-through halved if fluorescein isothiocyanate and Cy3 were replaced with Alexa Fluor 488 and Alexa Fluor 555 fluorophores (Invitrogen). We consider the dual-probe FISH technique described by Wang [1] a valuable addition to the detection of S. aureus which can be further enhanced.

References
1 2 3 Wang P: Simultaneous detection and differentiation of Staphylococcus species in blood cultures using fluorescence in situ hybridization. Med Princ Pract 2010;19:218221. Kempf VA, Trebesius K, Autenrieth IB: Fluorescent in situ hybridization allows rapid identification of microorganisms in blood cultures. J Clin Microbiol 2000;38:830838. Trebesius K, Leitritz L, Adler K, Schubert S, Autenrieth IB, Heesemann J: Culture independent and rapid identification of bacterial pathogens in necrotising fasciitis and streptococcal toxic shock syndrome by fluorescence in situ hybridisation. Med Microbiol Immunol 2000;188: 169175. Poppert S, Riecker M, Wellinghausen N, Frickmann H, Essig A: Accelerated identification of Staphylococcus aureus from blood cultures by a modified fluorescence in situ hybridization procedure. J Med Microbiol 2010;59:6568. Pernthaler A, Pernthaler J, Amann R: Fluorescence in situ hybridization and catalyzed reporter deposition for the identification of marine bacteria. Appl Environ Microbiol 2002; 68:30943101. Manz W, Amann R, Ludwig W, Wagner M, Schleifer KH: Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: problems and solutions. Syst Appl Microbiol 1992; 15:593600. Thomas S. Lawson Department of Physics, Macquarie University Sydney, NSW 2109 (Australia) Tel. +61 2 9850 8938, E-Mail tomxlawson @ gmail.com

5 6
2011 S. Karger AG, Basel 10117571/11/02040390$38.00/0 Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com Accessible online at: www.karger.com/mpp
A.2 The simultaneous detection and differentiation of staphylococcus species in blood cultures using fluorescence in situ hybridization 115
Reply
Pei Wang Division of Clinical Microbiology, Department of Laboratory Medicine, The First Peoples Hospital of Jingmen, Jingmen, China
Cy3 in terms of signal strength; however, the expensive cost hinders its wide application in routine clinical laboratory. There is room for enhancement in the permeabilization and hybridization protocol. I appreciate the effort made by the authors to share their experiences concerning the FISH protocol. References
1 2 3 Wang P: Simultaneous detection and differentiation of Staphylococcus species in blood cultures using fluorescence in situ hybridization. Med Princ Pract 2010;19:218221. Kempf VA, Trebesius K, Autenrieth IB: Fluorescent in situ hybridization allows rapid identification of microorganisms in blood cultures. J Clin Microbiol 2000;38:830838. Jansen GJ, Mooibroek M, Idema J, Harmsen HJ, Welling GW, Degener JE: Rapid identification of bacteria in blood cultures by using fluorescently labeled oligonucleotide probes. J Clin Microbiol 2000; 38: 814 817.
I would like to thank Lawson et al. for providing an excellent opinion regarding the article Simultaneous detection and differentiation of Staphylococcus species in blood cultures using fluorescence in situ hybridization [1]. I agree that heat fixation, and pretreatment at 46 C with a lysozyme and lysostaphin mixture is helpful for permeabilization. As for the probe, it is difficult to design a single probe to cover all CoNS species. An alternative strategy could be to use two specific probes that target different conserved sequences (data not published). Non-EUB338 is necessary to detect nonspecific binding of oligonucleotides [2], although it seldom occurs to clinical specimens. The FISH protocol was a modification of that established by Jansen et al. [3], in which the cell wall of Staphylococcus aureus was rigid, such that an intensive hybridization signal could be taken into account as a priority rather than a turnaround time. No doubt, Alexa Fluor (Invitrogen) or DyLight Fluor (Thermo Fisher) probes are superior to fluorescein isothiocyanate and

Pei Wang Department of Laboratory Medicine The First Peoples Hospital of Jingmen Jingmen 448000 (China) Tel. +86 724 230 5781, E-Mail peiwwien @ yahoo.com

Med Princ Pract 2011;20:390391
391
116
B
Appendix B: Analysis of common oligonucleotides used in the detection of S. aureus with FISH
Oligonucleotides were analyzed using mathFISH (mathsh.cee.wisc.edu) (92). EUB338 16S337: 5- GCTGCCTCCCGTAGGAGT -3 (157) Listing B.1: EUB338 alignment with S. aureus and S. epidermidis 16S rRNA EUB338 alignment with S . aureus : . . . .. ........ ........ ........ ....... EUB338 : TGAGGATGCCCTCCGTCG5 . . . .. ........ .....||| |||||||| ||||||| S . aureus : ACTCCTACGGGAGGCAGC3 . . . .. ........ ........ ........ ....... EUB338 alignment with S . epidermidis : . . . .. ........ ........ ........ ....... EUB338 : 3 TGAGGATGCCCTCCGTCG5 . . . .. ........ .....||| |||||||| ||||||| S . epidermidis : 5 ACTCCTACGGGAGGCAGC3 . . . .. ........ ........ ........ ....... 117
118
Table B.1: The calculated binding anity of the probe EUB338 to S. aureus and S. epidermidis. G (kcal/mol) Go 1 Go 2 Go 3
S. aureus -24.5 -1.5 -5.3 -17.7 58.0 1.0000
S. epidermidis -24.5 -1.5 -5.3 -17.7 58.0 1.0000
value 0.00 NA 0.00 0.00 0.00 0.00
Go overall [FA]m (%) Hybridization Eciency
Values for S. epidermidis Values for S. aureus. Go 1 indicates the binding anity of the DNA probe to its RNA target. Go 2 indicates the binding anity of the DNA probe to itself. Go 3 . indicates the binding anity of the RNA target to itself. Go overall indicates the binding anity of the DNA probe to its RNA target given o the competing Go 1 and G2 reactions. The formamide concentration required to anneal or dissociation of 50% of the DNA probe from its RNA target given 1 M probe, 0.9 M NaCl in the buer and 47 C incubation. At 0% formamide.
119
KT18 16S68: 5- GCAAGCTTCTCGTCCGTT -3 (1) Listing B.2: KT18-16S68 alignment with S. aureus and S. epidermidis 16S rRNA KT18 -16 S68 alignment with S . aureus : . . . .. ........ ........ ........ ....... .... KT18 -16 S68 : 3 TTGCCTGCTCTTCGAACG5 . . . .. ........ .....||| |||||||| ||||||| S . epidermidis : 5 AACGGACGAGAAGCTTGC3 . . . .. ........ ........ ........ ....... KT18 -16 S68 alignment with S . epidermidis : ..................... C ...... T ....... KT18 -16 S68 : 3 TTG . CTGCTC . TCGAACG5 . . . .. ........ .....||| .||||||. ||||||| S . epidermidis : 5 AAC . GACGAG . AGCTTGC3 ..................... A ...... G ....... Table B.2: The calculated binding anity of the probe KT18-16S68 to S. aureus and S. epidermidis. G (kcal/mol) Go 1 Go 2 Go 3 Go overall [FA]m (%) Hybridization Eciency S. aureus -20.8 1.7 -5.9 -14.8 35.3 0.9999 S. epidermidis -14.2 1.7 -8.2 -5.9 -27.8 0.0110 value 6.60 NA -2.30 8.90 -63.10 -0.99
120
STAAUR 16S69: 5- GAAGCAAGCTTCTCGTCCG -3 (87) Listing B.3: Staaur alignment with S. aureus and S. epidermidis 16S rRNA Staaur alignment with S . aureus : . . . . . . . . . .... ..... ..... .... . ...... ... Staaur : 3 GCCTGCTCTTCGAACGAAG5 . . . . . . . . . .... ..... ||||| |||| | |||||| ||| S . aureus : 5 CGGACGAGAAGCTTGCTTC3 . . . . . . . . . .... ..... ..... .... . ...... ... Staaur alignment with S . epidermidis : ................... C ...... T ........ A . Staaur : 3 G . CTGCTC . TCGAACGA . G5 . . . . . . . . . .... ..... |.||| |||.| |||||| |.| S . epidermidis : 5 C . GACGAG . AGCTTGCT . C3 ................... A ...... G ........ C . Table B.3: The calculated binding anity of the FISH probe Staaur to S. aureus and S. epidermidis. G (kcal/mol) Go 1 Go 2 Go 3 Go overall [FA]m (%) Hybridization Eciency S. aureus -19.8 -0.4 -7.0 -12.1 23.7 0.9944 S. epidermidis -14.7 -0.4 -8.2 -5.8 -50.7 0.0090 value 5.10 NA -1.20 6.30 -74.40 -0.99
121
STAPHY 16S697 5-TCCTCCATATCTCTGCGC-3 (87) Listing B.4: Staphy alignment with S. aureus and S. epidermidis 16S rRNA Staphy alignment with S . aureus : . .. ............................ Staphy : 3 CGCGTCTCTATACCTCCT5 . .. ..........|||||||||||||||||| S . aureus : 5 GCGCAGAGATATGGAGGA3 . .. ............................ Staphy alignment with E . coli : ................ G ...... T ....... Staphy : 3 CGC . TCTCTA . ACCTCCT5 . .. ..........|||.||||||.||||||| E . coli : 5 GCG . AGAGAT . TGGAGGA3 ................ T ...... C ....... Table B.4: The calculated binding anity of the FISH probe Staphy to S. aureus and S. epidermidis. G (kcal/mol) Go 1 Go 2 Go 3 Go overall [FA]m (%) Hybridization Eciency S. aureus -21.1 2.1 -3.7 -17.4 43.7 1.0000 E. coli -16.2 2.1 -2.9 -13.3 21.8 0.9991 value 4.90 NA 0.80 4.10 -21.90 -0.00
122
List of abbreviations
ANOVA C CA - MRSA CARD - FISH CoNS CRS Cy3 Cy5 DAPI Delta G DEPC DIC DNA EC EDTA Eu3 + FA FEB FISH FISH FISH FITC FN FP G GALD HA - MRSA HE IgG ISH LISH Ln3 + LNA M MC & S Min MQ water MRSA MSSA Analysis of variance Cytosine Community - acquired MRSA Catalyzed reporter deposition FISH Coagulase - negative staphylococci Chronic rhinosinusitis Cyanine dye excited at 550 nm Cyanine dye excited at 650 nm 4 ,6 - diamidino -2 - phenylindole dye excited at 358 nm Gibbs binding potential or free energy values Diethylpyrocarbonate Differential interference and contrast Deoxyribonucleic acid E . coli Ethylenediaminetetraacetic acid Europium ion excited at 350 nm Formamide Fluorescence enhancing buffer Fluorescent in situ hybridisation Fluorescence in situ hybridization Fluorescent in situ hybridization Fluorescein isothiocyanate dye excited at 495 nm False negative False positive Guanine Gated auto - synchronous luminescence detector Hospital - acquired MRSA Hybridization efficiency Immunoglobulin G antibody In situ hybridization Luminescence in situ hybridization Lanthanide trivalent ions Eu , Dy , Sm and Tb Locked nucleic acid Moles Microscopy , culturing and susceptibility Minutes Milli - Q water Methicillin - resistant Staphylococcus aureus Methicillin - sensitive Staphylococcus aureus 123
124
List of abbreviations
NaCl NaOH Oligo PBP2 PBS PCR PNA RNA rRNA S/N SA SAB S . aureus SCCmecA SDS SE S . epidermidis SSC TE buffer TGLM TIFF Tm TN TP Tris - HCl v/v w/v
Sodium chloride Sodium hydroxide Oligonucleotide Penicillin - Binding Protein 2 Gene Phosphate buffered saline Polymerase chain reaction Peptide nucleic acid Ribonucleic acid Ribosomal RNA Signal to noise ratio S . aureus Staphylococcus aureus bacteremia Staphylococcus aureus Staphylococcal cassette chromosome Sodium dodecyl sulfate S . epidermidis Staphylococcus epidermidis Sodium citrate buffer Tris - HCl and EDTA buffer Time - gated luminescence microscopy Tagged Image File Format Melting temperature True negative True positive Tris ( hydroxymethyl ) aminomethane hydrochloric acid Volume by volume Weight by volume
References
1. Lawson TS, Connally RE, Vemulpad S, et al. In silico evaluation and testing of uorescence in situ hybridization 16S rRNA probes for Staphylococcus aureus. Lab Med 2011;42:587591. vii, 17, 24, 27, 40, 45, 51, 72, 91, 92, 103, 104, 107, 119 2. Lawson TS, Connally RE, Vemulpad S, et al. Optimization of a two-step permeabilization uorescence in situ hybridization (FISH) assay for the detection of Staphylococcus aureus. J Clin Lab Anal 2011;25:359365. vii, 17, 24, 31, 34, 40, 44, 45, 47, 49, 51, 72, 91, 94, 103, 104, 105, 106 3. Lawson TS, Connally RE, Vemulpad S, et al. Express uorescence in situ hybridization methods for the detection of Staphylococcus aureus. Clin lab 2011; 57:789794. vii, 17, 24, 45, 47, 49, 51, 52, 72, 90, 104, 105, 106 4. Lawson TS, Connally RE, Iredell JR, et al. Detection of Staphylococcus aureus with a uorescence in situ hybridization that does not require lysostaphin. J Clin Lab Anal 2011;25:142147. vii, 18, 24, 44, 47, 72, 75, 86, 91, 92, 93, 94, 105, 106 5. Lawson TS, Connally RE, Vemulpad S, et al. Dimethyl formamide-free, ureaNaCl uorescence in situ hybridization (FISH) assay for Staphylococcus aureus. Lett Appl Microbiol 2012;10.1111/j.1472-765X.2011.03197.x:(in press). vii, 25, 44, 45, 47, 73, 75, 86, 101, 105, 106 6. Lawson TS, Connally RE, Vemulpad S, et al. In reference to targeted imaging modality selection for bacterial biolms in chronic rhinosinusitis and dierent biolms, dierent disease? a clinical outcomes study. Laryngoscope 2011; 121:20432044. vii, 25, 109 7. Lawson TS, Connally RE, Iredell JR, et al. The simultaneous detection and dierentiation of staphylococcus species in blood cultures using uorescence in situ hybridization: A comment. Med Princ Pract 2011;20:390391. viii, 25, 109 125
126
References
8. Hamey LGC, Connally RE, Yen SW, et al. Luminescent microspheres resolved from strong background on an automated Time-Gated luminescence microscopy workstation. DICTA 2009 2009;1:223228. viii 9. Wang L, Barrett J. Control and prevention of MRSA infections. Methods Mol Biol 2007;391:209225. 1, 4 10. Aboud Z, Peters T. Early recognition and management of sepsis at west middlesex university hospital. Crit Care 2009;13:32. 1, 3, 4 11. Edmond K, Zaidi A. New approaches to preventing, diagnosing, and treating neonatal sepsis. PLoS Med 2010;7:e1000213. 1 12. Schmidlin M, Alt M, Vogel G, et al. Contaminations of laboratory surfaces with Staphylococcus aureus are aected by the carrier status of laboratory sta. J Appl Microbiol 2010;109:12841293. 1, 3 13. Palavecino E, et al. Clinical, epidemiological, and laboratory aspects of
methicillin-resistant Staphylococcus aureus (MRSA) infections. Methods Mol Biol 2007;391:119. 1, 3 14. Gosbell IB, Barbagiannakos T, Neville SA, et al. Non-multiresistant methicillinresistant Staphylococcus aureus bacteraemia in sydney, australia: emergence of EMRSA-15, oceania, queensland and western australian MRSA strains. Pathology 2006;38:239244. 1 15. Schulz M, Nonnenmacher C, Mutters R. Cost-eectiveness of rapid MRSA screening in surgical patients. Eur J Clin Microbiol Infect Dis 2009;28:12911296. 1 16. Haji-Michael P, Dodgson K, Kaczmarski E. Guidelines for the management of sepsis (including neutropenic sepsis). christie.nhs.uk 2010. 1, 4, 5 17. LaRosa S. Prevalence and incidence. clevelandclinicmeded.com 2010. 1, 4
References
127
18. Venkatesh M, Flores A, Luna RA, et al. Molecular microbiological methods in the diagnosis of neonatal sepsis. Expert Rev Anti Infect Ther 2010;8:10371048. 1, 2, 5, 6, 7, 11, 14, 17 19. Krimmer V, Merkert H, Ei CV, et al. Detection of Staphylococcus aureus and Staphylococcus epidermidis in clinical samples by 16S rRNA-directed in situ hybridization. J Clin Microbiol 1999;37:26672673. 1, 2, 5, 8, 13, 14, 17, 51, 93, 108 20. Llewelyn M, Cohen J. Diagnosis of infection in sepsis. Intensive Care Med 2001; 27:1032. 1, 4, 5, 14, 95 21. Nimmo GR. Rapid detection of bacteraemia. Clin Microbiol 2010;101:131. 1, 4, 5, 6, 14 22. Shah A, Gordon NC, Pheel L, et al. Comparison of microscopic, phenotypic and molecular techniques for the rapid identication and susceptibility testing of staphylococci from positive blood culture bottles. Crit Care 2009;13:44. 1, 5, 6, 10, 12, 14 23. Munson EL, Diekema DJ, Beekmann SE, et al. Detection and treatment of bloodstream infection: laboratory reporting and antimicrobial management. J Clin Microbiol 2003;41:495497. 1, 2, 4, 5, 6, 12, 14 24. Lever A, Mackenzie I. Sepsis: denition, epidemiology, and diagnosis. Br Med J 2007;335:879883. 1, 4, 5 25. Dryden M, Andrasevic AT, Bassetti M, et al. A European survey of antibiotic management of methicillin resistant Staphylococcus aureus infection: current clinical opinion and practice. Clin Microbiol Infect 2010;16:330. 1, 3, 4 26. Cohen J, Brun-Buisson C, Torres A, et al. Diagnosis of infection in sepsis: an evidence-based review. Crit Care Med 2004;32:S466. 1, 4, 6
128
References
27. Brown DFJ, Edwards DI, Hawkey PM, et al. Guidelines for the laboratory diagnosis and susceptibility testing of methicillin-resistant Staphylococcus aureus (MRSA). J Antimicrob Chemother 2005;56:10001018. 1, 3, 4, 5, 6 28. Mallmann C, Siemoneit S, Schmiedel D, et al. Fluorescence in situ hybridization to improve the diagnosis of endocarditis: a pilot study. Clin Microbiol Infect 2010; 16:767773. 1, 5, 7, 13 29. Bottari B, Ercolini D, Gatti M, et al. Application of FISH technology for microbiological analysis: current state and prospects. Appl Microbiol Biotechnol 2006; 73:485494. 2, 9 30. Amann R, Fuchs BM. Single-cell identication in microbial communities by improved uorescence in situ hybridization techniques. Nat Rev Microbiol 2008; 6:339348. 2, 9, 24 31. Schweickert B, Moter A, Lefmann M, et al. Let them y or light them up: matrixassisted laser desorption/ionization time of ight (MALDI-TOF) mass spectrometry and uorescence in situ hybridization (FISH). APMIS 2004;112:856885. 2, 8 32. Poppert S, Riecker M, Wellinghausen N, et al. Accelerated identication of Staphylococcus aureus from blood cultures by a modied uorescence in situ hybridization procedure. J Med Microbiol 2010;59:6568. 2, 5, 8, 9, 10, 11, 12, 13, 15, 17, 18, 24, 28, 30, 41, 43, 44, 45, 47, 48, 49, 51, 72, 95, 105, 107 33. Wu Q, Li Y, Wang M, et al. Fluorescence in situ hybridization rapidly detects three dierent pathogenic bacteria in urinary tract infection samples. J Microbiol Methods 2010;83:175178. 2, 8, 10, 11, 13, 107 34. Kempf VAJ, Mandle T, Schumacher U, et al. Rapid detection and identication of pathogens in blood cultures by uorescence in situ hybridization and ow cytometry. Int J Med Mol 2005;295:4755. 2, 12, 29, 31, 107
References
129
35. Shrestha N, Scalera N, Wilson D, et al. Rapid identication of Staphylococcus aureus and methicillin resistance by ow cytometry using a peptide nucleic acid probe. J Clin Microbiol 2011;49:33833385. 2, 12, 13, 95, 107, 108 36. Wagner M, Horn M, Daims H. Fluorescence in situ hybridisation for the identication and characterisation of prokaryotes. Curr Opin Microbiol 2003;6:302309. 2, 10, 29, 31 37. Kempf VAJ, Trebesius K, Autenrieth IB. Fluorescent in situ hybridization allows rapid identication of microorganisms in blood cultures. J Clin Microbiol 2000; 38:830838. 2, 10, 13, 16, 18 38. Zwirglmaier K. Detection of prokaryotic cells with uorescence in situ hybridization. Methods Mol Biol 2010;659:349362. 2, 8, 15, 27 39. Poppert S, Essig A, Stoehr B, et al. Rapid diagnosis of bacterial meningitis by Real-Time PCR and uorescence in situ hybridization. J Clin Microbiol 2005; 43:33903397. 2, 10, 11, 13, 14, 15, 19, 88, 106 40. Wang P. Simultaneous detection and dierentiation of staphylococcus species in blood cultures using uorescence in situ hybridization. Med Princ Pract 2010; 19:218221. 2, 10, 13, 14, 16, 18, 42, 72, 95, 107, 109 41. Riedel S, Carroll KC. Blood cultures: key elements for best practices and future directions. J Infect Chemother 2010;16:301316. 2, 5, 14 42. Stevens K, Jaykus L. Bacterial separation and concentration from complex sample matrices: a review. Crit Rev Microbiol 2004;30:724. 2, 9, 14, 21 43. Brehm-Stecher B, Young C, Jaykus L, et al. Sample preparation: the forgotten beginning. J Food Prot 2009;72:17741789. 2, 9, 14, 21 44. Moter A, Gobel UB. Fluorescence in situ hybridization (FISH) for direct visualization of microorganisms. J Microbiol Methods 2000;41:85112. 2, 8, 9, 15, 17, 19, 27, 88
130
References
45. Zwirglmaier K. Fluorescence in situ hybridisation (FISH) - the next generation. FEMS Microbiol Lett 2005;246:151158. 2, 10, 16, 22, 47, 72, 89, 90, 94 46. Connally RE, Piper JA. Time-Gated luminescence microscopy. Ann N Y Acad Sci 2008;1130:106116. 2, 19, 88, 101 47. Hagan A, Zuchner T. Lanthanide-based time-resolved luminescence immunoassays. Anal Bioanal Chem 2011;400:118. 2, 14, 19, 21, 25, 89 48. Murdoch DR, Greenlees RL. Rapid identication of Staphylococcus aureus from BacT/ALERT blood culture bottles by direct gram stain characteristics. Br Med J 2004;57:199201. 2, 5, 8, 9, 28, 48 49. Lagace-Wiens PRS, Alfa MJ, Manickam K, et al. Thermostable DNase is superior to tube coagulase for direct detection of Staphylococcus aureus in positive blood cultures. J Clin Microbiol 2007;45:34783479. 2, 6, 10 50. Hermsen ED, Shull SS, Klepser DG, et al. Pharmacoeconomic analysis of microbiologic techniques for dierentiating staphylococci directly from blood culture bottles. J Clin Microbiol 2008;46:29242929. 2, 6, 10, 12, 13 51. Sturm PDJ, Kwa D, Vos FJ, et al. Performance of two tube coagulase methods for rapid identication of Staphylococcus aureus from blood cultures and their impact on antimicrobial management. Clin Microbiol Infect 2008;14:510513. 2, 6 52. Tavares A, Inacio J, Melo-Cristino J, et al. Use of uorescence in situ hybridization for rapid identication of staphylococci in blood culture samples collected in a portuguese hospital. J Clin Microbiol 2008;46:30973100. 2, 10, 13, 16, 18, 27, 28, 30, 44, 72, 73, 105, 107 53. Hotchkiss R, Karl I. The pathophysiology and treatment of sepsis. N Engl J Med 2003;348:138150. 3
References
131
54. Parthasarathy P. Outcomes of Staphylococcus aureus bacteremia. Ph.D. thesis, NUS 2009. 3, 4, 6, 103 55. Collignon P, Nimmo G, Gottlieb T, et al. Staphylococcus aureus bacteremia, Australia. Emerg Infect Dis 2005;11:554561. 3, 6, 17, 90, 103 56. Garcia-Lara J, Foster SJ. Anti-Staphylococcus aureus immunotherapy: current status and prospects. Curr Opin Pharmacol 2009;9:552557. 3, 7, 8 57. Halablab M, Hijazi S, Fawzi M, et al. Staphylococcus aureus nasal carriage rate and associated risk factors in individuals in the community. Epidemiol Infect 2010;138:702706. 3 58. Millar BC, Loughrey A, Elborn JS, et al. Proposed denitions of communityassociated meticillin-resistant Staphylococcus aureus (CA-MRSA). J Hosp Infect 2007;67:109113. 3 59. Gould I. Costs of hospital-acquired methicillin-resistant Staphylococcus aureus (MRSA) and its control. Int J Antimicrob Agents 2006;28:379384. 3 60. Mancini N, Carletti S, Ghidoli N, et al. The era of molecular and other NonCulture-Based methods in diagnosis of sepsis. Clin Microbiol Rev 2010;23:235 251. 4, 5, 10, 14 61. Wasserman E. What can you expect from a microbiology diagnostic service? CME 2008;26:528530. 5 62. Kudo M, Matsuo Y, Nakasendo A, et al. Potential clinical benet of the in situ hybridization method for the diagnosis of sepsis. J Infect Chemother 2009;15:23 26. 5, 10, 11, 13, 14, 91 63. Shimada J, Hayashi I, Inamatsu T, et al. Clinical trial of in-situ hybridization method for the rapid diagnosis of sepsis. J Infect Chemother 1999;5:2131. 5, 11, 13, 14, 91
132
References
64. Gescher DM, Kovacevic D, Schmiedel D, et al. Fluorescence in situ hybridisation (FISH) accelerates identication of gram-positive cocci in positive blood cultures. Int J Antimicrob Agents 2008;32:5159. 5, 10, 11, 27, 28, 30, 73, 107 65. Jukes L, Mikhail J, Bome-Mannathoko N, et al. Rapid dierentiation of Staphylococcus aureus, Staphylococcus epidermidis and other coagulase-negative staphylococci and methicillin susceptibility testing directly from growth positive blood cultures by multiplex real-time PCR. J Med Microbiol 2010;59:14561461. 5, 6, 36 66. Sogaard M, Norgaard M, Schonheyder HC. First notication of positive blood cultures and the high accuracy of the gram stain report. J Clin Microbiol 2007; 45:11131117. 5, 6, 12 67. Kateete DP, Kimani CN, Katabazi FA, et al. Identication of Staphylococcus aureus : DNase and mannitol salt agar improve the eciency of the tube coagulase test. Ann Clin Microbiol Antimicrob 2010;9:23. 6, 10 68. Holtzman C, Whitney D, Barlam T, et al. Assessment of impact of peptide nucleic acid uorescence in situ hybridization for rapid identication of CoagulaseNegative staphylococci in the absence of antimicrobial stewardship intervention. J Clin Microbiol 2011;49:15811582. 6, 13, 14 69. French GL. Methods for screening for methicillin-resistant Staphylococcus aureus carriage. Clin Microbiol Infect 2009;15:1016. 6, 106 70. Wellinghausen N, Siegel D, Gebert S, et al. Rapid detection of Staphylococcus aureus bacteremia and methicillin resistance by real-time PCR in whole blood samples. Eur J Clin Microbiol Infect Dis 2009;28:10011005. 6 71. Mirrett S, Lauer BA, Miller GA, et al. Comparison of acridine orange, methylene blue, and gram stains for blood cultures. J Clin Microbiol 1982;15:562566. 7 72. Gitai Z. New uorescence microscopy methods for microbiology: sharper, faster, and quantitative. Curr Opin Microbiol 2009;12:341346. 7, 48
References
133
73. Albeanu D, Soucy E, Sato T, et al. LED arrays as cost eective and ecient light sources for wideeld microscopy. PLoS ONE 2008;3:2146. 7 74. Nishimura M, Shimakita T, Matsuzaki T, et al. Automatic counting of FISHlabeled microbes by an LED illuminated detecting apparatus. Fish Sci 2008; 74:405410. 7 75. Fazii P, Ciancaglini E, Riario Sforza G. Dierential uorescent staining method for detection of bacteria in blood cultures, cerebrospinal uid and other clinical specimens. Eur J Clin Microbiol Infect Dis 2002;21:373378. 7 76. Gmur R, Luthi-Schaller H. A combined immunouorescence and uorescent in situ hybridization assay for single cell analyses of dental plaque microorganisms. J Microbiol Methods 2007;69:402405. 7, 8, 14 77. Clausen CR. Detection of bacterial pathogens in purulent clinical specimens by immunouorescence techniques. J Clin Microbiol 1981;13:1119. 7, 8 78. Schellenberg J, Smoragiewicz W, Karska-Wysocki B. A rapid method combining immunouorescence and ow cytometry for improved understanding of competitive interactions between lactic acid bacteria (LAB) and methicillin-resistant S. aureus (MRSA) in mixed culture. J Microbiol Methods 2006;65:19. 7, 8 79. Oliveira M, Bexiga R, Nunes SF, et al. Biolm-forming ability proling of Staphylococcus aureus and Staphylococcus epidermidis mastitis isolates. Vet Microbiol 2006;118:133140. 8, 9, 13, 48 80. Oliveira M, Nunes SF, Carneiro C, et al. Time course of biolm formation by Staphylococcus aureus and Staphylococcus epidermidis mastitis isolates. Vet Microbiol 2007;124:187191. 8, 13 81. Forsgren A, Forsum U. Agglutination of Staphylococcus aureus by rabbit sera. Infect Immun 1972;5:524530. 8
134
References
82. Smith P, McCoy E, Wilson J. Identication of staphylococci in nonfat dry milk by the uorescent antibody technique [1] and [2]. J Dairy Sci 1962;45:729734. 8 83. Forsgren A, Sjoquist J. Protein A from S. aureus. I. pseudo-immune reaction with human gamma-globulin. J Immunol 1966;97:822827. 8, 22 84. Hugenholtz P, Tyson GW, Blackall LL. Design and evaluation of 16S rRNAtargeted oligonucleotide probes for uorescence in situ hybridization. Methods Mol Biol 2002;179:2942. 9, 11, 27, 32, 36, 45, 48 85. Malic S, Hill KE, Hayes A, et al. Detection and identication of specic bacteria in wound biolms using peptide nucleic acid uorescent in situ hybridization (PNA FISH). Microbiology 2009;155:26032611. 9, 11, 13, 31 86. Baldrich E, Vigues N, Mas J, et al. Sensing bacteria but treating them well: Determination of optimal incubation and storage conditions. Anal Biochem 2008; 383:6875. 9, 17, 41 87. Trebesius K, Leitritz L, Adler K, et al. Culture independent and rapid identication of bacterial pathogens in necrotising fasciitis and streptococcal toxic shock syndrome by uorescence in situ hybridisation. Med Microbiol Immunol 2000; 188:169175. 9, 10, 12, 13, 31, 32, 40, 41, 120, 121 88. Jansen GJ, Mooibroek M, Idema J, et al. Rapid identication of bacteria in blood cultures by using uorescently labeled oligonucleotide probes. J Clin Microbiol 2000;38:814817. 9, 13, 27, 107 89. Kalliomaki M, Collado MC, Salminen S, et al. Early dierences in fecal microbiota composition in children may predict overweight. Am J Clin Nutr 2008;87:534538. 10, 11, 13 90. Hogardt M, Trebesius K, Geiger AM, et al. Specic and rapid detection by uorescent in situ hybridization of bacteria in clinical samples obtained from cystic brosis patients. J Clin Microbiol 2000;38:818825. 10, 11, 13
References
135
91. Hoshino T, Yilmaz LS, Noguera DR, et al. Quantication of target molecules needed to detect microorganisms by uorescence in situ hybridization (FISH) and catalyzed reporter deposition-FISH. Appl Environ Microbiol 2008;74:50685077. 10 92. Yilmaz LS, Parnerkar S, Noguera DR. mathFISH, a web tool that uses
thermodynamics-based mathematical models for in silico evaluation of oligonucleotide probes for uorescence in situ hybridization. Appl Environ Microbiol 2011;77:111822. 10, 11, 16, 32, 33, 34, 36, 37, 38, 45, 46, 117 93. Chapin K, Musgnug M. Evaluation of three rapid methods for the direct identication of Staphylococcus aureus from positive blood cultures. J Clin Microbiol 2003;41:43244327. 10, 15 94. Pernthaler J, Pernthaler A, Amann R. Automated enumeration of groups of marine picoplankton after uorescence in situ hybridization. Appl Environ Microbiol 2003;69:26312637. 10, 31 95. Szweda P, Kotlowski R, Kur J. New eective sources of the Staphylococcus simulans lysostaphin. J Biotechnol 2005;117:203213. 10, 15, 18, 44, 72 96. Yilmaz LS, Bergsven LI, Noguera DR. Systematic evaluation of single mismatch stability predictors for uorescence in situ hybridization. Environ Microbiol 2008; 10:28722885. 11, 38, 39 97. Johnson M, Zaretskaya I, Raytselis Y, et al. NCBI BLAST: a better web interface. Nucleic Acids Res 2008;36:59. 11, 36 98. Yilmaz LS, Okten HE, Noguera DR. Making all parts of the 16S rRNA of Escherichia coli accessible in situ to single DNA oligonucleotides. Appl Environ Microbiol 2006;72:733744. 11, 25, 38, 39 99. Yilmaz LS, Noguera DR. Development of thermodynamic models for simulating probe dissociation proles in uorescence in situ hybridization. Biotechnol Bioeng 2007;96:349363. 11, 16, 38
136
References
100. Matsuhisa A, Saito Y, Ueyama H, et al. Detection of staphylococci in mouse phagocytic cells by in situ hybridization using biotinylated DNA probes. Biotech Histochem 1994;69:3137. 11, 13, 14, 15, 40, 42, 90, 91 101. Hawkins RC. Laboratory turnaround time. Clin Biochem Rev 2007;28:179194. 11, 12, 51 102. Perry-OKeefe H, Rigby S, Oliveira K, et al. Identication of indicator microorganisms using a standardized PNA FISH method. J Microbiol Methods 2001; 47:281292. 12, 13, 27, 34, 40, 41, 48, 108 103. Oliveira K, Brecher SM, Durbin A, et al. Direct identication of Staphylococcus aureus from positive blood culture bottles. J Clin Microbiol 2003;41:889891. 12, 13, 15 104. Gonzalez V, Padilla E, Gimenez M, et al. Rapid diagnosis of Staphylococcus aureus bacteremia using S. aureus PNA FISH. Eur J Clin Microbiol Infect Dis 2004;23:396398. 12, 13 105. Hartmann H, Stender H, Schafer A, et al. Rapid identication of Staphylococcus aureus in blood cultures by a combination of uorescence in situ hybridization using peptide nucleic acid probes and ow cytometry. J Clin Microbiol 2005; 43:48554857. 12, 13, 29, 40, 107, 108 106. Fiandaca M, Oliveira K, Stender H. Patent US20070128646 - Hybridization of PNA probes in alcohol solutions 2007. 12, 108 107. Regnault B, Martin-Delautre S, Grimont PAD. Problems associated with the direct viable count procedure applied to gram-positive bacteria. Int J Food Microbiol 2000;55:281284. 12, 13, 108 108. Nielsen PE, Egholm M, Berg RH, et al. Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide. Science (80) 1991; 254:14971500. 12, 108
References
137
109. Oliveira K, Procop GW, Wilson D, et al. Rapid identication of Staphylococcus aureus directly from blood cultures by uorescence in situ hybridization with peptide nucleic acid probes. J Clin Microbiol 2002;40:247251. 13, 40 110. Sogaard M, Stender H, Schonheyder HC. Direct identication of major blood culture pathogens, including Pseudomonas aeruginosa and Escherichia coli, by a panel of uorescence in situ hybridization assays using peptide nucleic acid probes. J Clin Microbiol 2005;43:19471949. 13 111. Forrest GN, Mehta S, Weekes E, et al. Impact of rapid in situ hybridization testing on coagulase-negative staphylococci positive blood cultures. J Antimicrob Chemother 2006;58:154158. 13 112. Peters RP, Savelkoul PH, Simoons-Smit AM, et al. Faster identication of
pathogens in positive blood cultures by uorescence in situ hybridization in routine practice. J Clin Microbiol 2006;44:119123. 13 113. Peters RPH, Agtmael MAV, Simoons-Smit AM, et al. Rapid identication of pathogens in blood cultures with a modied uorescence in situ hybridization assay. J Clin Microbiol 2006;44:41864188. 13 114. Horvath A, Kristof K, Konkoly-Thege M, et al. Rapid identication of pathogens in blood culture with uorescent in situ hybridization (FISH). Acta Microbiol Immunol Hung 2010;57:225234. 13 115. Kipp F, Ziebuhr W, Becker K, et al. Detection of Staphylococcus aureus by 16S rRNA directed in situ hybridisation in a patient with a brain abscess caused by small colony variants. J Neurol Neurosurg Psychiatry 2003;74:10001002. 13 116. Alt V, Lips KS, Henkenbehrens C, et al. A new animal model for implantrelated infected non-unions after intramedullary xation of the tibia in rats with uorescent in situ hybridization of bacteria in bone infection. Bone 2011;48:1146 1153. 13, 18, 34, 45
138
References
117. Hall-Stoodley L, Hu FZ, Gieseke A, et al. Direct detection of bacterial biolms on the Middle-Ear mucosa of children with chronic otitis media. JAMA 2006; 296:202211. 13 118. Hoa M, Tomovic S, Nistico L, et al. Identication of adenoid biolms with middle ear pathogens in otitis-prone children utilizing SEM and FISH. Int J Pediatr Otorhinolaryngol 2009;73:12421248. 13 119. Homoe P, Bjarnsholt T, Wessman M, et al. Morphological evidence of biolm formation in Greenlanders with chronic suppurative otitis media. Eur Arch Otorhinolaryngol 2009;266:15331538. 13 120. Nistico L, Gieseke A, Stoodley P, et al. Fluorescence in situ hybridization for the detection of biolm in the middle ear and upper respiratory tract mucosa. Methods Mol Biol 2009;493:191213. 13 121. Veeh RH, Shirtli ME, Petik JR, et al. Detection of Staphylococcus aureus biolm on tampons and menses components. J Infect Dis 2003;188:519530. 13, 14, 19, 88 122. Sanderson AR, Leid JG, Hunsaker D. Bacterial biolms on the sinus mucosa of human subjects with chronic rhinosinusitis. Laryngoscope 2006;116:11211126. 13 123. Huvenne W, Zhang N, Tijsma E, et al. Pilot study using doxycycline-releasing stents to ameliorate postoperative healing quality after sinus surgery. Wound Repair Regen 2008;16:757767. 13 124. Healy DY, Leid JG, Sanderson AR, et al. Biolms with fungi in chronic rhinosinusitis. Otolaryngol Head Neck Surg 2008;138:641647. 13 125. Niederfuhr A, Kirsche H, Deutschle T, et al. Staphylococcus aureus in nasal lavage and biopsy of patients with chronic rhinosinusitis. Allergy 2008;63:13591367. 13, 19, 88
References
139
126. Corriveau MN, Zhang N, Holtappels G, et al. Detection of Staphylococcus aureus in nasal tissue with peptide nucleic acid-uorescence in situ hybridization. Am J Rhinol Allergy 2009;23:461465. 13 127. Foreman A, Psaltis AJ, Tan LW, et al. Characterization of bacterial and fungal biolms in chronic rhinosinusitis. Am J Rhinol Allergy 2009;23:556561. 13 128. Foreman A, Wormald PJ. Dierent biolms, dierent disease? a clinical outcomes study. Laryngoscope 2010;120:17011706. 13, 109 129. Foreman A, Singhal D, Psaltis AJ, et al. Targeted imaging modality selection for bacterial biolms in chronic rhinosinusitis. Laryngoscope 2010;120:427431. 13, 109 130. Sachse F, Becker K, von Ei C, et al. Staphylococcus aureus invades the epithelium in nasal polyposis and induces IL-6 in nasal epithelial cells in vitro. Allergy 2010; 65:14301437. 13 131. Swidsinski A, Goktas O, Bessler C, et al. Spatial organisation of microbiota in quiescent adenoiditis and tonsillitis. J Clin Pathol 2007;60:253260. 13 132. Zautner AE, Krause M, Stropahl G, et al. Intracellular persisting Staphylococcus aureus is the major pathogen in recurrent tonsillitis. PLoS One 2010;5:e9452. 13, 93 133. Kirketerp-Moller K, Jensen PO, Fazli M, et al. Distribution, organization, and ecology of bacteria in chronic wounds. J Clin Microbiol 2008;46:27172722. 13 134. Thomsen T, Aasholm M, Rudkjobing V, et al. The bacteriology of chronic venous leg ulcer examined by culture-independent molecular methods. Wound Repair Regen 2010;18:3849. 13 135. Stoodley P, Conti S, DeMeo P, et al. Characterization of a mixed MRSA/MRSE biolm in an explanted total ankle arthroplasty. FEMS Immunol Med Mic 2011; 62:6674. 13
140
References
136. Connally R, Veal D, Piper J. Time-resolved uorescence microscopy using an improved europium chelate BHHST for the in situ detection of cryptosporidium and giardia. Microsc Res Tech 2004;64:312322. 14, 19, 21, 22, 89, 94 137. Bernhardt M, Pennell D, Almer L, et al. Detection of bacteria in blood by centrifugation and ltration. J Clin Microbiol 1991;29:422425. 14, 18, 106, 108 138. Decleva E, Menegazzi R, Busetto S, et al. Common methodology is inadequate for studies on the microbicidal activity of neutrophils. J Leukocyte Biol 2006; 79:8794. 14, 19, 21, 42, 87, 91, 93, 94, 95, 106 139. Pernthaler A, Pernthaler J, Amann R. Fluorescence in situ hybridization and catalyzed reporter deposition for the identication of marine bacteria. Appl Environ Microbiol 2002;68:30943101. 15, 42, 43 140. Bouvier T, Del Giorgio PA. Factors inuencing the detection of bacterial cells using uorescence in situ hybridization (FISH): a quantitative review of published reports. FEMS Microbiol Ecol 2003;44:315. 15, 16, 27, 33, 34, 104 141. Yan C, Ding B, Lan X, et al. The toxicity study on marine low-temperature lysozyme. Food Chem Toxicol 2008;46:604609. 15, 44, 73 142. Manz W, Amann R, Ludwig W, et al. Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: problems and solutions. Syst Appl Microbiol 1992;15:593600. 16, 18, 31, 32, 35, 45, 47, 105 143. Manz W, Eisenbrecher M, Neu TR, et al. Abundance and spatial organization of gram-negative sulfate-reducing bacteria in activated sludge investigated by in situ probing with specic 16S rRNA targeted oligonucleotides. FEMS Microbiol Ecol 1998;25:4361. 16, 34, 35, 45 144. Simard C, Lemieux R, Cote S. Urea substitutes toxic formamide as destabilizing agent in nucleic acid hybridizations with RNA probes. Electrophoresis 2001; 22:26792683. 16, 18, 32, 72, 105
References
141
145. Knoll J, Lichter P, Bakdounes K, et al. In situ hybridization and detection using nonisotopic probes. Curr Protoc Mol Biol 2007;14:Unit 14.7. 16, 47, 89, 94 146. Bossuyt PM, Irwig L, Craig J, et al. Comparative accuracy: assessing new tests against existing diagnostic pathways. BMJ 2006;332:1089. 17 147. Cisani G, Varaldo PE, Grazi G, et al. High-level potentiation of lysostaphin anti-staphylococcal activity by lysozyme. Antimicrob Agents Chemother 1982; 21:531535. 17, 27, 30, 43, 44, 48, 72 148. Connally R. A device for Gated Auto-Synchronous Luminescence Detection
(GALD). Anal Chem 2011;83:47824787. 19, 20, 21, 22, 23, 47, 48, 90, 91, 92, 95, 101 149. Seveus L, Vaisala M, Syrjanen S, et al. Time-resolved uorescence imaging of europium chelate label in immunohistochemistry and in situ hybridization. Cytometry 1992;13:329338. 21, 22, 88, 90, 93, 106 150. de Haas R, Verwoerd N, Van der Corput M, et al. The use of peroxidasemediated deposition of biotin-tyramide in combination with time-resolved uorescence imaging of europium chelate label in immunohistochemistry and in situ hybridization. J Histochem Cytochem 1996;44:10911099. 21, 22, 90 151. Connally R, Jin D, Piper J. BHHST: an improved lanthanide chelate for timeresolved uorescence applications. In Proc SPIE, vol. 5704. 93. 21, 22, 89, 101 152. Weise A, Mrasek K, Ewers E, et al. Diagnostic applications of uorescence in situ hybridization. Expert Opin Med Diagn 2009;3:453460. 29 153. Hutton JR. Renaturation kinetics and thermal stability of DNA in aqueous solutions of formamide and urea. Nucleic Acids Res 1977;4:35373555. 31, 32, 33, 39, 45, 47, 105, 106 154. Cole JR, Wang Q, Cardenas E, et al. The ribosomal database project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res 2008;37:141145. 36
142
References
155. Loy A, Arnold R, Tischler P, et al. probeCheck-a central resource for evaluating oligonucleotide probe coverage and specicity. Environ Microbiol 2008;10:2894 2898. 36 156. Yilmaz LS, Noguera DR. Mechanistic approach to the problem of hybridization eciency in uorescent in situ hybridization. Appl Environ Microbiol 2004; 70:71267139. 36, 38 157. Amann RI, Binder BJ, Olson RJ, et al. Combination of 16S rRNA-targeted oligonucleotide probes with ow cytometry for analyzing mixed microbial populations. Appl Environ Microbiol 1990;56:19191925. 40, 107, 117 158. Thomas LC, Gidding HF, Ginn AN, et al. Development of a real-time Staphylococcus aureus and MRSA (SAM-) PCR for routine blood culture. J Microbiol Methods 2007;68:296302. 41, 90, 106 159. Hinds A, Peterson G. Method for standardizing staphylococcal suspensions: Relationship of optical density to viable cell count. J Bacteriol 1963;86:168. 41, 91 160. Hockey L, Fujita N, Gibson T, et al. Detection of fungemia obscured by concomitant bacteremia: in vitro and in vivo studies. J Clin Microbiol 1982;16:10801085. 42, 91, 106 161. Krasnoperov L, Marras S, Kozlov M, et al. Luminescent probes for ultrasensitive detection of nucleic acids. Bioconjugate Chem 2010;21:319327. 88, 89 162. Soini E, Lovgren T, Reimer C. Time-resolved uorescence of lanthanide probes and applications in biotechnology. Crit Rev Anal Chem 1987;18:105154. 88, 89 163. Selvin P. Principles and biophysical applications of lanthanide-based probes. Annu Rev Biophys Biomol Struct 2002;31:275302. 89 164. Bunzli J, Piguet C. Taking advantage of luminescent lanthanide ions. Chem Soc Rev 2005;34:10481077. 89
References
143
165. Bunzli J. Lanthanide luminescence for biomedical analyses and imaging. Chem Rev 2010;110:27292755. 89, 90 166. Nauseef W. Isolation of human neutrophils from venous blood. Methods Mol Biol 2007;412:1520. 93 167. Roller C, Wagner M, Amann R, et al. In situ probing of gram-positive bacteria with high DNA G + C content using 23S rRNA-targeted oligonucleotides. Microbiology 1994;140:28492858. 108 168. Fowler JVG, Justice A, Moore C, et al. Risk factors for hematogenous complications of intravascular Catheter-Associated Staphylococcus aureus bacteremia. Clin Infect Dis 2005;40:695703. 108 169. Jin D, Connally R, Piper J. Practical time-gated luminescence ow cytometry. I: concepts. Cytom Part A 2007;71:783796. 108 170. Jin D, Connally R, Piper J. Practical time-gated luminescence ow cytometry. II: experimental evaluation using UV LED excitation. Cytom Part A 2007;71:797 808. 108 171. Foreman A, Wormald P. In response to targeted imaging modality selection for bacterial biolms in chronic rhinosinusitis and dierent biolms, dierent disease? a clinical outcomes study. Laryngoscope 2011;121:20452046. 109

The Specific Identification of Staphylococcus Aureus With New Fluorescence in Situ Hybridization (FISH) Methods

Uploaded by

Copyright:

Available Formats

You might also like

The Specific Identification of Staphylococcus Aureus With New Fluorescence in Situ Hybridization (FISH) Methods

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

The Specific Identification of Staphylococcus Aureus With New Fluorescence in Situ Hybridization (FISH) Methods

Uploaded by

Copyright:

Available Formats

The specific identification of Staphylococcus aureus with new fluorescence in situ hybridization (FISH) methods

Thomas Sutherland Lawson

c Thomas Sutherland Lawson, 2012.

Thomas Sutherland Lawson

List of publications and awards

List of publications and awards

v vii ix xvii xix 1 1 3 4 4 6

Outline of the thesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . xiii

In situ probing of S. aureus with specic 16S rRNA targeted oligonucleotides . . . . . . . . . . . . . . . . . . . . . . . . . . . 40 41 41 42 43 43

2.1.4 2.1.5 2.2 2.3 2.4 2.5

Bacterial isolates . . . . . . . . . . . . . . . . . . . . . . . . . . Separation of S. aureus from an in vitro model of bacteraemia .

1.1 1.2 2.1 2.2 2.3 5.1 5.2 5.3 5.4

1.1 1.2 2.1 2.2 2.3 5.1

S/N calculations of a BHTEGS and a conventional probe . . . . . . . . 100

1.2 Septicemia and S. aureus

Septicemia and S. aureus

Diagnosis and treatment of S. aureus septicemia

Standard diagnostic pathway for septicemia and its limitations

1.3 Diagnosis and treatment of S. aureus septicemia

The role of blood culture in diagnosing septicemia

The role of Gram-stain for the detection of septicemia

The role of conrmatory and antibacterial susceptibility tests

Possible improvements to S. aureus septicemia diagnostics

1.3 Diagnosis and treatment of S. aureus septicemia

The role of uorescence microscopy in diagnosing S. aureus septicemia

Improving the FISH for identication of S. aureus directly in blood cultures

Recent developments in FISH

Brain abscess Bone

Cerebrospinal uid Planktonic Ear Heart valve Non-planktonic Non-planktonic

Laboratory strains Planktonic Menses Milk Nose Planktonic Planktonic Non-planktonic

Sputum Stool Throat Tampon Urine Whole-blood Wound

Planktonic Planktonic Non-planktonic Non-planktonic Planktonic Planktonic Non-planktonic

Limitations of FISH as applied to S. aureus

Duplex binding of DNA to RNA

Improvements required for the application of FISH in the detection of S. aureus

Re-engineering FISH for the detection of S. aureus

(a) Ungated uorescence image

(b) Time-gated luminescence image

Outline of the thesis

1.6 Outline of the thesis

Methodology: FISH with rRNA-targeted oligonucleotide probes

Methodology: FISH with rRNA-targeted oligonucleotide probes

Total time: 127 minutes.

2.1 Preparation of reagents, probes and S. aureus samples

Preparation of reagents, probes and S. aureus samples

Hybridization and post-hybridization washing buer preparation

Methodology: FISH with rRNA-targeted oligonucleotide probes

sterilized with a 2 m syringe lter.

2.1 Preparation of reagents, probes and S. aureus samples

Methodology: FISH with rRNA-targeted oligonucleotide probes

2.1 Preparation of reagents, probes and S. aureus samples

Methodology: FISH with rRNA-targeted oligonucleotide probes

(DeltaGo) and the hy-

2.1 Preparation of reagents, probes and S. aureus samples

Methodology: FISH with rRNA-targeted oligonucleotide probes

2.1 Preparation of reagents, probes and S. aureus samples

Methodology: FISH with rRNA-targeted oligonucleotide probes