US 20120251502A1

(19) United States

(12) Patent Application Publication (10) Pub. No.: US 2012/0251502 A1
TOWner et al. (43) Pub. Date: Oct. 4, 2012
(54) HUMAN EBOLAVIRUS SPECIES AND Publication Classification
COMPOSITIONS AND METHODS THEREOF
(51) Int. Cl.
(75) Inventors: Jonathan S. Towner, Atlanta, GA A6II 35/76 (2006.01)
(US): Stuart T. Nichol, Atlanta, GA C7H 2L/04 (2006.01)
(US); James A. Comer, Atlanta, CI2N 7/04 (2006.01)
GA (US); Thomas G. Ksiazek, C07K I4/08 (2006.01)
Atlanta, GA (US); Pierre E. Rollin, A638/02 (2006.01)
Atlanta, GA (US) A63L/7088 (2006.01)
C07K 7/06 (2006.01)
(73) Assignee: The Government of the US as C07K 7/08 (2006.01)
Represented by the Secretary of CI2N 7/00 (2006.01)
the Dept. of health, Atlanta, GA C7H 2L/02 (2006.01)
(US)
(52) U.S. Cl. .................. 424/93.6:435/235.1536/23.72:
(21) Appl. No.: 13/125,890 435/236; 530/350; 514/1.1, 514/44 R; 530/330;
530/329; 530/328; 530/327: 530/326; 530/325;
(22) PCT Fled: Oct. 26, 2009 530/324

(86) PCT NO.: PCT/USO9/62079

(57) ABSTRACT
S371 (c)(1), Compositions and methods including and related to the Ebola
(2), (4) Date: Jun. 21, 2011 Bundibugyo virus (EboBun) are provided. Compositions are
Related U.S. Application Data provided that are operable as immunogens to elicit and
immune response or protection from EboBun challenge in a
(62) Division of application No. 61/108,175, filed on Oct. Subject such as a primate. Inventive methods are directed to
24, 2008. detection and treatment of EboBun infection.
Patent Application Publication Oct. 4, 2012 Sheet 1 of 27 US 2012/O251502 A1

09 DRC 1999
1f100
Ravn Kenya 1987
Marbu rC Ozolin Zimbabwe 1975
999 of DRc1999
1194
O5 DRC 1999
.98
1379c Angola 2005
9958 Popp Uganda/Germany 1967

Musoke Kenya 1980

ware Yambuku 1976

1A96 Zaire, Kikwit 1995

Ebola 1
Cote d'Ivoire 1994

1f100
Sudan Gulu Uganda 2000
0.5 substfsite Reston, USA 1989

Fig. 1
Patent Application Publication Oct. 4, 2012 Sheet 8 of 27 US 2012/O251502 A1

1
0
L 1
0
L 1
0
L

leToqÐI leToqÐI leToqÐI leToqÐI leToqÐI leToqÐI leToqÐI leToqÐI leToqÐI

US 2012/025 1502 A1 Oct. 4, 2012

HUMAN EBOLAVIRUS SPECIES AND d'Ivoire ebolavirus, in contrast to Zaire and Sudan ebolavi
COMPOSITIONS AND METHODS THEREOF ruses which have each caused multiple large outbreaks over
the same time period.
RELATED APPLICATIONS 0007. In late November 2007, HF cases were reported in
0001. This application claims priority benefit of U.S. Pro the townships of Bundibugyo and Kikyo in Bundibugyo Dis
visional Application 61/108,175 filed 24 Oct. 2008; the con trict, Western Uganda. The outbreak continued through Janu
tents of which are hereby incorporated by reference. ary 2008, and resulted in approximately 149 cases and 37
deaths. Laboratory investigation of the initial 29 suspect
DEPOSIT STATEMENT case blood specimens by classic methods (antigen capture,
IgM and IgG ELISA) and a recently developed random
0002 The invention provides the isolated human Ebola primed pyrosequencing approach identified this to be an
(hEbola) viruses denoted as Bundibugyo (EboBun) deposited Ebola HF outbreakassociated with a new discovered ebolavi
with the Centers for Disease Control and Prevention (“CDC': rus species. These specimens were negative when initially
Atlanta, Ga., United States of America) on Nov. 26, 2007 and tested with highly sensitive real-time RT-PCR assays specific
accorded an accession number 200706291. This deposit was for all known Zaire and Sudan ebolaviruses and Marburg
not made to an International Depository Authority (IDA) as viruses. This new species is referred to herein as “the
established under the Budapest Treaty on the International Bundibugyo species', abbreviated “EboBun'.
Recognition of the Deposit of Microorganisms for the Pur 0008 Accordingly, compositions and methods directed to
poses of Patent Procedure, and is a non-Budapest treaty the new Ebola virus species are described herein and the most
deposit. The deposited organism is not acceptable by Ameri closely related Ebola Ivory Coast species, which composi
can Type Culture Collection (ATCC), Manassas, Va., an Inter tions and methods are useful for diagnosis and prevention of
national Depository Authority (IDA) as established under the human Ebola virus infection; including related vaccine devel
Budapest Treaty on the International Recognition of the opment, and prevention of hemorrhagic fever in a human
Deposit of Microorganisms for the Purposes of Patent Proce population.
dure. Samples of the stated Deposit Accession No.
200706291 will be made available to approved facilities for SUMMARY OF THE INVENTION
thirty years from the date of deposit, and for the lifetime of the
patent issuing from, or claiming priority to this application. 0009. The present invention is based upon the isolation
and identification of a new human Ebola virus species,
FIELD OF THE INVENTION EboBun. EboBun was isolated from the patients suffering
from hemorrhagic fever in a recent outbreak in Uganda. The
0003. The invention is related to compositions and meth isolated virus is a member of the Filoviridae family, a family
ods directed to a novel species of human Ebola (hEbola) of negative sense RNA viruses. Accordingly, the invention
virus. relates to the isolated EboBun virus that morphologically and
BACKGROUND OF THE INVENTION
phylogenetically relates to known members filoviridae.
0010. In one aspect, the invention provides the isolated
0004. The family Filoviridae consists of two genera, Mar EboBun virus deposited with the Centers for Disease Control
burgvirus and Ebolavirus, which have likely evolved from a and Prevention (“CDC': Atlanta, Ga., United States of
common ancestor'. The genus Ebolavirus includes four spe America) on Nov. 26, 2007 and accorded an accession num
cies: Zaire, Sudan, Reston and Cote d'Ivoire (Ivory Coast) ber 200706291, as stated in the paragraph entitled “DEPOSIT
ebolaviruses, which have, with the exception of Reston and STATEMENT supra.
Cote d'Ivoire ebolaviruses, been associated with large hem 0011. In another aspect, the invention provides an isolated
orrhagic fever (HF) outbreaks in Africa with high case fatality hEbola EboBun virus comprising a nucleic acid molecule
(53-90%). comprising a nucleotide sequence selected from the group
0005 Viruses of each species have genomes that are at consisting of: a) a nucleotide sequence set forth in SEQ ID
least 30-40% divergent from one another, a level of diversity NO: 1; b) a nucleotide sequence that hybridizes to the
that presumably reflects differences in the ecological niche sequence set forth in SEQID NO: 1 under stringent condi
they occupy and in their evolutionary history. Identification of tions; and c) a nucleotide sequence that has at least 70%, 75%,
the natural reservoir of ebolaviruses remains somewhat elu 80%, 85%, 90%, 95%,96%.97%.98%, or 99% identity to the
sive, although recent PCR and antibody data Suggest that SEQID NO: 1. In another aspect, the invention provides the
three species of arboreal fruit bats may be carriers of Zaire complete genomic sequence of the hEbola virus EboBun.
ebolavirus. No data has yet been published to suggest reser 0012. In a related aspect, the invention provides nucleic
voirs for the Sudan, Reston and Cote d'Ivoire ebolavirus acid molecules isolated from EboBun, or fragments thereof.
species. However, a cave-dwelling fruit bat has been recently 0013. In another aspect, the invention provides proteins or
implicated as a natural host for marburgvirus" . Supporting polypeptides that are isolated from the EboBun, including
the hypothesis that different bat species may be the reservoir viral proteins isolated from cells infected with the virus but
hosts for the various filoviruses. not present in comparable uninfected cells; or fragments
0006 Filovirus outbreaks are sporadic, sometimes inter thereof. In one embodiment of the present invention, the
spersed by years or even decades of no apparent disease amino acid sequences of the proteins or polypeptides are set
activity. The last new species of ebolavirus was discovered 14 forth in SEQID NOS: 2-9 and 59, or fragments thereof.
years ago (1994), in Cote d'Ivoire (Ivory Coast), and involved 0014. In a related aspect, the invention provides an iso
a single non-fatal case, a veterinarian who performed an lated polypeptide encoded by the nucleic acid molecule of the
autopsy on an infected chimpanzee found in the Tai Forest. inventive hEbola EbolC (Sequence ID No. 10) virus
No further disease reports have been associated with Cote described above.
US 2012/025 1502 A1 Oct. 4, 2012

0015. In another aspect, the invention provides an isolated sample with an agent that selectively binds to the polypeptide;
hEbola EbolC virus comprising a nucleic acid molecule com and (b) detecting whether the agent binds to the polypeptide
prising a nucleotide sequence selected from the group con in the sample.
sisting of: a) a nucleotide sequence set forth in SEQID NO: 0024. In another aspect, the invention provides a method
10; b) a nucleotide sequence that hybridizes to the sequence for propagating the hEbola virus in host cells comprising
set forth in SEQID NO: 10 under stringent conditions; and c) infecting the host cells with the inventive isolated hEbola
a nucleotide sequence that has at least 70%, 75%, 80%, 85%, virus described above, culturing the host cells to allow the
90%. 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID virus to multiply, and harvesting the resulting virions. Also
NO: 10. In another aspect, the invention provides the com provided by the present invention are host cells infected with
plete genomic sequence of the hEbola virus EboC. the inventive hEbola virus described above.
0016. In a related aspect, the invention provides nucleic 0025. In another aspect, the invention provides a method
of detecting in a biological sample the presence of an anti
acid molecules isolated from EbolC, or fragments thereof. body that immunospecifically binds hEbola virus, the method
0017. In another aspect, the invention provides proteins or comprising: (a) contacting the biological sample with the
polypeptides that are isolated from the EboC, including viral inventive host cell host described above; and (b) detecting the
proteins isolated from cells infected with the virus but not antibody bound to the cell.
present in comparable uninfected cells; or fragments thereof. 0026. In another aspect, the invention provides vaccine
In one embodiment of the present invention, the amino acid preparations, comprising the inventive hEbola virus, includ
sequences of the proteins or polypeptides are set forth in SEQ ing recombinant and chimeric forms of the virus, nucleic acid
ID NOs: 11-19, or fragments thereof. molecules comprised by the virus, or protein subunits of the
0018. In a related aspect, the invention provides an iso virus. The invention also provides a vaccine formulation com
lated polypeptide encoded by the nucleic acid molecule of the prising atherapeutically or prophylactically effective amount
inventive hEbola EboC virus described above. of the inventive hEbola virus described above, and a pharma
0019. In other aspects, the invention relates to the use of ceutically acceptable carrier. In one embodiment, the inven
the isolated hEbola virus for diagnostic and therapeutic meth tion provides a vaccine formulation comprising a therapeuti
ods based on EbBun, EboC, or a combination thereof. In one cally or prophylactically effective amount of a protein extract
embodiment, the invention provides a method of detecting in of the inventive hEbola virus described above, or a subunit
a biological sample an antibody immunospecific for the thereof, and a pharmaceutically acceptable carrier. In another,
genus of West Afrin Ebola Species constituting hEbola the invention provides a vaccine formulation comprising a
EbBun and EboC virus using at least one the inventive iso therapeutically or prophylactically effective amount of a
lated hEbola virus described herein, or any of the inventive nucleic acid molecule comprising the nucleotide sequence of
proteins or polypeptides as described herein. In another spe SEQID NO: 1 or a complement thereof, and a pharmaceuti
cific embodiment, the invention provides a method of screen cally acceptable carrier. In another, the invention provides a
ing for an antibody which immunospecifically binds and neu vaccine formulation comprising a therapeutically or prophy
tralizes hEbola EboBun. Such an antibody is useful for a lactically effective amount of a nucleic acid molecule com
passive immunization or immunotherapy of a subject infected prising any of inventive the nucleotide sequences as described
with hEbola. above, or a complement thereof, and a pharmaceutically
acceptable carrier.
0020. In another aspect, the invention provides an isolated 0027. In a related aspect, the invention provides an immu
antibody or an antigen-binding fragment thereof which nogenic formulation comprising an immunogenically effec
immunospecifically binds to the hEbola virus of the invention tive amount of the inventive hEbola virus described above,
described above.
and a pharmaceutically acceptable carrier. In another related
0021. In other aspects, the invention provides methods for aspect, the invention provides an immunogenic formulation
detecting the presence, activity or expression of the Glade of comprising an immunogenically effective amount of a pro
Bundibungyo-Ivory Coast hEbola virus in a biological mate tein extract of the inventive hEbola virus described above or a
rial. Such as cells, blood, saliva, urine, feces and so forth; and Subunit thereof, and a pharmaceutically acceptable carrier. In
specifically at least one of EbBun or EbolC. another related aspect, the invention provides an immuno
0022. In a related aspect, the invention provides a method genic formulation comprising an immunogenically effective
for detecting the presence of the inventive hEbola virus amount of a nucleic acid molecule comprising the nucleotide
described above in a biological sample, the method includes sequence of SEQ ID NO: 1 or a complement thereof, and a
(a) contacting the sample with an agent that selectively binds pharmaceutically acceptable carrier. In another related
to a West African hEbola virus; and (b) detecting whether the aspect, the invention provides an immunogenic formulation
compound binds to the West African hEbola virus in the comprising an immunogenically effective amount of a
sample. nucleic acid molecule comprising the inventive nucleotide
0023. In another aspect, the invention provides a method sequence as described above or a complement thereof, and a
for detecting the presence of the inventive polypeptide pharmaceutically acceptable carrier. In another related
described above, in a biological sample, said method includes aspect, the invention provides an immunogenic formulation
(a) contacting the biological sample with an agent that selec comprising an immunogenically effective amount of any of
tively binds to the polypeptide; and (b) detecting whether the the inventive polypeptides described above.
agent binds to the polypeptide in the sample. In another 0028. In another aspect, the present invention provides
aspect, the invention provides a method for detecting the pharmaceutical compositions comprising antiviral agents of
presence of a first nucleic acid molecule derived from the the present invention and a pharmaceutically acceptable car
inventive hEbola virus described above in a biological rier. In a specific embodiment, the antiviral agent of the inven
sample, the method comprising: (a) contacting the biological tion is an antibody that immunospecifically binds hEbola
US 2012/025 1502 A1 Oct. 4, 2012

virus or any hEbola epitope. In another specific embodiment, sequenced using a recently developed random-primed
the antiviral agent is a polypeptide or protein of the present pyrosequencing approach which allowed the rapid develop
invention or nucleic acid molecule of the invention. ment of molecular detection assay which were deployed in
0029. In a related aspect, the invention provides a pharma the disease outbreak response. This random-primed pyrose
ceutical composition comprising a prophylactically or thera quencing draft sequence allowed faster completion of the
peutically effective amount of an anti-hEbola EboBun agent whole genome sequence using traditional primer walking
and a pharmaceutically acceptable carrier. approach and confirmation that the EboBun virus represented
0030 The invention also provides kits containing compo a new ebolavirus species.
sitions and formulations of the present invention. Thus, in
another aspect, the invention provides a kit comprising a Definitions
container containing the inventive immunogenic formulation 0039. The definitions herein provided are operative
described above. In another aspect, the invention provides a throughout the entire description of the invention set forth
kit comprising a container containing the inventive vaccine herein, including the Summary of the Invention.
formulation described above. In another, the invention pro 0040. The term “an antibody or an antibody fragment that
vides a kit comprising a container containing the inventive immunospecifically binds a polypeptide of the invention' as
pharmaceutical composition described above. In another, the used herein refers to an antibody or a fragment thereof that
invention provides a kit comprising a container containing the immunospecifically binds to the polypeptide encoded by the
inventive vaccine formulation described above. In another, nucleotide sequence of SEQID NO: 1 (EboBun), or a frag
the invention provides a method for identifying a subject ment thereof, and does not non-specifically bind to other
infected with the inventive hEbola virus described above, polypeptides. An antibody or a fragment thereof that immu
comprising: (a) obtaining total RNA from a biological sample nospecifically binds to the polypeptide of the invention may
obtained from the subject; (b) reverse transcribing the total cross-react with other antigens. Preferably, an antibody or a
RNA to obtain cDNA; and (c) amplifying the cDNA using a fragment thereofthat immunospecifically binds to a polypep
set of primers derived from a nucleotide sequence of the tide of the invention does not cross-react with other antigens.
inventive hEbola virus described above.
An antibody or a fragment thereof that immunospecifically
0031. The invention further relates to the use of the binds to the polypeptide of the invention can be identified by,
sequence information of the isolated virus for diagnostic and for example, immunoassays or other techniques known to
therapeutic methods. those skilled in the art, or otherwise as described herein.
0032. In another aspect, the present invention provides 0041 An "isolated” or “purified” peptide or protein is
methods for screening antiviral agents that inhibit the infec Substantially free of cellular material or other contaminating
tivity or replication of hEbola virus or variants thereof. proteins from the cell or tissue source from which the protein
0033. The invention further provides methods of prepar is derived, or substantially free of chemical precursors or
ing recombinant or chimeric forms of hEbola. other chemicals when chemically synthesized. The language
BRIEF DESCRIPTION OF THE DRAWINGS
“substantially free of cellular material includes preparations
of a polypeptide?protein in which the polypeptide?protein is
0034 FIG. 1 represents a Phylogenetic tree comparing separated from cellular components of the cells from which it
full-length genomes of Ebolavirus and Marburg virus by is isolated or recombinantly produced. Thus, a polypeptide?
Bayesian analysis; protein that is substantially free of cellular material includes
0035 FIG. 2 represents an alignment of genomes of novel preparations of the polypeptide?protein having less than
hEbola EboBun (SEQID NO: 1) referred to below as “Ebola about 30%, 20%, 10%, 5%, 2.5%, or 1% (by dry weight) of
Bundibugyo’ or “EboBun', and hEbola Zaire (SEQID NO: contaminating protein. When the polypeptide?protein is
20); referred to below as “Ebola Zaire 76” or “EboZ” and recombinantly produced, it is also preferably substantially
hEbola Ivory Coast (SEQID NO: 10) also referred to below free of culture medium, i.e., culture medium represents less
as “EboIC. than about 20%, 10%, or 5% of the volume of the protein
preparation.
DETAILED DESCRIPTION OF THE PREFERRED 0042. When polypeptide?protein is produced by chemical
EMBODIMENTS synthesis, it is preferably substantially free of chemical pre
cursors or other chemicals, i.e., it is separated from chemical
0036. It is to be understood that the present invention is not precursors or other chemicals which are involved in the syn
limited to particular embodiments described, as such may, of thesis of the protein. Accordingly, Such preparations of the
course, vary. It is also to be understood that the terminology polypeptide?protein have less than about 30%, 20%, 10%, 5%
used herein is for the purpose of describing particular (by dry weight) of chemical precursors or compounds other
embodiments only, and is not intended to be limiting. than polypeptide?protein fragment of interest. In a preferred
0037. Due to the sequence divergence of EboBun relative embodiment of the present invention, polypeptides/proteins
to all previously recognized ebolaviruses, the present inven are isolated or purified.
tion has utility in design of diagnostic assays to monitor Ebola 0043. An "isolated nucleic acid molecule is one which is
HF disease in humans and animals, and develop effective separated from other nucleic acid molecules which are
antivirals and vaccines. present in the natural source of the nucleic acid molecule.
0038. The EboBun virus of the present invention is geneti Moreover, an "isolated nucleic acid molecule, such as a
cally distinct, differing by more than 30% at the genome level cDNA molecule, can be substantially free of other cellular
from all other known ebolavirus species. The unique nature of material, or culture medium when produced by recombinant
this virus created challenges for traditional filovirus molecu techniques, or Substantially free of chemical precursors or
lar based diagnostic assays and genome sequencing other chemicals when chemically synthesized. In a preferred
approaches. Instead, over 70% of the virus genome was embodiment of the invention, nucleic acid molecules encod
US 2012/025 1502 A1 Oct. 4, 2012

ing polypeptides/proteins of the invention are isolated or puri MEGALIGN version 3.12e sequence alignment program.
fied. The term "isolated nucleic acid molecule does not This program is part of the LASERGENE software package,
include a nucleic acid that is a member of a library that has not a Suite of molecular biological analysis programs (DNAS
been purified away from other library clones containing other TAR, Madison, Wis.). CLUSTALV is described in Higgins,
nucleic acid molecules. D. G. and P. M. Sharp (1989; CABIOS 5:151-153) and in
0044) The term “portion' or “fragment as used herein Higgins, D. G. et al. (1992; CABIOS 8:189-191). For pair
includes the specified fragment lengths, and all integers in wise alignments of polynucleotide sequences, the default
between, inclusive of the specified end points in a specified parameters are set as follows: Ktuple 2, gap penalty=5, win
range, and inclusive of any length up to the full length of a dow=4, and “diagonals saved’—4. The “weighted residue
protein, polypeptide, or nucleic acid. weight table is selected as the default.
0045. The term “having a biological activity of the pro 0051 Alternatively, a suite of commonly used and freely
tein' or “having biological activities of the polypeptides of
the invention” refers to the characteristics of the polypeptides available sequence comparison algorithms which can be used
or proteins having a common biological activity, similar or is provided by the National Center for Biotechnology Infor
identical structural domain, and/or having Sufficient amino mation (NCBI) Basic Local Alignment Search Tool (BLAST)
acid identity to the polypeptide encoded by the nucleotide (Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403-410),
sequence of SEQ ID NO: 1 (EboBun). Such common bio which is available from several sources, including the NCBI,
logical activities of the polypeptides of the invention include Bethesda, Md., and on the NCBI World WideWeb site avail
antigenicity and immunogenicity. able on the Internet. The BLAST software suite includes
0046. The term “under stringent condition” refers to various sequence analysis programs including “blastin,” that
hybridization and washing conditions under which nucle is used to align a known polynucleotide sequence with other
otide sequences having at least 70%, at least 75%, at least polynucleotide sequences from a variety of databases. Also
80%, at least 85%, at least 90%, or at least 95% identity to available is a tool called “BLAST 2 Sequences” that is used
each other remain hybridized to each other. Such hybridiza for direct pairwise comparison of two nucleotide sequences.
tion conditions are described in, for example but not limited “BLAST 2 Sequences' can be accessed and used interac
to, Current Protocols in Molecular Biology, John Wiley & tively on the Internet via the NCBI World Wide Web site as
Sons, NY (1989), 6.3.1-6.3.6; Basic Methods in Molecular well. The “BLAST 2 Sequences” tool can be used for both
Biology, Elsevier Science Publishing Co., Inc., NY (1986), blastn and blastp (discussed below). BLAST programs are
pp. 75-78, and 84-87; and Molecular Cloning, Cold Spring commonly used with gap and other parameters set to default
Harbor Laboratory, NY (1982), pp. 387-389, and are well settings. For example, to compare two nucleotide sequences,
known to those skilled in the art. A preferred, non-limiting one may use blastin with the “BLAST 2 Sequences” tool
example of Stringent hybridization conditions is hybridiza Version 2.0.12 (Apr. 21, 2000) set at default parameters. Such
tion in 6x sodium chloride/sodium citrate (SSC), 0.5% SDS default parameters may be, for example: Matrix:BLO
at about 68°C. followed by one or more washes in 2xSSC, SUM62; Reward for match: 1; Penalty for mismatch: -2:
0.5% SDS at room temperature. Another preferred, non-lim Open Gap: 5 and Extension Gap: 2 penalties; Gapxdrop-off:
iting example of stringent hybridization conditions is hybrid 50; Expect: 10; Word Size: 11: Filter: on.
ization in 6xSSC at about 45° C., followed by one or more 0.052 Percent identity may be measured over the length of
washes in 0.2xSSC, 0.1% SDS at about 50-65° C. an entire defined sequence, for example, as defined by a
0047. The term “variant” as used herein refers either to a particular SEQID number, or may be measured overa shorter
naturally occurring genetic mutant of hEbola EboBun, or length, for example, over the length of a fragment taken from
hEbola EbolC, or a recombinantly prepared variation of these a larger, defined sequence, for instance, a fragment of at least
hEbola species, each of which contain one or more mutations 20, at least 30, at least 40, at least 50, at least 70, at least 100,
in its genome compared to the hEbola of SEQID NO: 1 or 10. or at least 200 contiguous nucleotides. Such lengths are
The term “variant may also refer either to a naturally occur exemplary only, and it is understood that any fragment length
ring variation of a given peptide or a recombinantly prepared Supported by the sequences shown herein, in the tables, fig
variation of a given peptide or protein in which one or more ures, or sequence listing, may be used to describe a length
amino acid residues have been modified by amino acid Sub over which percentage identity may be measured.
stitution, addition, or deletion. 0053. The phrases “percent identity” and “% identity”, as
0048 “Homology” refers to sequence similarity or, alter applied to polypeptide sequences, refer to the percentage of
natively, sequence identity, between two or more polynucle identical residue matches between at least two polypeptide
otide sequences or two or more polypeptide sequences. sequences aligned using a standardized algorithm. Methods
0049. The terms “percent identity” and “% identity,” as of polypeptide sequence alignment are well known. Some
applied to polynucleotide sequences, refer to the percentage alignment methods take into account conservative amino acid
of identical nucleotide matches between at least two poly Substitutions. Such conservative substitutions, explained in
nucleotide sequences aligned using a standardized algorithm. more detail above, generally preserve the charge and hydro
Such an algorithm may insert, in a standardized and repro phobicity at the site of substitution, thus preserving the struc
ducible way, gaps in the sequences being compared in order to ture (and therefore function) of the polypeptide. The phrases
optimize alignment between two sequences, and therefore "percent similarity” and “% similarity', as applied to
achieve a more meaningful comparison of the two sequences. polypeptide sequences, refer to the percentage of residue
0050 Percent identity between polynucleotide sequences matches, including identical residue matches and conserva
may be determined using one or more computer algorithms or tive Substitutions, between at least two polypeptide sequences
programs known in the art or described herein. For example, aligned using a standardized algorithm. In contrast, conser
percent identity can be determined using the default param vative substitutions are not included in the calculation of
eters of the CLUSTAL V algorithm as incorporated into the percent identity between polypeptide sequences.
US 2012/025 1502 A1 Oct. 4, 2012

0054 Percent identity between polypeptide sequences 10,000-fold. In another, the assembling ability of the attenu
may be determined using the default parameters of the ated hEbola virus is reduced. In another, the assembling abil
CLUSTAL V algorithm as incorporated into the MEGA ity of the attenuated virus is reduced by at least 5-fold,
LIGN version 3.12e sequence alignment program (described 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold,
and referenced above). For pairwise alignments of polypep 1,000-fold, or 10,000-fold. In another, the cytopathic effect of
tide sequences using CLUSTALV, the default parameters are the attenuated hEbola virus is reduced. In another, the cyto
set as follows: Ktuple=1, gap penalty-3, window=5, and pathic effect is reduced by at least 5-fold, 10-fold, 25-fold,
"diagonals saved’’=5. The PAM250 matrix is selected as the 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000
default residue weight table. fold.
0055 Alternatively the NCBI BLAST software suite may 0060. In another aspect, the invention provides the com
be used. For example, for a pairwise comparison of two plete genomic sequence of the hEbola virus EboBun or
polypeptide sequences, one may use the “BLAST 2 EboC. In a specific embodiment, the virus includes a nucle
Sequences” tool Version 2.0.12 (Apr. 21, 2000) with blastp otide sequence of SEQID NOs: 1 or 10, respectively.
set at default parameters. Such default parameters may be, for 0061. In a related aspect, the invention provides nucleic
example: Matrix: BLOSUM62; Open Gap: 11 and Extension acid molecules isolated from EboBun, EbolC, or fragments
Gap: 1 penalties; Gapxdrop-off:50: Expect: 10; Word Size: 3; thereof. In one embodiment of the present invention, the
Filter: on. isolated nucleic acid molecule includes the nucleotide
0056 Percent identity may be measured over the length of sequence of SEQID NOs: 1 or 10, or a complement thereof.
an entire defined polypeptide sequence, for example, as In another, the nucleic acid molecule includes a nucleotide
defined by a particular SEQID number, or may be measured sequence having at least 4, 5, 10, 15, 20, 25, 30.35, 40, 45, 50.
over a shorter length, for example, over the length of a frag 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500,
ment taken from a larger, defined polypeptide sequence, for 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500,
instance, a fragment of at least 15, at least 20, at least 30, at 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, or
least 40, at least 50, at least 70 or at least 150 contiguous 4900 contiguous nucleotides of the nucleotide sequence of
residues. Such lengths are exemplary only, and it is under SEQID NO: 1, or a complement thereof; with the proviso that
stood that any fragment length Supported by the sequences the nucleotide sequence is not comprised by the nucleotide
shown herein, in the tables, figures or sequence listing, may sequence set forth in SEQID NO:20 (Ebola Zaire nucleotide
be used to describe a length over which percentage identity sequence); or at least 5000, 5500, 5600, 5700, 5800, 5900,
may be measured. 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous
0057 The term "agent' encompasses any chemical, bio nucleotides of the nucleotide sequence of SEQID NOs: 1 or
chemical, or biological molecule. Such as Small molecules, 10, or a complement thereof. In another embodiment, the
proteins, polypeptides, antibodies, nucleic acid molecules isolated nucleic acid molecule includes a nucleotide sequence
including DNA or RNA, and the like. that encodes the EboBun amino acid sequence of SEQ ID
Methods and Compositions Related to the Inventive hEbola NOs: 2-9 or 59, the EbolCamino acid sequence of SEQ ID
0058. The present invention is based upon the isolation NOs: 11-19, or a complement of the nucleotide sequence that
and identification of a new human Ebola virus species, encodes the EboBunamino acid sequences of SEQID NOs:
EboBun and the sequencing of the only other known West 2-9 or 59 or the EbolCamino acid sequences of SEQID NOs:
African Ebola species EbolC. EboBun was isolated from the 11-19. In another, the isolated nucleic acid molecule hybrid
patients Suffering from hemorrhagic fever in a recent out izes under stringent conditions to a nucleic acid molecule
break in Uganda. The isolated virus is a member of the Filov having the nucleotide sequence of SEQID NOs: 1 or 10 or a
iridae family, a family of negative sense RNA viruses. complement thereof, wherein the nucleic acid molecule
Accordingly, the invention relates to the isolated EboBun or encodes an amino acid sequence which has a biological activ
EBOIC virus that morphologically and phylogenetically ity exhibited by a polypeptide encoded by the nucleotide
relates to known members filoviridae. sequence of SEQ ID NOs: 1 or 10. In another, nucleic acid
0059. In another aspect, the invention provides an isolated molecule is RNA. In another, nucleic acid molecule is DNA.
hEbola virus including a nucleic acid molecule with a nucle 0062. In another aspect, the invention provides proteins or
otide sequence that is preferably: a) a nucleotide sequence set polypeptides that are isolated from the EboBun, including
forth in SEQID NO: 1; b) a nucleotide sequence that hybrid viral proteins isolated from cells infected with the virus but
izes to the sequence set forth in SEQID NO: 1 understringent not present in comparable uninfected cells. In one embodi
conditions; or c) a nucleotide sequence that has at least 70%, ment of the present invention, the amino acid sequences of the
75%, 80%,85%, 90%, 95%,96%.97%.98%, or 99% identity proteins or polypeptides are set forth in SEQID NOS: 2-9, 59.
to the SEQ ID NO: 1. In one embodiment of the present or 11-19, or fragments thereof. In one embodiment, polypep
invention, the hEbola virus is killed. In another, the virus is tides or proteins of the present invention have a biological
attenuated. In another, the infectivity of the attenuated hEbola activity of the protein (including antigenicity and/or immu
virus is reduced. In another, the infectivity is reduced by at nogenicity) encoded by the sequence of SEQID NOs: 1 or 10.
least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, In another, the polypeptides or the proteins of the present
500-fold, or 10,000-fold. In another, the replication ability of invention have a biological activity of at least one protein
the attenuated hEbola virus is reduced. In another, the repli having the amino acid sequence (including antigenicity and/
cation ability of the attenuated virus is educed by at least or immunogenicity) set forth in SEQ ID NOS: 2-9, 59, or
5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500 11-19, or a fragment thereof.
fold, 1,000-fold, or 10,000-fold. In another, the protein syn 0063. In a related aspect, the invention provides an iso
thesis ability of the attenuated virus is reduced. In another, the lated polypeptide encoded by the nucleic acid molecule of the
protein synthesis ability is reduced by at least 5-fold, 10-fold, invention described above. In one embodiment of the present
25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or invention, the isolated polypeptide includes the amino acid
US 2012/025 1502 A1 Oct. 4, 2012

sequence selected from the group consisting of: a) an amino tion encoded by the nucleotide sequence of SEQID NOs: 1
acid sequence set forth in SEQID NO: 2, 3, 4, 5, 6, 7, 8, or 9: (EboBun) or 10 (EbolC), a fragment thereof, or encoded by a
11, 12, 13, 14, 15, 16, 17, 18 or 19; and b) an amino acid nucleic acid comprising a nucleotide sequence that hybrid
sequence that has 70%, 75%, 80%, 85%, 90%, 95%, 96%, izes under stringent conditions to the nucleotide sequence of
97%, 98%, or 99% homology to the amino acid sequence SEQ ID NOs: 1 (EboBun) or 10 (EbolC) and/or any hEbola
according to a). In another, the isolated polypeptide com EboBun epitope, having one or more biological activities of a
prises the amino acid sequence having at least 5, 10, 15, 20, polypeptide of the invention. These polypeptides include
25, 30, 35, 40, 45, 50, 60, 70, 80,90, 100, 150, 200, 210, 220, those shown in SEQID NOs: 2-9, 59, and 11-19. Such anti
230, 240 or 250 contiguous amino acid residues of the amino bodies include, but are not limited to, polyclonal, mono
acid sequence of SEQID NOs: 5 or 18 (VP24); 5, 10, 15, 20, clonal, bi-specific, multi-specific, human, humanized, chi
25, 30, 35, 40, 45, 50, 60, 70, 80,90, 100, 150, 200, 210, 220, meric antibodies, single chain antibodies, Fab fragments,
230, 240,250, 260,270, 280 contiguous amino acid residues F(ab') fragments, disulfide-linked FVs, intrabodies and frag
of the amino acid sequence of SEQID NOs: 6 or 17 (VP30): ments containing eitheraVL or VH domain or even a comple
5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80,90, 100, 150, mentary determining region (CDR) that specifically binds to
200, 250, 300, 310, or 320 contiguous amino acid residues of a polypeptide of the invention.
the amino acid sequence of SEQID NOs: 8 or 13 (VP40): 5, 0066. In other aspects, the invention provides methods for
10, 15, 20, 25, 30,35, 40, 45,50, 60, 70, 80,90, 100, 150, 200, detecting the presence, activity or expression of the hEbola
250, 300, 310,320, 330, or 340 contiguous amino acid resi virus of the invention in a biological material, such as cells,
dues of the amino acid sequence of SEQ ID NOs: 7 or 12 blood, saliva, urine, and so forth. The increased or decreased
(VP35); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80,90, activity or expression of the hEbola virus in a sample relative
100, 150, 200, 250, 300,310,320,330,340,350,360, or 370 to a control sample can be determined by contacting the
contiguous amino acid residues of the amino acid sequence of biological material with an agent which can detect directly or
SEQID NOs: 4 or 15 (SGP); 5, 10, 15, 20, 25, 30, 35, 40, 45, indirectly the presence, activity or expression of the hEbola
50, 60, 70, 80,90, 100,150, 200,250,300,310,320,330,340, virus. In one embodiment of the present invention, the detect
350,360, or 370 contiguous amino acid residues of the amino ing agents are the antibodies or nucleic acid molecules of the
acid sequence of SEQID NOs: 59 or 16 (SSGP);5, 10, 15, 20, present invention. Antibodies of the invention can also be
25, 30, 35, 40, 45, 50, 60, 70, 80,90, 100, 150, 200, 250, 300, used to treat hemorrhagic fever.
350, 400, 450, 450, 500, 550, 600, 610, 620, 630, 640, 650, 0067. In a related aspect, the invention provides a method
660, or 670 contiguous amino acid residues of the amino acid for detecting the presence of the inventive hEbola virus
sequence of SEQID NOs: 9 or 14 (GP); 5, 10, 15, 20, 25.30, described above in a biological sample, the method compris
35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300,350, ing: (a) contacting the sample with an agent that selectively
400, 450, 450, 500, 550, 600, 650, 700, 710, 720, or 730 binds to the hEbola virus; and (b) detecting whether the
contiguous amino acid residues of the amino acid sequence of compound binds to the hEbola virus in the sample. In one
SEQID NOs: 3 or 11 (NP); or 5, 10, 15, 20, 25, 30,35, 40, 45, embodiment of the present invention, the biological sample is
50, 60, 70, 80,90, 100,150, 200,250,300,350,400,450,450, selected from the group consisting of cells; blood; serum;
500, 550, 600, 650, 700, 750, 800, 850,900,950, 1000, 1050, plasma; feces; rectal, vaginal and conjunctival Swabs. In
1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, another, the agent that binds to the virus is an antibody. In
1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, another, the agent that binds to the virus is a nucleic acid
2100, 2150, 2160, 2170, 2180, 2190, or 2200 contiguous molecule comprising the nucleotide sequence of SEQID NO:
amino acid residues of the amino acid sequence of SEQ ID 1 or a complement thereof. In another, the agent that binds to
NOs: 2 or 19 (L). the virus is a nucleic acid molecule comprising a nucleotide
0064. In other aspects, the invention relates to the use of an sequence having at least 4, 5, 10, 15, 20, 25, 30.35, 40, 45, 50.
isolated West African hEbola virus for diagnostic and thera 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500,
peutic methods. In one embodiment, the invention provides a 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500,
method of detecting in a biological sample an antibody 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700,4800, 4900,
immunospecific for the hEbola virus using the inventive iso 5000, 5500, 5600,5700, 5800, 5900,6000, 6100,6200, 6300,
lated hEbola virus described herein, or any of the inventive 6400, 6500, or 6600 contiguous nucleotides of the nucleotide
proteins or polypeptides as described herein. In another spe sequence of SEQID NOs: 1 or 10, or a complement thereof.
cific embodiment, the invention provides a method of screen 0068. In another aspect, the invention provides a method
ing for an antibody which immunospecifically binds and neu for detecting the presence of the inventive polypeptide
tralizes hEbola EboBun or EboC or a combination thereof. described above, in a biological sample, the method compris
Such an antibody is useful for a passive immunization or ing: (a) contacting the biological sample with an agent that
immunotherapy of a subject infected with hEbola. selectively binds to the polypeptide; and (b) detecting
0065. In another aspect, the invention provides an isolated whether the agent binds to the polypeptide in the sample. In
antibody or an antigen-binding fragment thereof which one embodiment of the present invention, the biological
immunospecifically binds to a West African genus hEbola sample is selected from the group consisting of cells; blood;
virus of the invention described above, and illustratively serum; plasma; feces; rectal, vaginal and conjunctival Swabs.
including EboBun or EbolC. In one embodiment of the In another, the agent that binds to the polypeptide is an anti
present invention, the isolated antibody oran antigen-binding body or an antigen-binding fragment thereof.
fragment thereof neutralizes a West African genus hEbola 0069. In another aspect, the invention provides a method
virus. In another, the isolated antibody or an antigen-binding for detecting the presence of a first nucleic acid molecule
fragment thereof immunospecifically binds to the inventive derived from the inventive hEbola virus described above in a
polypeptide described above. The invention further provides biological sample, the method includes (a) contacting the
antibodies that specifically bind a polypeptide of the inven biological sample with an agent that selectively binds to the
US 2012/025 1502 A1 Oct. 4, 2012

nucleic acid; and (b) detecting whether the agent binds to the mulation comprising a therapeutically or prophylactically
nucleotide in the sample. In one embodiment of the present effective amount of a protein extract of the inventive hEbola
invention, the agent that binds to the first nucleic acid mol virus described above, or a Subunit thereof, and a pharmaceu
ecule is a second nucleic acid molecule comprising the nucle tically acceptable carrier. In another aspect, the invention
otide sequence of SEQID NO: 1 or a complement thereof. In provides a vaccine formulation comprising a therapeutically
another, the second nucleic acid molecule comprises at least or prophylactically effective amount of a nucleic acid mol
4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80,90, 100, 150, ecule comprising the nucleotide sequence of SEQID NOs: 1
200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 10, or a complement thereof, and a pharmaceutically
800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, acceptable carrier. In another, the invention provides a vac
4000, 4500, 4600,4700, 4800,4900, 5000, 5500,5600,5700, cine formulation comprising a therapeutically or prophylac
5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 tically effective amount of a nucleic acid molecule compris
contiguous nucleotides of the nucleotide sequence of SEQID ing any of inventive the nucleotide sequences as described
NOs: 1 or 10, or a complement thereof. above, or a complement thereof, and a pharmaceutically
0070. In another aspect, the invention provides a method acceptable carrier.
for propagating the hEbola virus in host cells comprising 0074. In yet another specific embodiment, the vaccine
infecting the host cells with an inventive isolated West Afri preparations of the present invention comprise a nucleic acid
can hEbola virus described above, culturing the host cells to or fragment of the hEbola virus, e.g., the virus having Acces
allow the virus to multiply, and harvesting the resulting viri sion No. 200706291, or nucleic acid molecules having the
ons. Also provided by the present invention are host cells sequence of SEQID NOs: 1 or 10, or a fragment thereof. In
infected with the inventive hEbola virus described above. In
another, the vaccine preparations comprise a polypeptide of
one embodiment of the present invention, the host cell is a the invention encoded by the nucleotide sequence of SEQID
primate cell. NOs: 1 or 10 or a fragment thereof. In a specific embodiment,
0071. In another aspect, the invention provides a method the vaccine preparations comprise polypeptides of the inven
of detecting in a biological sample the presence of an anti tion as shown in SEQID NOs: 2-9, 59, or 11-19, or encoded
body that immunospecifically binds hEbola virus, the method by the nucleotide sequence of SEQ ID NOs: 1 or 10, or a
includes: (a) contacting the biological sample with the inven fragment thereof.
tive host cell described above; and (b) detecting the antibody 0075. Furthermore, the present invention provides meth
bound to the cell.
ods for treating, ameliorating, managing or preventing hem
0072. In another aspect, the invention provides vaccine orrhagic fever by administering the vaccine preparations or
preparations, including the inventive hEbola virus, including antibodies of the present invention alone or in combination
recombinant and chimeric forms of the virus, nucleic acid with adjuvants, or other pharmaceutically acceptable excipi
molecules comprised by the virus, or protein subunits of the ents. Furthermore, the present invention provides methods for
virus. In one embodiment, the vaccine preparations of the treating, ameliorating, managing, or preventing hemorrhagic
present invention includes live but attenuated hEbola virus fever by administering the inventive compositions and for
with or without pharmaceutically acceptable carriers, includ mulations including the vaccine preparations orantibodies of
ing adjuvants. In another, the vaccine preparations of the the present invention alone or in combination with antivirals
invention comprise an inactivated or killed hEbola EboBun e.g., amantadine, rimantadine, gancyclovir, acyclovir, rib
virus, EboC virus, or a combination thereof, with or without avirin, penciclovir, oseltamivir, foScamet Zidovudine (AZT),
pharmaceutically acceptable carriers, including adjuvants. didanosine (ddI), lamivudine (3TC), zalcitabine (ddC), sta
Such attenuated or inactivated viruses may be prepared by a Vudine (d4T), nevirapine, delavirdine, indinavir, ritonavir,
series of passages of the virus through the host cells or by Vidarabine, nelfinavir, saquinavir, relenza, tamiflu, plecon
preparing recombinant or chimeric forms of virus. Accord aril, interferons, etc., Steroids and corticosteroids such as
ingly, the present invention further provides methods of pre prednisone, cortisone, fluticasone and glucocorticoid, antibi
paring recombinant or chimeric forms of the inventive hEbola otics, analgesics, bronchodilators, or other treatments for res
viruses described herein. piratory and/or viral infections.
0073. In another specific embodiment, the invention pro 0076. In a related aspect, the invention provides an immu
vides a vaccine formulation comprising a therapeutically or nogenic formulation comprising an immunogenically effec
prophylactically effective amount of the inventive hEbola tive amount of the inventive hEbola virus described above,
virus described above, and a pharmaceutically acceptable and a pharmaceutically acceptable carrier.
carrier. In another, the invention provides a vaccine formula 0077. In another related aspect, the invention provides an
tion comprising a therapeutically or prophylactically effec immunogenic formulation comprising an immunogenically
tive amount of a protein extract of the inventive hEbola virus effective amount of a protein extract of the inventive hEbola
described above, or a subunit thereof; and a pharmaceutically
acceptable carrier. In another aspect, the invention provides a virus described above or a subunit thereof, and a pharmaceu
vaccine formulation comprising a therapeutically or prophy tically acceptable carrier.
lactically effective amount of a nucleic acid molecule com 0078. In another related aspect, the invention provides an
prising the nucleotide sequence of SEQID NOs: 1 or 10, or a immunogenic formulation comprising an immunogenically
complement thereof, and a pharmaceutically acceptable car effective amount of a nucleic acid molecule comprising the
rier. In another, the invention provides a vaccine formulation nucleotide sequence of SEQ ID NOs: 1, 10, a combination
comprising a therapeutically or prophylactically effective thereof, or a complement thereof, and a pharmaceutically
amount of a nucleic acid molecule comprising any of inven acceptable carrier.
tive the nucleotide sequences as described above, or a 0079. In another related aspect, the invention provides an
complement thereof, and a pharmaceutically acceptable car immunogenic formulation comprising an immunogenically
rier. In another aspect, the invention provides a vaccine for effective amount of a nucleic acid molecule comprising the
US 2012/025 1502 A1 Oct. 4, 2012

inventive nucleotide sequence as described above or a SEQID NOs: 1 or 10, or a complement thereof, or at least a
complement thereof, and a pharmaceutically acceptable car portion of the nucleotide sequence thereof. In another specific
1. embodiment, the invention provides nucleic acid molecules
0080. In another related aspect, the invention provides an which are suitable for hybridization to the inventive hEbola
immunogenic formulation comprising an immunogenically nucleic acid; including, but not limited to PCR primers,
effective amount of any of the inventive polypeptides Reverse Transcriptase primers, probes for Southern analysis
described above. or other nucleic acid hybridization analysis for the detection
0081. In another aspect, the present invention provides of hEbola nucleic acids, e.g., consisting of or including the
pharmaceutical compositions comprising antiviral agents of nucleotide sequence of SEQ ID NOs: 1, 10 a combination
the present invention and a pharmaceutically acceptable car thereof, a complement thereof, or a portion thereof. The
rier. In a specific embodiment, the antiviral agent of the inven invention further encompasses chimeric or recombinant
tion is an antibody that immunospecifically binds hEbola viruses encoded in whole or in part by the nucleotide
virus or any hEbola epitope. In another specific embodiment, Sequences.
the antiviral agent is a polypeptide or protein of the present 0090. In another aspect, the present invention provides
invention or nucleic acid molecule of the invention. methods for Screening antiviral agents that inhibit the infec
0082 In a related aspect, the invention provides a pharma tivity or replication of hEbola virus or variants thereof.
ceutical composition comprising a prophylactically or thera 0091. The invention further provides methods of prepar
peutically effective amount of an anti-hEbola EboBun agent ing recombinant or chimeric forms of hEbola.
and a pharmaceutically acceptable carrier. In one embodi 0092. In another aspect, the invention provides vaccine
ment of the present invention, the anti-hEbola EboBun agent preparations including the hEbola virus, including recombi
is an antibody or an antigen-binding fragment thereof which nant and chimeric forms of the virus, or subunits of the virus.
immunospecifically binds to the hEbola virus of Deposit The present invention encompasses recombinant or chimeric
Accession No. 200706291, or polypeptides or protein derived viruses encoded by viral vectors derived from the genome of
therefrom. In another, the anti-hEbola agent is a nucleic acid the inventive hEbola virus described herein or natural variants
molecule comprising the nucleotide sequence of SEQ ID thereof. In a specific embodiment, a recombinant virus is one
NOs: 1, 10, a combination thereof, or a fragment thereof. In derived from the hEbola virus of Deposit Accession No.
another, the anti-hEbola agent is a polypeptide encoded by a 200706291. It is recognized that natural variants of the inven
nucleic acid molecule comprising the nucleotide sequence of tive hEbola viruses described herein comprise one or more
SEQ ID NOs: 1, 10, a combination thereof, or a fragment mutations, including, but not limited to, point mutations,
thereofhaving a biological activity of the polypeptide. rearrangements, insertions, deletions etc., to the genomic
0083. The invention also provides kits containing compo sequence. It is recognized that the mutations may or may not
sitions and formulations of the present invention. Thus, in result in a phenotypic change.
another aspect, the invention provides a kit comprising a 0093. In another specific embodiment, a chimeric virus of
container containing the inventive immunogenic formulation the invention is a recombinant hEbola EboBun or EboC virus
described above. which further comprises a heterologous nucleotide sequence.
0084. In another aspect, the invention provides a kit In accordance with the invention, a chimeric virus may be
includes a container containing the inventive vaccine formu encoded by a nucleotide sequence in which heterologous
lation described above. nucleotide sequences have been added to the genome or in
0085. In another aspect, the invention provides a kit which endogenous or native nucleotide sequences have been
including a container containing the inventive pharmaceuti replaced with heterologous nucleotide sequences.
cal composition described above. 0094. According to the present invention, the chimeric
I0086. In another aspect, the invention provides a kit viruses are encoded by the viral vectors of the invention
including a container containing the inventive vaccine formu which further comprise a heterologous nucleotide sequence.
lation described above. In accordance with the present invention a chimeric virus is
0087. In another aspect, the invention provides a method encoded by a viral vector that may or may not include nucleic
for identifying a subject infected with the inventive hEbola acids that are non-native to the viral genome. In accordance
virus described above, including: (a) obtaining total RNA with the invention a chimeric virus is encoded by a viral
from a biological sample obtained from the subject; (b) vector to which heterologous nucleotide sequences have been
reverse transcribing the total RNA to obtain cDNA; and (c) added, inserted or substituted for native or non-native
amplifying the cDNA using a set of primers derived from a sequences. In accordance with the present invention, the chi
nucleotide sequence of the inventive hEbola virus described meric virus may be encoded by nucleotide sequences derived
above. from different species or variants of hEbola virus. In particu
0088. In one embodiment of the present invention, the set lar, the chimeric virus is encoded by nucleotide sequences
of primers are derived from the nucleotide sequence of the that encode antigenic polypeptides derived from different
genome of the hEbola virus of Deposit Accession No. species or variants of hEbola virus.
200706291. In another, the set of primers are derived from the 0.095 A chimeric virus may be of particular use for the
nucleotide sequence of SEQ ID NOs: 1 or 10 or any of the generation of recombinant vaccines protecting against two or
inventive nucleotide sequences as described above, or a more viruses (Tao et al., J. Virol. 72,2955-2961: Durbinet al.,
complement thereof. 2000, J. Virol. 74, 6821-6831; Skiadopoulos et al., 1998, J.
0089. The invention further relates to the use of the Virol. 72, 1762-1768 (1998); Teng et al., 2000, J. Virol. 74,
sequence information of the isolated virus for diagnostic and 9317-9321). For example, it can be envisaged that a virus
therapeutic methods. In a specific embodiment, the invention vector derived from the hEbola virus expressing one or more
provides nucleic acid molecules which are suitable for use as proteins of variants of hEbola virus including hEbola
primers consisting of or including the nucleotide sequence of EboBun, or vice versa, will protect a subject vaccinated with
US 2012/025 1502 A1 Oct. 4, 2012

such vector against infections by both the native hEbola and viral vectors containing the polymerase components of
the variant. Attenuated and replication-defective viruses may hEbola virus are generated in prokaryotic cells for the expres
be of use for vaccination purposes with live vaccines as has sion of the components in relevant cell types (bacteria, insect
been suggested for other viruses. (See, for example, PCTWO cells, eukaryotic cells). Plasmid or viral vectors containing
02/057302, at pp. 6 and 23; and United States Patent Appli full-length or partial copies of the hEbola genome will be
cation Publication 2008/0069838 incorporated by reference generated in prokaryotic cells for the expression of viral
herein). nucleic acids in vitro or in vivo. The latter vectors optionally
0096. In accordance with the present invention the heter contain other viral sequences for the generation of chimeric
ologous sequence to be incorporated into the viral vectors viruses or chimeric virus proteins, optionally lack parts of the
encoding the recombinant or chimeric viruses of the inven viral genome for the generation of replication defective virus,
tion include sequences obtained or derived from different and optionally contain mutations, deletions or insertions for
species or variants of hEbola. the generation of attenuated viruses. In addition, the present
0097. In certain embodiments, the chimeric or recombi invention provides a host cell infected with hEbola virus of
nant viruses of the invention are encoded by viral vectors Deposit Accession No. 200706291,
derived from viral genomes wherein one or more sequences, 0103) Infectious copies of West African hEbola (being
intergenic regions, termini sequences, or portions or entire wild type, attenuated, replication-defective or chimeric) are
ORF have been substituted with a heterologous or non-native optionally produced upon co-expression of the polymerase
sequence. In certain embodiments of the invention, the chi components according to the state-of-the-art technologies
meric viruses of the invention are encoded by viral vectors described above.
derived from viral genomes wherein one or more heterolo 0104. In addition, eukaryotic cells, transiently or stably
gous sequences have been inserted or added to the vector. expressing one or more full-length or partial hEbola proteins
0098. The selection of the viral vector may depend on the are optionally used. Such cells are preferably made by trans
species of the subject that is to be treated or protected from a fection (proteins or nucleic acid vectors), infection (viral
viral infection. If the Subject is human, then an attenuated vectors) or transduction (viral vectors) and are useful for
hEbola virus can be used to provide the antigenic sequences. complementation of mentioned wild type, attenuated, repli
0099. In accordance with the present invention, the viral cation-defective or chimeric viruses.
vectors can be engineered to provide antigenic sequences 0105. The viral vectors and chimeric viruses of the present
which confer protection against infection by the inventive invention optionally modulate a subject's immune system by
hEbola and natural variants thereof. The viral vectors may be stimulating a humoral immune response, a cellular immune
engineered to provide one, two, three or more antigenic response or by stimulating tolerance to an antigen. As used
sequences. In accordance with the present invention the anti herein, a Subject means: humans, primates, horses, cows,
genic sequences may be derived from the same virus, from sheep, pigs, goats, dogs, cats, avian species and rodents.
different species or variants of the same type of virus, or from Formulation of Vaccines and Antivirals
different viruses.
0100. The expression products and/or recombinant or chi 0106. In a preferred embodiment, the invention provides a
meric virions obtained in accordance with the invention may proteinaceous molecule or hEbola virus specific viral protein
advantageously be utilized in vaccine formulations. The or functional fragment thereof encoded by a nucleic acid
expression products and chimeric virions of the present according to the invention. Useful proteinaceous molecules
invention may be engineered to create vaccines against a are for example derived from any of the genes or genomic
broad range of pathogens, including viral and bacterial anti fragments derivable from the virus according to the invention,
gens, tumor antigens, allergen antigens, and auto antigens preferably the GP, L, NP, sGP VP24, VP30, VP35, and VP40
involved in autoimmune disorders. One way to achieve this proteins described herein. Such molecules, or antigenic frag
goal involves modifying existing hEbola genes to contain ments thereof, as provided herein, are for example useful in
foreign sequences in their respective external domains. diagnostic methods or kits and in pharmaceutical composi
Where the heterologous sequences are epitopes orantigens of tions such as Subunit vaccines. Particularly useful are
pathogens, these chimeric viruses may be used to induce a polypeptides encoded by the nucleotide sequence of SEQID
protective immune response against the disease agent from NOs: 1 or 10; or antigenic fragments thereof for inclusion as
which these determinants are derived. In particular, the chi antigen or subunit immunogen, but inactivated whole virus
meric virions of the present invention may be engineered to can also be used. Particularly useful are also those proteina
create vaccines for the protection of a subject from infections ceous Substances that are encoded by recombinant nucleic
with hEbola virus and variants thereof. acid fragments of the hEbola genome, of course preferred are
0101 Thus, the present invention further relates to the use those that are within the preferred bounds and metes of ORFs,
of viral vectors and recombinant or chimeric viruses to for in particular, for eliciting hEbola specific antibody or T cell
mulate vaccines against a broad range of viruses and/or anti responses, whether in vivo (e.g. for protective or therapeutic
gens. The present invention also encompasses recombinant purposes or for providing diagnostic antibodies) or in vitro
viruses including a viral vector derived from the hEbola or (e.g. by phage display technology or another technique useful
variants thereof which contains sequences which result in a for generating synthetic antibodies).
virus having a phenotype more Suitable for use in vaccine 0107. It is recognized that numerous variants, analogues,
formulations, e.g., attenuated phenotype or enhanced antige or homologues of EboBun polypeptides are within the scope
nicity. The mutations and modifications can be in coding of the present invention including amino acid Substitutions,
regions, in intergenic regions and in the leader and trailer alterations, modifications, or other amino acid changes that
sequences of the virus. increase, decrease, or do not alter the function or immuno
0102 The invention provides a host cell including a genic propensity of the inventive immunogen or vaccine.
nucleic acid or a vector according to the invention. Plasmidor Several post-translational modifications are similarly envi
US 2012/025 1502 A1 Oct. 4, 2012

Sioned as within the scope of the present invention illustra indices are within +2 is preferred, those within +1 are par
tively including incorporation of a non-naturally occurring ticularly preferred, and those within +0.5 are even more par
amino acid(s), phosphorylation, glycosylation, Sulfation, and ticularly preferred.
addition of pendent groups such as biotynlation, fluoro 0113. As outlined above, amino acid substitutions are gen
phores, lumiphores, radioactive groups, antigens, or other erally based on the relative similarity of the amino acid side
molecules. chain substituents, for example, their hydrophobicity, hydro
0108 Methods of expressing and purifying natural or philicity, charge, size, and the like. Exemplary Substitutions
recombinant peptides and proteins are well known in the art. that take various of the foregoing characteristics into consid
Illustratively, peptides and proteins are recombinantly eration are well known to those of skill in the art and include
expressed in eukaryotic cells. Exemplary eukaryotic cells (original residue: exemplary Substitution): (Ala: Gly, Ser),
include yeast, HeLa cells, 293 cells, COS cells, Chinese ham (Arg: Lys), (ASn: Gln, His), (Asp: Glu, Cys, Ser), (Gln: ASn),
ster ovary cells (CHO), and many other cell types known in (Glu: Asp), (Gly: Ala), (His: Asn., Gln), (Ile: Leu, Val), (Leu:
the art. Both eukaryotic and prokaryotic expression systems Ile, Val), (Lys: Arg), (Met: Leu, Tyr), (Ser: Thr), (Thr: Ser),
and cells are available illustratively from Invitrogen Corp., (Tip: Tyr), (Tyr: Trp, Phe), and (Val: Ile, Leu). Embodiments
Carlsbad, Calif. It is appreciated that cell-free expression of this disclosure thus contemplate functional or biological
systems are similarly operable. equivalents of a polypeptide and immunogen as set forth
0109. In a preferred embodiment an immunogenic above. In particular, embodiments of the polypeptides and
polypeptide is a full length EboBun protein. Preferably, an immunogens optionally include variants having about 50%,
immunogen is a full length EboBun protein of SEQID NOs: 60%, 70%, 80%, 90%, and 95% sequence identity to the
2-9 or 59, or EbolC SEQ ID NOs: 11-19, or a fragment polypeptide of interest.
thereofas described herein. Preferably, an immunogen is has 0114. The invention provides vaccine formulations for the
a minimum of 5 amino acids. As used herein an immunogen prevention and treatment of infections with hEbola virus. In
is preferably a polypeptide. In the context of an immunogenic certain embodiments, the vaccine of the invention comprises
polypeptide the terms immunogen, polypeptide, and antigen recombinant and chimeric viruses of the hEbola virus. In
are used interchangeably. certain embodiments, the virus is attenuated.
0110 Modifications and changes can be made in the struc 0.115. In another embodiment of this aspect of the inven
ture of the inventive immunogens that are the subject of the tion, inactivated vaccine formulations are prepared using con
application and still obtain a molecule having similar or ventional techniques to “kill the chimeric viruses. Inacti
improved characteristics as the Wild-type sequence (e.g., a vated vaccines are "dead” in the sense that their infectivity has
conservative amino acid Substitution). For example, certain been destroyed. Ideally, the infectivity of the virus is
amino acids are optionally Substituted for other amino acids destroyed without affecting its immunogenicity. In order to
in a sequence without appreciable loss of immunogenic activ prepare inactivated vaccines, the chimeric virus may be
ity. Because it is the interactive capacity and nature of a grown in cell culture or in the allantois of the chick embryo,
polypeptide that defines that polypeptide's biological func purified by Zonal ultracentrifugation, inactivated by formal
tional activity, certain amino acid sequence Substitutions can dehyde or B-propiolactone, and pooled. The resulting vaccine
be made in a polypeptide sequence and nevertheless obtain a is usually inoculated intramuscularly or intranasally.
polypeptide with like or improved properties. Optionally, a 0116 Inactivated viruses are optionally formulated with a
polypeptide is used that has less or more immunogenic activ Suitable adjuvant in order to enhance the immunological
ity compared to the wild-type sequence. response. Such adjuvants illustratively include but are not
0111. In making Such changes, the hydropathic index of limited to mineral gels, e.g., aluminum hydroxide; Surface
amino acids is preferably considered. The importance of the active Substances Such as lysolecithin, pluronic polyols,
hydropathic amino acid index in conferring interactive bio polyanions; peptides; oil emulsions; and potentially useful
logic function on a polypeptide is generally understood in the human adjuvants such as BCG and Corynebacterium par
art. It is known that certain amino acids can be substituted for iFi.
otheramino acids having a similar hydropathic index or score 0117. In another aspect, the present invention also pro
and still result in a polypeptide with similar biological activ vides DNA vaccine formulations including a nucleic acid or
ity. Each amino acid has been assigned a hydropathic index on fragment of the inventive hEbola virus, e.g., the virus having
the basis of its hydrophobicity and charge characteristics. Accession No. 200706291, or nucleic acid molecules having
Those indices are: isoleucine (+4.5); Valine (+4.2); leucine the sequence of SEQID NOs: 1 or 10, or a fragment thereof.
(+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5); In another specific embodiment, the DNA vaccine formula
methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine tions of the present invention comprise a nucleic acid or
(-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); pro fragment thereof encoding the antibodies which immunospe
line (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3. cifically bind hEbola viruses. In DNA vaccine formulations,
5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and a vaccine DNA comprises a viral vector, such as that derived
arginine (-4.5). from the hEbola virus, bacterial plasmid, or other expression
0112. It is believed that the relative hydropathic character vector, bearing an insert including a nucleic acid molecule of
of the amino acid determines the secondary structure of the the present invention operably linked to one or more control
resultant polypeptide, which in turn defines the interaction of elements, thereby allowing expression of the vaccinating pro
the polypeptide with other molecules. Such as enzymes, Sub teins encoded by the nucleic acid molecule in a vaccinated
strates, receptors, antibodies, antigens, and the like. It is subject. Such vectors can be prepared by recombinant DNA
known in the art that an amino acid can be substituted by technology as recombinant or chimeric viral vectors carrying
another amino acid having a similar hydropathic index and a nucleic acid molecule of the present invention.
still obtain a functionally equivalent immunogen. In Such 0118. A nucleic acid as used herein refers to single- or
changes, the Substitution of amino acids whose hydropathic double-stranded molecules which are optionally DNA,
US 2012/025 1502 A1 Oct. 4, 2012

including the nucleotide bases A, T, C and G, or RNA, includ pares an expression vector that comprises a polynucleotide
ing the bases A, U (substitutes for T), C, and G. The nucleic under the control of one or more promoters. To bring a coding
acid may represent a coding strand or its complement. sequence “under the control of a promoter, one positions the
Nucleic acids are optionally identical in sequence to the 5' end of the translational initiation site of the reading frame
sequence which is naturally occurring or include alternative generally between about 1 and 50 nucleotides “downstream”
codons which encode the same amino acid as that which is of (i.e., 3' of) the chosen promoter. The “upstream” promoter
found in the naturally occurring sequence. Furthermore, stimulates transcription of the inserted DNA and promotes
nucleic acids optionally include codons which represent con expression of the encoded recombinant protein. This is the
servative Substitutions of amino acids as are well known in the meaning of “recombinant expression' in the context used
art here.
0119. As used herein, the term "isolated nucleic acid” 0.124 Many standard techniques are available to construct
means a nucleic acid separated or Substantially free from at expression vectors containing the appropriate nucleic acids
least Some of the other components of the naturally occurring and transcriptional/translational control sequences in order to
organism, for example, the cell structural components com achieve protein or peptide expression in a variety of host
monly found associated with nucleic acids in a cellular envi expression systems. Cell types available for expression
ronment and/or other nucleic acids. The isolation of nucleic include, but are not limited to, bacteria, such as E. coli and B.
acids is illustratively accomplished by techniques such as cell subtilis transformed with recombinant phage DNA, plasmid
lysis followed by phenol plus chloroform extraction, fol DNA or cosmid DNA expression vectors.
lowed by ethanol precipitation of the nucleic acids. The 0.125 Certain examples of prokaryotic hosts illustratively
nucleic acids of this invention are illustratively isolated from include E. coli strain RR1, E. coli LE392, E. coli B, E. coli
cells according to methods well known in the art for isolating 1776 (ATCC No. 3 1537) as well as E. coli W3110 (F-
nucleic acids. Alternatively, the nucleic acids of the present lambda-, prototrophic, ATCC No. 273325); bacilli such as
invention are optionally synthesized according to standard Bacillus subtilis; and other enterobacteria such as Salmonella
protocols well described in the literature for synthesizing typhimurium, Serratia marcescens, and various Pseudomo
nucleic acids. Modifications to the nucleic acids of the inven
tion are also contemplated, provided that the essential struc nas species.
ture and function of the peptide or polypeptide encoded by the 0.126 In general, plasmid vectors containing replicon and
nucleic acid are maintained. control sequences that are derived from species compatible
with the host cell are used in connection with these hosts. The
0120. The nucleic acid encoding the peptide or polypep vector ordinarily carries a replication site, as well as marking
tide of this invention is optionally part of a recombinant sequences that are capable of providing phenotypic selection
nucleic acid construct comprising any combination of restric
tion sites and/or functional elements as are well known in the in transformed cells. For example, E. coli is often transformed
art which facilitate molecular cloning and other recombinant using pBR322, a plasmid derived from an E. coli species.
DNA manipulations. Thus, the present invention further pro Plasmid pl3R322 contains genes for ampicillin and tetracy
vides a recombinant nucleic acid construct including a cline resistance and thus provides easy means for identifying
nucleic acid encoding a polypeptide of this invention. transformed cells. The pEBR322 plasmid, or other microbial
0121 Generally, it may be more convenient to employ as plasmid orphage may also contain, or be modified to contain,
the recombinant polynucleotide a cDNA version of the poly promoters that can be used by the microbial organism for
nucleotide. It is believed that the use of a cDNA version will expression of its own proteins.
provide advantages in that the size of the gene will generally 0127. In addition, phage vectors containing replicon and
be much smaller and more readily employed to transfect the control sequences that are compatible with the host microor
targeted cell than will agenomic gene, which will typically be ganism are optionally used as transforming vectors in con
up to an order of magnitude larger than the cDNA gene. nection with these hosts. For example, the phage lambda is
However, the inventor does not exclude the possibility of optionally utilized in making a recombinant phage vector that
employing a genomic version of a particular gene where can be used to transform host cells, such as E. coli LE392.
desired. I0128. Further useful vectors include plN vectors and
0122. As used herein, the terms “engineered” and “recom pGEX vectors, for use in generating glutathione S-transferase
binant cells are synonymous with “host cells and are (GST) soluble fusion proteins for later purification and sepa
intended to refer to a cell into which an exogenous DNA ration or cleavage. Other Suitable fusion proteins are those
segment or gene. Such as a cDNA or gene has been intro with B-galactosidase, ubiquitin, or the like.
duced. Therefore, engineered cells are distinguishable from I0129. Promoters that are most commonly used in recom
naturally occurring cells which do not contain a recombi binant DNA construction include the B-lactamase (penicilli
nantly introduced exogenous DNA segment or gene. A host nase), lactose and tryptophan (trp) promoter systems. While
cell is optionally a naturally occurring cell that is transformed these are the most commonly used, other microbial promoters
with an exogenous DNA segment or gene or a cell that is not have been discovered and utilized, and details concerning
modified. A host cell preferably does not possess a naturally their nucleotide sequences have been published, enabling
occurring gene encoding RSV G protein. Engineered cells those of skill in the art to ligate them functionally with plas
are, thus, cells having a gene or genes introduced through the mid vectors.
hand of man. Recombinant cells illustratively include those 0.130 For expression in Saccharomyces, the plasmid
having an introduced cDNA or genomic DNA, and also YRp7, for example, is commonly used. This plasmid contains
include genes positioned adjacent to a promoter not naturally the trp1 gene, which provides a selection marker for a mutant
associated with the particular introduced gene. strain of yeast lacking the ability to grow in tryptophan, for
0123 To express a recombinant encoded polypeptide in example ATCC No. 44076 or PEP4-1. The presence of the
accordance with the present invention one optionally pre trp 1 lesion as a characteristic of the yeast host cell genome
US 2012/025 1502 A1 Oct. 4, 2012

then provides an effective environment for detecting transfor tion is preferably provided either by construction of the vector
mation by growth in the absence of tryptophan. to include an exogenous origin, Such as may be derived from
0131 Suitable promoting sequences in yeast vectors illus SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV)
tratively include the promoters for 3-phosphoglycerate source, or may be provided by the host cell chromosomal
kinase or other glycolytic enzymes, such as enolase, glycer replication mechanism. If the vector is integrated into the host
aldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate cell chromosome, the latter is often sufficient.
decarboxylase, phosphofructokinase, glucose-6-phosphate 0.137 The promoters are optionally derived from the
isomerase, 3-phosphoglycerate mutase, pyruvate kinase, tri genome of mammalian cells (e.g., metallothionein promoter)
osephosphate isomerase, phosphoglucose isomerase, and or from mammalian viruses (e.g., the adenovirus late pro
glucokinase. In constructing Suitable expression plasmids, moter; the vaccinia virus 7.5K promoter). Further, it is also
the termination sequences associated with these genes are possible, and may be desirable, to utilize promoter or control
also preferably ligated into the expression vector 3' of the sequences normally associated with the desired gene
sequence desired to be expressed to provide polyadenylation sequence, provided Such control sequences are compatible
of the mRNA and termination. with the host cell systems.
0.132. Other suitable promoters, which have the additional 0.138 A number of viral based expression systems are
advantage of transcription controlled by growth conditions, operable herein, for example, commonly used promoters are
illustratively include the promoter region for alcohol dehy derived from polyoma, Adenovirus 2, Adenovirus 5, cytome
drogenase 2, isocytochrome C, acid phosphatase, degradative galovirus and Simian Virus 40 (SV40). The early and late
enzymes associated with nitrogen metabolism, and the afore promoters of SV40 virus are useful because both are obtained
mentioned glyceraldehyde-3-phosphate dehydrogenase, and easily from the virus as a fragment which also contains the
enzymes responsible for maltose and galactose utilization. SV40 viral origin of replication. Smaller or larger SV40 frag
0133. In addition to microorganisms, cultures of cells ments are also operable, particularly when there is included
derived from multicellular organisms are also operable as the approximately 250 bp sequence extending from the Hin
hosts. In principle, any such cell culture is operable, whether dIII site toward the BglI site located in the viral origin of
from vertebrate or invertebrate culture. In addition to mam replication.
malian cells, these include insect cell systems infected with 0.139. In cases where an adenovirus is used as an expres
recombinant virus expression vectors (e.g., baculovirus); and sion vector, the coding sequences are preferably ligated to an
plant cell Systems infected with recombinant virus expression adenovirus transcription/translation control complex, e.g.,
vectors (e.g., cauliflower mosaic virus, CaMV; tobacco the late promoter and tripartite leader sequence. This chi
mosaic virus, TMV) or transformed with recombinant plas meric gene is then optionally inserted in the adenovirus
mid expression vectors (e.g., Ti plasmid) containing one or genome by in vitro or in Vivo recombination. Insertion in a
more coding sequences. non-essential region of the viral genome (e.g., region E1 or
0134. In a useful insect system, Autographica Californica E3) will result in a recombinant virus that is viable and
nuclear polyhedrosis virus (AcNPV) is used as a vector to capable of expressing proteins in infected hosts.
express foreign genes. The virus grows in Spodoptera fru 0140 Specific initiation signals may also be required for
giperda cells. The isolated nucleic acid coding sequences are efficient translation of the claimed isolated nucleic acid cod
cloned into non-essential regions (for example the polyhe ing sequences. These signals include the ATG initiation
dron gene) of the virus and placed under control of an AcNPV codon and adjacent sequences. Exogenous translational con
promoter (for example, the polyhedron promoter). Successful trol signals, including the ATG initiation codon, may addi
insertion of the coding sequences results in the inactivation of tionally need to be provided. One of ordinary skill in the art
the polyhedron gene and production of non-occluded recom would readily be capable of determining this need and pro
binant virus (i.e., virus lacking the proteinaceous coat coded viding the necessary signals. It is well known that the initia
for by the polyhedron gene). These recombinant viruses are tion codon must be in-frame (or in-phase) with the reading
then used to infect Spodoptera frugiperda cells in which the frame of the desired coding sequence to ensure translation of
inserted gene is expressed (e.g., U.S. Pat. No. 4,215,051). the entire insert. These exogenous translational control sig
0135 Examples of useful mammalian host cell lines nals and initiation codons are optionally of a variety of ori
include VERO and HeLa cells, Chinese hamster ovary (CHO) gins, both natural and synthetic. The efficiency of expression
cell lines, W138, BHK, COS-7, 293, HepG2, NIH3T3, RIN is optionally enhanced by the inclusion of appropriate tran
and MDCK cell lines. In addition, a host cell is preferably Scription enhancer elements or transcription terminators.
chosen that modulates the expression of the inserted 0.141. In eukaryotic expression, one will also typically
sequences, or modifies and processes the gene product in the desire to incorporate into the transcriptional unit an appropri
specific fashion desired. Such modifications (e.g., glycosyla ate polyadenylation site if one was not contained within the
tion) and processing (e.g., cleavage) of protein products may original cloned segment. Typically, the poly Aaddition site is
be important for the function of the encoded protein. placed about 30 to 2000 nucleotides “downstream” of the
0136. Different host cells have characteristic and specific termination site of the protein at a position prior to transcrip
mechanisms for the post-translational processing and modi tion termination.
fication of proteins. Appropriate cell lines or host systems are 0.142 For long-term, high-yield production of recombi
preferably chosen to ensure the correct modification and pro nant proteins, stable expression is preferred. For example,
cessing of the foreign protein expressed. Expression vectors cell lines that stably express constructs encoding proteins are
for use in mammalian cells ordinarily include an origin of engineered. Rather than using expression vectors that contain
replication (as necessary), a promoter located in front of the viral origins of replication, host cells are preferably trans
gene to be expressed, along with any necessary ribosome formed with vectors controlled by appropriate expression
binding sites, RNA splice sites, polyadenylation site, and control elements (e.g., promoter, enhancer, sequences, tran
transcriptional terminator sequences. The origin of replica Scription terminators, polyadenylation sites, etc.), and a
US 2012/025 1502 A1 Oct. 4, 2012

selectable marker. Following the introduction of foreign HIV virus (Wang, B. et al., 1993, Gene inoculation generates
DNA, engineered cells may be allowed to grow for 1-2 days immune responses against human immunodeficiency virus
in an enriched medium, and then are Switched to a selective type 1, Proc. Natl. Acad. Sci. USA 90:4156-4160: Lu, S. et
medium. The selectable marker in the recombinant plasmid al., 1996, Simian immunodeficiency virus DNA vaccine trial
confers resistance to the selection and allows cells to stably in Macques, J. Virol. 70:3978-3991; Letvin, N. L. et al., 1997,
integrate the plasmid into their chromosomes and grow to Potent, protective anti-HIV immune responses generated by
form foci, which in turn can be cloned and expanded into cell bimodal HIV envelope DNA plus protein vaccination, Proc
lines. Natl Acad Sci USA. 94(17):9378-83), and influenza viruses
0143 A number of selection systems are illustratively (Robinson, H L et al., 1993, Protection against a lethal influ
used, including, but not limited, to the herpes simplex virus enza virus challenge by immunization with a haemaggluti
thymidine kinase, hypoxanthine-guanine phosphoribosyl nin-expressing plasmid DNA, Vaccine 11:957-960: Ulmer, J.
transferase and adenine phosphoribosyltransferase genes, in B. et al., Heterologous protection against influenza by injec
tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite tion of DNA encoding a viral protein, Science 259:1745
resistance is optionally used as the basis of selection for dhfr. 1749), as well as bacterial infections, such as tuberculosis
which confers resistance to methotrexate; gpt, which confers (Tascon, R. E. et al., 1996, Vaccination against tuberculosis
resistance to mycophenolic acid; neo, which confers resis by DNA injection, Nature Med. 2:888-892; Huygen, K. et al.,
tance to the aminoglycoside G-418; and hygro, which confers 1996, Immunogenicity and protective efficacy of a tubercu
resistance to hygromycin. It is appreciated that numerous losis DNA vaccine, Nature Med., 2:893-898), and parasitic
other selection systems are known in the art that are similarly infection, such as malaria (Sedegah, M., 1994, Protection
operable in the present invention. against malaria by immunization with plasmid DNA encod
0144. The nucleic acids encoding the peptides and ing circumsporozoite protein, Proc. Natl. Acad. Sci. USA
polypeptides of this invention are optionally administered as 91:9866-9870: Doolan, D. L. et al., 1996, Circumventing
nucleic acid vaccines. For the purposes of vaccine delivery, a genetic restriction of protection against malaria with multi
nucleic acid encoding a peptide or polypeptide of this inven gene DNA immunization: CD8+ T cell-interferon.delta., and
tion is preferably in an expression vector that includes viral nitric oxide-dependent immunity, J. Exper. Med., 1183:1739
nucleic acid including, but not limited to, vaccinia virus, 1746).
adenovirus, retrovirus and/or adeno-associated virus nucleic 0147 Many methods are optionally used to introduce the
acid. The nucleic acid or vector of this invention is optionally vaccine formulations described above. These include, but are
in a liposome or a delivery vehicle which can be taken up by not limited to, oral, intradermal, intramuscular, intraperito
a cell via receptor-mediated or other type of endocytosis. The neal, intravenous, Subcutaneous, and intranasal routes. Alter
nucleic acid vaccines of this invention are preferably in a natively, in a preferred embodiment the chimeric virus vac
pharmaceutically acceptable carrier or administered with an cine formulation is introduced via the natural route of
adjuvant. The nucleic acids encoding the peptides and infection of the pathogen for which the vaccine is designed.
polypeptides of this invention can also be administered to The DNA vaccines of the present invention are optionally
cells in vivo or ex vivo. administered in Saline Solutions by injections into muscle or
0145. It is contemplated that the isolated nucleic acids of skin using a syringe and needle (Wolff J. A. et al., 1990, Direct
the disclosure are optionally "overexpressed’, i.e., expressed gene transfer into mouse muscle in vivo, Science 247: 1465
in increased levels relative to its natural expression in cells of 1468; Raz, E., 1994, Intradermal gene immunization: The
its indigenous organism, or even relative to the expression of possible role of DNA uptake in the induction of cellular
other proteins in the recombinant host cell. Such overexpres immunity to viruses, c. Natl. Acd. Sci. USA 91:9519-9523).
sion is assessed by a variety of methods illustratively includ Another way to administer DNA vaccines operable herein is
ing radio-labeling and/or protein purification. However, called the 'gene gun' method, whereby microscopic gold
simple and direct methods are preferred, for example, those beads coated with the DNA molecules of interest is fired into
involving SDS/PAGE and protein staining or immunoblot cells (Tang, D. et al., 1992, Genetic immunization is a simple
ting, followed by quantitative analyses. Such as densitometric method for eliciting an immune response, Nature 356:152
scanning of the resultant gel or blot. A specific increase in the 154). For general reviews of the methods for DNA vaccines,
level of the recombinant protein or peptide in comparison to see Robinson, H. L., 1999, DNA vaccines: basic mechanism
the level in natural in transfected cells is indicative of over and immune responses (Review), Int. J. Mol. Med. 4(5):549
expression, as is a relative abundance of the specific protein in 555; Barber, B., 1997, Introduction: Emerging vaccine strat
relation to the other proteins produced by the host cell and, egies, Seminars in Immunology 9(5):269-270; and Robinson,
e.g., visible on a gel. H. L. et al., 1997, DNA vaccines, Seminars in Immunology
0146 Various heterologous vectors are described for 9(5):271-283.
DNA vaccinations against viral infections. For example, the Attenuation of hEbola Virus or Variants. Thereof
vectors described in the following references, incorporated 0.148. The hEbola virus or variants thereof of the invention
herein by reference, may be used to express hEbola sequences are optionally genetically engineered to exhibit an attenuated
instead of the sequences of the viruses or other pathogens phenotype. In particular, the viruses of the invention exhibit
described; in particular, vectors described for hepatitis B an attenuated phenotype in a subject to which the virus is
virus (Michel, M. L. et al., 1995, DAN-mediated immuniza administered as a vaccine. Attenuation can be achieved by
tion to the hepatitis B Surface antigen in mice: Aspects of the any method known to a skilled artisan. Without being bound
humoral response mimic hepatitis B viral infection in by theory, the attenuated phenotype of the viruses of the
humans, Proc. Natl. Aca. Sci. USA 92:5307-5311; Davis, H. invention is caused, e.g., by using a virus that naturally does
L. et al., 1993, DNA-based immunization induces continuous not replicate well in an intended host species, for example, by
secretion of hepatitis B Surface antigen and high levels of reduced replication of the viral genome, by reduced ability of
circulating antibody, Human Molec. Genetics 2:1847-1851), the virus to infect a host cell, or by reduced ability of the viral
US 2012/025 1502 A1 Oct. 4, 2012

proteins to assemble to an infectious viral particle relative to same efficiency as the wild type hEbola. In other embodi
the wild type species of the virus. ments, the ability of the attenuated virus to cause viral pro
014.9 The attenuated phenotypes of hEbola virus or vari teins to be inserted into the cytoplasmic membrane into the
ants thereofare optionally tested by any method known to the host cell is reduced compared to the wildtype virus. In certain
artisan. A candidate virus, for example, is optionally tested embodiments, the ability of the attenuated hEbola virus to
for its ability to infect a host or for the rate of replication in a replicate in the host is reduced compared to the wild type
cell culture system. In certain embodiments, growth curves at virus. Any technique known to the skilled artisan can be used
different temperatures are used to test the attenuated pheno to determine whether a virus is capable of infecting a mam
type of the virus. For example, an attenuated virus is able to malian cell, of replicating within the host, and of causing viral
grow at 35°C., but not at 39° C. or 40°C. In certain embodi proteins to be inserted into the cytoplasmic membrane of the
ments, different cell lines are used to evaluate the attenuated host.
phenotype of the virus. For example, an attenuated virus may 0154. In certain embodiments, the attenuated virus of the
only be able to grow in monkey cell lines but not the human invention is capable of infecting a host. In contrast to the wild
cell lines, or the achievable virus titers in different cell lines type hEbola, however, the attenuated hEbola cannot be rep
are different for the attenuated virus. In certain embodiments, licated in the host. In a specific embodiment, the attenuated
viral replication in the respiratory tract of a small animal hEbola virus can infect a host and can cause the host to insert
model, including but not limited to, hamsters, cotton rats, viral proteins in its cytoplasmic membranes, but the attenu
mice and guinea pigs, is used to evaluate the attenuated phe ated virus is incapable of being replicated in the host. Any
notypes of the virus. In other embodiments, the immune method known to the skilled artisan can be used to test
response induced by the virus, including but not limited to, whether the attenuated hEbola has infected the host and has
the antibody titers (e.g., assayed by plaque reduction neutral caused the host to insert viral proteins in its cytoplasmic
ization assay or ELISA) is used to evaluate the attenuated membranes.
phenotypes of the virus. In a specific embodiment, the plaque
reduction neutralization assay or ELISA is carried out at a low 0.155. In certain embodiments, the ability of the attenuated
dose. In certain embodiments, the ability of the hEbola virus virus to infect a host is reduced compared to the ability of the
to elicit pathological symptoms in an animal model is tested. wild type virus to infect the same host. Any technique known
A reduced ability of the virus to elicit pathological symptoms to the skilled artisan can be used to determine whether a virus
in an animal model system is indicative of its attenuated is capable of infecting a host.
phenotype. In a specific embodiment, the candidate viruses 0156. In certain embodiments, mutations (e.g., missense
are tested in a monkey model for nasal infection, indicated by mutations) are introduced into the genome of the virus, for
mucus production. example, into the sequence of SEQ ID NOs: 1 or 10, or to
0150. The viruses of the invention are optionally attenu generate a virus with an attenuated phenotype. Mutations
ated such that one or more of the functional characteristics of (e.g., missense mutations) can be introduced into the struc
the virus are impaired. In certain embodiments, attenuation is tural genes and/or regulatory genes of the hEbola. Mutations
measured in comparison to the wild type species of the virus are optionally additions, Substitutions, deletions, or combi
from which the attenuated virus is derived. In other embodi nations thereof. Such variant of hEbola can be screened for a
ments, attenuation is determined by comparing the growth of predicted functionality, such as infectivity, replication ability,
an attenuated virus in different host systems. Thus, for a protein synthesis ability, assembling ability, as well as cyto
non-limiting example, hEbola virus or a variant thereof is pathic effect in cell cultures. In a specific embodiment, the
attenuated when grown in a human host if the growth of the missense mutation is a cold-sensitive mutation. In another
hEbola or variant thereof in the human host is reduced com embodiment, the missense mutation is a heat-sensitive muta
pared to the non-attenuated hEbola or variant thereof. tion. In another embodiment, the missense mutation prevents
0151. In certain embodiments, the attenuated virus of the a normal processing or cleavage of the viral proteins.
invention is capable of infecting a host, is capable of repli 0157. In other embodiments, deletions are introduced into
cating in a host Such that infectious viral particles are pro the genome of the hEbola virus, which result in the attenua
duced. In comparison to the wild type species, however, the tion of the virus.
attenuated species grows to lowertiters or grows more slowly. 0158. In certain embodiments, attenuation of the virus is
Any technique known to the skilled artisan can be used to achieved by replacing a gene of the wild type virus with a
determine the growth curve of the attenuated virus and com gene of a virus of a different species, of a different Subgroup,
pare it to the growth curve of the wild type virus. or of a different variant. In another aspect, attenuation of the
0152. In certain embodiments, the attenuated virus of the virus is achieved by replacing one or more specific domains
invention (e.g., a recombinant or chimeric hEbola) cannot of a protein of the wild type virus with domains derived from
replicate in human cells as well as the wild type virus (e.g., the corresponding protein of a virus of a different species. In
wild type hEbola) does. However, the attenuated virus can certain other embodiments, attenuation of the virus is
replicate well in a cell line that lacks interferon functions, achieved by deleting one or more specific domains of a pro
such as Vero cells. tein of the wild type virus.
0153. In other embodiments, the attenuated virus of the 0159. When a live attenuated vaccine is used, its safety
invention is capable of infecting a host, of replicating in the should also be considered. The vaccine preferably does not
host, and of causing proteins of the virus of the invention to be cause disease. Any techniques known in the art for improving
inserted into the cytoplasmic membrane, but the attenuated vaccine safety are operable in the present invention. In addi
virus does not cause the host to produce new infectious viral tion to attenuation techniques, other techniques are optionally
particles. In certain embodiments, the attenuated virus infects be used. One non-limiting example is to use a soluble heter
the host, replicates in the host, and causes viral proteins to be ologous gene that cannot be incorporated into the virion
inserted in the cytoplasmic membrane of the host with the membrane. For example, a single copy of the Soluble version
US 2012/025 1502 A1 Oct. 4, 2012

of a viral transmembrane protein lacking the transmembrane 0166 In other embodiments, any of the above classes of
and cytosolic domains thereof is used. adjuvants are optionally used in combination with each other
0160 Various assays are optionally used to test the safety or with other adjuvants. For example, non-limiting examples
of a vaccine. For example, Sucrose gradients and neutraliza of combination adjuvant preparations used to administer the
tion assays are used to test the safety. A Sucrose gradient assay hEbola-associated antigens of the invention include lipo
is optionally used to determine whether a heterologous pro Somes containing immunostimulatory protein, cytokines,
tein is inserted in a virion. If the heterologous protein is T-cell and/or B-cell peptides, or microbes with or without
inserted in the virion, the virion is preferably tested for its entrapped IL-2 or microparticles containing enterotoxin.
ability to cause symptoms in an appropriate animal model Other adjuvants known in the art are also included within the
since the virus may have acquired new, possibly pathological, scope of the invention (see Vaccine Design: The Subunit and
properties. Adjuvant Approach, Chap. 7, Michael F. Powell and Mark J.
Newman (eds.), Plenum Press, New York, 1995, which is
5.4 Adjuvants and Carrier Molecules incorporated herein in its entirety).
0161 hEbola-associated antigens are administered with 0167. The effectiveness of an adjuvant is illustratively
one or more adjuvants. In one embodiment, the hEbola-asso determined by measuring the induction of antibodies directed
ciated antigen is administered together with a mineral salt against an immunogenic polypeptide containing a hEbola
adjuvants or mineral salt gel adjuvant. Such mineral salt and polypeptide epitope, the antibodies resulting from adminis
mineral salt gel adjuvants include, but are not limited to, tration of this polypeptide in vaccines which are also com
aluminum hydroxide (ALHYDROGEL REHYDRAGEL), prised of the various adjuvants.
aluminum phosphate gel, aluminum hydroxyphosphate 0.168. The polypeptides are optionally formulated into the
(ADJU-PHOS), and calcium phosphate. vaccine as neutral or salt forms. Pharmaceutically acceptable
0162. In another embodiment, hEbola-associated antigen salts include the acid additional salts (formed with free amino
is administered with an immunostimulatory adjuvant. Such groups of the peptide) and which are formed with inorganic
class of adjuvants include, but are not limited to, cytokines acids, such as, for example, hydrochloric orphosphoric acids,
(e.g., interleukin-2, interleukin-7, interleukin-12, granulo or organic acids Such as acetic, oxalic, tartaric, maleic, and the
cyte-macrophage colony stimulating factor (GM-CSF), inter like. Salts formed with free carboxyl groups are optionally
feron-Y interleukin-1B (IL-1B), and IL-1B peptide or Sclavo derived from inorganic bases, such as, for example, Sodium
Peptide), cytokine-containing liposomes, triterpenoid glyco potassium, ammonium, calcium, or ferric hydroxides, and
sides or saponins (e.g., QuilA and QS-21, also sold under the Such organic bases as isopropylamine, trimethylamine,
trademark STIMULON, ISCOPREP), Muramyl Dipeptide 2-ethylamino ethanol, histidine, procaine and the like.
(MDP) derivatives, such as N-acetyl-muramyl-L-threonyl 0169. The vaccines of the invention are preferably multi
valent or univalent. Multivalent vaccines are made from
D-isoglutamine (Threonyl-MDP sold under the trademark
TERMURTIDE), GMDP, N-acetyl-nor-muramyl-L-alanyl recombinant viruses that direct the expression of more than
D-isoglutamine, N-acetylmuramyl-L-alanyl-D-isoglutami one antigen.
nyl-L-alanine-2-(1'-2'-dipalmitoyl-s-n-glycero-3-hydroxy 0170 Many methods are operable herein to introduce the
phosphoryloxy)-ethylamine, muramyl tripeptide phosphati vaccine formulations of the invention; these include but are
dylethanolamine (MTP-PE), unmethylated CpG dinucle not limited to oral, intradermal, intramuscular, intraperito
otides and oligonucleotides. Such as bacterial DNA and frag neal, intravenous, Subcutaneous, intranasal routes, and via
ments thereof. LPS, monophosphoryl Lipid A (3D-MLA sold scarification (scratching through the top layers of skin, e.g.,
under the trademark MPL), and polyphosphaZenes. using a bifurcated needle).
0163. In another embodiment, the adjuvant used is a par 0171 The patient to which the vaccine is administered is
ticular adjuvant, including, but not limited to, emulsions, e.g., preferably a mammal, most preferably a human, but is also
Freund's Complete Adjuvant, Freund's Incomplete Adjuvant, optionally a non-human animal including but not limited to
squalene or squalane oil-in-water adjuvant formulations, lower primates, cows, horses, sheep, pigs, fowl (e.g., chick
such as SAF and MF59, e.g., prepared with block-copoly ens), goats, cats, dogs, hamsters, mice and rats.
mers, such as L-121 (polyoxypropylene/polyoxyetheylene) Preparation of Antibodies
sold under the trademark PLURONIC L-121, Liposomes,
Virosomes, cochleates, and immune stimulating complex, 0172 Antibodies that specifically recognize a polypeptide
which is sold under the trademark ISCOM. of the invention, Such as, but not limited to, polypeptides
0164. In another embodiment, a microparticular adjuvant including the sequence of SEQID NOS: 2-9, 59, or 11-19 and
is used. Microparticular adjuvants include, but are not limited other polypeptides as described herein, or hEbola epitope or
to, biodegradable and biocompatible polyesters, homo- and antigen-binding fragments thereof are used in a preferred
copolymers of lactic acid (PLA) and glycolic acid (PGA), embodiment for detecting, screening, and isolating the
poly(lactide-co-glycolides) (PLGA) microparticles, poly polypeptide of the invention or fragments thereof, or similar
mers that self-associate into particulates (poloxamer par sequences that might encode similar enzymes from the other
ticles), Soluble polymers (polyphosphaZenes), and virus-like organisms. For example, in one specific embodiment, an anti
particles (VLPs) Such as recombinant protein particulates, body which immunospecifically binds hEbola epitope, or a
e.g., hepatitis B surface antigen (HbSAg). fragment thereof, is used for various in vitro detection assays,
0.165 Yet another class of adjuvants that are optionally including enzyme-linked immunosorbent assays (ELISA),
used include mucosal adjuvants, including but not limited to radioimmunoassays, western blot, etc., for the detection of a
heat-labile enterotoxin from Escherichia coli (LT), cholera polypeptide of the invention or, preferably, hEbola, in
holotoxin (CT) and cholera Toxin B Subunit (CTB) from samples, for example, a biological material, including cells,
Vibrio cholerae, mutant toxins (e.g., LTK63 and LTR72), cell culture media (e.g., bacterial cell culture media, mamma
microparticles, and polymerized liposomes. lian cell culture media, insect cell culture media, yeast cell
US 2012/025 1502 A1 Oct. 4, 2012

culture media, etc.), blood, plasma, serum, tissues, sputum, the synthesis of antibodies, in particular, by chemical synthe
naseopharyngeal aspirates, etc. sis or preferably, by recombinant expression techniques.
0173 Antibodies specific for a polypeptide of the inven 0.178 The nucleotide sequence encoding an antibody is
tion or any epitope ofhEbola are optionally generated by any obtained from any information available to those skilled in
suitable method known in the art. Polyclonal antibodies to an the art (i.e., from Genbank, the literature, or by routine clon
antigen of interest, for example, the hEbola virus from ing and sequence analysis). If a clone containing a nucleic
Deposit Accession No. 200706291, or including a nucleotide acid encoding a particular antibody or an epitope-binding
sequence of SEQID NOs: 1 or 10, are optionally produced by fragment thereof is not available, but the sequence of the
various procedures well known in the art. For example, an antibody molecule or epitope-binding fragment thereof is
antigen is optionally administered to various host animals known, a nucleic acid encoding the immunoglobulin may be
including, but not limited to, rabbits, mice, rats, etc., to induce chemically synthesized or obtained from a suitable source
the production of antisera containing polyclonal antibodies (e.g., an antibody cDNA library, or a cDNA library generated
specific for the antigen. Various adjuvants are optionally used from, or nucleic acid, preferably poly A+RNA, isolated from
to increase the immunological response, depending on the any tissue or cells expressing the antibody, such as hybridoma
host species, and include but are not limited to, Freund's cells selected to express an antibody) by PCR amplification
(complete and incomplete) adjuvant, mineral gels such as using synthetic primers hybridizable to the 3' and 5' ends of
aluminum hydroxide, Surface active Substances such as lyso the sequence or by cloning using an oligonucleotide probe
lecithin, pluronic polyols, polyanions, peptides, oil emul specific for the particular gene sequence to identify, e.g., a
sions, keyhole limpet hemocyanins, dinitrophenol, and cDNA clone from a cDNA library that encodes the antibody.
potentially useful adjuvants for humans such as BCG (Bacille Amplified nucleic acids generated by PCR are optionally then
Calmette-Guerin) and Corynebacterium parvum. Such adju cloned into replicable cloning vectors using any method
vants are also well known in the art. known in the art.
0.174 Monoclonal antibodies are optionally prepared 0179. Once the nucleotide sequence of the antibody is
using a wide variety of techniques known in the art including determined, the nucleotide sequence of the antibody is
the use of hybridoma, recombinant, and phage display tech optionally manipulated using methods well known in the art
nologies, or a combination thereof. In one example, mono for the manipulation of nucleotide sequences, e.g., recombi
clonal antibodies are produced using hybridoma techniques nant DNA techniques, site directed mutagenesis, PCR, etc.
including those known in the art and taught, for example, in (see, for example, the techniques described in Sambrook et
Harlow et al., Antibodies: A Laboratory Manual (Cold Spring al., Supra; and Ausubel et al., eds., 1998, Current Protocols in
Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., Molecular Biology, John Wiley & Sons, NY, which are both
in: Monoclonal Antibodies and T-Cell Hybridomas, pp. 563 incorporated by reference herein in their entireties), to gen
681 (Elsevier, N.Y., 1981) (both of which are incorporated by erate antibodies having a different amino acid sequence by,
reference in their entireties). The term “monoclonal anti for example, introducing amino acid Substitutions, deletions,
body” as used herein is not limited to antibodies produced and/or insertions into the epitope-binding domain regions of
through hybridoma technology. The term "monoclonal anti the antibodies or any portion of antibodies which may
body” refers to an antibody that is derived from a single clone, enhance or reduce biological activities of the antibodies.
including any eukaryotic, prokaryotic, or phage clone, and 0180 Recombinant expression of an antibody requires
not the method by which it is produced. construction of an expression vector containing a nucleotide
0175 Methods for producing and screening for specific sequence that encodes the antibody. Once a nucleotide
antibodies using hybridoma technology are routine and well sequence encoding an antibody molecule or a heavy or light
known in the art. In a non-limiting example, mice are immu chain of an antibody, orportion thereofhas been obtained, the
nized with an antigen of interest or a cell expressing Such an vector for the production of the antibody molecule is option
antigen. Once an immune response is detected, e.g., antibod ally produced by recombinant DNA technology using tech
ies specific for the antigen are detected in the mouse serum, niques known in the art as discussed in the previous sections.
the mouse spleen is harvested and splenocytes isolated. The Methods which are known to those skilled in the art are
splenocytes are then fused by well known techniques to any optionally used to construct expression vectors containing
suitable myeloma cells. Hybridomas are selected and cloned antibody coding sequences and appropriate transcriptional
by limiting dilution. The hybridoma clones are then assayed and translational control signals. These methods include, for
by methods known in the art for cells that secrete antibodies example, in vitro recombinant DNA techniques, synthetic
capable of binding the antigen. Ascites fluid, which generally techniques, and in vivo genetic recombination. The nucle
contains high levels of antibodies, is optionally generated by otide sequence encoding the heavy-chain variable region,
inoculating mice intraperitoneally with positive hybridoma light-chain variable region, both the heavy-chain and light
clones. chain variable regions, an epitope-binding fragment of the
0176 Antibody fragments which recognize specific heavy- and/or light-chain variable region, or one or more
epitopes are optionally generated by known techniques. For complementarity determining regions (CDRs) of an antibody
example, Fab and F(ab') fragments are illustratively pro are optionally cloned into Such a vector for expression. Thus,
duced by proteolytic cleavage of immunoglobulin molecules, prepared expression vector is optionally then introduced into
using enzymes Such as papain (to produce Fab fragments) or appropriate host cells for the expression of the antibody.
pepsin (to produce F(ab')2 fragments). F(ab')2 fragments pref Accordingly, the invention includes host cells containing a
erably contain the complete light chain, and the variable polynucleotide encoding an antibody specific for the
region, the CH1 region and the hinge region of the heavy polypeptides of the invention or fragments thereof.
chain. 0181. The host cell is optionally co-transfected with two
0177. The antibodies of the invention or fragments thereof expression vectors of the invention, the first vector encoding
are optionally produced by any method known in the art for a heavy chain derived polypeptide and the second vector
US 2012/025 1502 A1 Oct. 4, 2012

encoding a light chain derived polypeptide. The two vectors ecule, for example, by chromatography (e.g., ion exchange,
illustratively contain identical selectable markers which affinity, particularly by affinity for the specific antigen after
enable equal expression of heavy and light chain polypeptides Protein A or Protein G purification, and sizing column chro
or different selectable markers to ensure maintenance of both matography), centrifugation, differential solubility, or by any
plasmids. Alternatively, a single vector is optionally used other standard technique(s) for the purification of proteins.
which encodes, and is capable of expressing, both heavy and Further, the antibodies of the present invention or fragments
light chain polypeptides. In Such situations, the light chain thereof are optionally fused to heterologous polypeptide
should be placed before the heavy chain to avoid an excess of sequences described herein or otherwise known in the art to
toxic free heavy chain (Proudfoot, Nature, 322:52, 1986; and facilitate purification. Illustrative examples include 6xHis
Kohler, Proc. Natl. Acad. Sci. USA, 77:2 197, 1980). The tag, FLAG tag, biotin, avidin, or other system.
coding sequences for the heavy and light chains optionally 0185. For some uses, including in vivo use of antibodies in
include cDNA or genomic DNA. humans and in vitro detection assays, it is preferable to use
0182. In another embodiment, antibodies are generated chimeric, humanized, or human antibodies. A chimeric anti
using various phage display methods known in the art. In body is a molecule in which different portions of the antibody
phage display methods, functional antibody domains are dis are derived from different animal species, such as antibodies
played on the Surface of phage particles which carry the having a variable region derived from a murine monoclonal
polynucleotide sequences encoding them. In a particular antibody and a constant region derived from a human immu
embodiment, suchphage is utilized to display antigenbinding noglobulin. Methods for producing chimeric antibodies are
domains, such as Fab and Fv or disulfide-bond stabilized Fv, known in the art. See e.g., Morrison, Science, 229:1202,
expressed from a repertoire or combinatorial antibody library 1985; Oi et al., BioTechniques, 4:214 1986; Gillies et al., J.
(e.g., human or murine). Phage expressing an antigenbinding Immunol. Methods, 125:191-202, 1989; U.S. Pat. Nos.
domain that binds the antigen of interest is optionally selected 5,807,715;4,816,567; and 4,816,397, which are incorporated
or identified with antigen, e.g., using labeled antigen or anti herein by reference in their entireties. Humanized antibodies
gen bound or captured to a solid Surface or bead. Phages used are antibody molecules from non-human species that bind the
in these methods are typically filamentous phage, including desired antigen having one or more complementarity deter
fa and M13. The antigen binding domains are expressed as a mining regions (CDRS) from the non-human species and
recombinantly fused protein to either the phage gene III or framework regions from a human immunoglobulin molecule.
gene VIII protein. Examples of phage display methods that Often, framework residues in the human framework regions
can be used to make the immunoglobulins, or fragments will be substituted with the corresponding residue from the
thereof, of the present invention include those disclosed in CDR donor antibody to alter, preferably improve, antigen
Brinkman et al., J. Immunol. Methods, 182:41-50, 1995; binding. These framework substitutions are identified by
Ames et al., J. Immunol. Methods, 184:177-186, 1995; methods well known in the art, e.g., by modeling of the
Kettleborough et al., Eur. J. Immunol., 24:952-958, 1994: interactions of the CDR and framework residues to identify
Persic et al., Gene, 187:9-18, 1997: Burton et al., Advances in framework residues important for antigen binding and
Immunology, 57:191-280, 1994; PCT application No. PCT/ sequence comparison to identify unusual framework residues
GB91/01134; PCT publications WO 90/02809; WO at particular positions. See, e.g., Queen et al., U.S. Pat. No.
91/10737; WO92/01047; WO92/18619; WO 93/11236; WO 5,585,089; Riechmann et al., Nature, 332:323, 1988, which
95/15982; WO95/20401; and U.S. Pat. Nos. 5,698,426; are incorporated herein by reference in their entireties. Anti
5,223,409; 5,403.484: 5,580,717; 5,427,908; 5,750,753; bodies are humanized using a variety of techniques known in
5,821,047; 5,571,698; 5,427,908: 5,516,637; 5,780,225; the art including, for example, CDR-grafting (EP 239,400;
5,658,727; 5,733,743 and 5,969,108; each of which is incor PCT publication WO 91/09967; U.S. Pat. Nos. 5.225,539;
porated herein by reference in its entirety. 5.530,101 and 5,585,089), veneering or resurfacing (EP592,
0183. As described in the above references, after phage 106; EP 519,596: Padlan, Molecular Immunology, 28(4/5):
selection, the antibody coding regions from the phage is 489-498, 1991; Studnicka et al., Protein Engineering, 7(6):
optionally isolated and used to generate whole antibodies, 805-814, 1994; Roguska et al., Proc Natl. Acad. Sci. USA,
including human antibodies, or any other desired fragments, 91:969-973, 1994), and chain shuffling (U.S. Pat. No. 5,565,
and expressed in any desired host, including mammalian 332), all of which are hereby incorporated by reference in
cells, insect cells, plant cells, yeast, and bacteria, e.g., as their entireties.
described in detail below. For example, techniques to recom 0186 Completely human antibodies are particularly desir
binantly produce Fab, Fab' and F(ab'), fragments are option able for therapeutic treatment of human patients. Human
ally employed using methods known in the art Such as those antibodies are made by a variety of methods known in the art
disclosed in PCT publication WO92/22324; Mullinax et al., illustratively including phage display methods described
BioTechniques, 12(6):864-869, 1992; and Sawai et al., AJR1, above using antibody libraries derived from human immuno
34:26-34, 1995; and Better et al., Science, 240: 1041-1043, globulin sequences. See U.S. Pat. Nos. 4,444,887 and 4,716.
1988 (each of which is incorporated by reference in its 111; and PCT publications WO 98/46645; WO 98/50433;
entirety). Examples oftechniques operable to produce single WO 98/24893; WO 98/16654; WO 96/34096; WO 96/33735;
chain Fvs and antibodies include those described in U.S. Pat. and WO 91/10741, each of which is incorporated herein by
Nos. 4,946,778 and 5,258.498: Huston et al., Methods in reference in its entirety.
Enzymology, 203:46-88, 1991; Shu et al., PNAS, 90:7995 0187 Human antibodies are also illustratively produced
7999, 1993; and Skerra et al., Science, 240:1038-1040, 1988. using transgenic mice which are incapable of expressing
0184. Once an antibody molecule of the invention has functional endogenous immunoglobulins, but which can
been produced by any methods described above, or otherwise express human immunoglobulin genes. For an overview of
known in the art, it is then optionally purified by any method this technology for producing human antibodies, see Lonberg
known in the art for purification of an immunoglobulin mol and Huszar, Int. Rev. Immunol., 13:65-93, 1995. For a
US 2012/025 1502 A1 Oct. 4, 2012

detailed discussion of this technology for producing human or local. In a preferred embodiment, it is desirable to intro
antibodies and human monoclonal antibodies and protocols duce the pharmaceutical compositions of the invention into
for producing Such antibodies, see, e.g., PCT publications the lungsby any suitable route. Pulmonary administration can
WO 98/24893; WO92/01047; WO 96/34096; WO 96/33735; also be employed, e.g., by use of an inhaler or nebulizer, and
European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923; formulation with an aerosolizing agent.
5,625,126; 5,633,425; 5,569,825; 5,661.016; 5,545,806; 0193 In a specific embodiment, it is desirable to admin
5,814,318; 5,885,793; 5,916,771; and 5,939,598, which are ister the pharmaceutical compositions of the invention locally
incorporated by reference herein in their entireties. In addi to the area in need of treatment. This administration may be
tion, companies Such as Abgenix, Inc. (Fremont, Calif.), achieved by, for example, and not by way of limitation, local
Medarex (NJ) and Genpharm (San Jose, Calif.) can be infusion during Surgery, topical application, e.g., in conjunc
engaged to provide human antibodies directed against a tion with a wound dressing after Surgery, by injection, by
selected antigen using technology similar to that described means of a catheter, by means of a Suppository, by means of
above. nasal spray, or by means of an implant, the implant being of a
0188 Completely human antibodies which recognize a porous, non-porous, or gelatinous material, including mem
selected epitope are optionally generated using a technique branes, such as Sialastic membranes, or fibers. In one embodi
referred to as “guided selection.” In this approach a selected ment, administration can be by direct injection at the site (or
non-human monoclonal antibody, e.g., a mouse antibody, is former site) infected tissues.
used to guide the selection of a completely human antibody 0194 In another embodiment, the pharmaceutical compo
recognizing the same epitope. (Jespers et al., Bio/technology, sition is delivered in a vesicle, in particular a liposome (see
12:899-903, 1988). Langer, 1990, Science 249:1527-1533; Treat et al., in Lipo
0189 Antibodies fused or conjugated to heterologous Somes in the Therapy of Infectious Disease and Cancer,
polypeptides are optionally used in in vitro immunoassays Lopez. Berestein and Fidler (eds.), Liss, New York, pp. 353
and in purification methods (e.g., affinity chromatography) 365 (1989); Lopez-Berestein, ibid., pp. 317-327; see gener
known in the art. See e.g., PCT publication No. WO ally ibid.).
93/21232; EP 439,095; Naramura et al., Immunol. Lett. 0.195. In yet another embodiment, the pharmaceutical
39:91-99, 1994: U.S. Pat. No. 5,474,981; Gillies et al., PNAS, composition is delivered in a controlled release system. In one
89:1428-1432, 1992; and Fell et al., J. Immunol., 146:2446 embodiment, a pump is used (see Langer, Supra; Sefton,
2452, 1991, which are incorporated herein by reference in 1987, CRC Crit. Ref. Biomed. Eng. 14:201: Buchwaldet al.,
their entireties. 1980, Surgery 88:507; and Saudek et al., 1989, N. Engl. J.
0.190 Antibodies may also be illustratively attached to Med. 321:574). In another embodiment, polymeric materials
Solid Supports, which are particularly useful for immunoas are used (see Medical Applications of Controlled Release,
says or purification of the polypeptides of the invention or Langer and Wise (eds.), CRC Pres. Boca Raton, Fla. (1974);
fragments, derivatives, analogs, or variants thereof, or similar Controlled Drug Bioavailability, Drug Product Design and
molecules having the similar enzymatic activities as the Performance, Smolen and Ball (eds.), Wiley, New York
polypeptide of the invention. Such solid supports include, but (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macro
are not limited to, glass, cellulose, polyacrylamide, nylon, mol. Chem. 23:61 (1983); see also Levy et al., 1985, Science
polystyrene, polyvinyl chloride or polypropylene. 228:190; During et al., 1989, Ann. Neurol. 25:351; Howardet
al., 1989, J. Neurosurg. 71:105). In yet another embodiment,
Pharmaceutical Compositions and Kits a controlled release system is placed in proximity of the
0191 The present invention encompasses pharmaceutical composition's target, i.e., the lung, thus, requiring only a
compositions including antiviral agents of the present inven fraction of the systemic dose (see, e.g., Goodson, in Medical
tion. In a specific embodiment, the antiviral agent is prefer Applications of Controlled Release, supra, vol. 2, pp. 115
ably an antibody which immunospecifically binds and neu 138 (1984)).
tralizes the hEbola virus or variants thereof, or any proteins 0196. Other controlled release systems are discussed in
derived therefrom. In another specific embodiment, the anti the review by Langer (Science 249:1527-1533 (1990)) the
viral agent is a polypeptide or nucleic acid molecule of the contents of which are incorporated herein by reference.
invention. The pharmaceutical compositions have utility as 0197) The pharmaceutical compositions of the present
an antiviral prophylactic agent are illustratively administered invention illustratively include a therapeutically effective
to a subject where the subject has been exposed or is expected amount of alive attenuated, inactivated or killed West African
to be exposed to a virus. hEbola virus, or recombinant or chimeric hEbola virus, and a
0.192 Various delivery systems are known and operable to pharmaceutically acceptable carrier. In a specific embodi
administer the pharmaceutical composition of the invention, ment, the term “pharmaceutically acceptable” means
illustratively, encapsulation in liposomes, microparticles, approved by a regulatory agency of the Federal or a state
microcapsules, recombinant cells capable of expressing the government or listed in the U.S. Pharmacopeia or other gen
mutant viruses, and receptor mediated endocytosis (see, e.g., erally recognized pharmacopeia for use in animals, and more
Wu and Wu, 1987, J. Biol. Chem. 262:4429 4432). Methods particularly in humans. The term “carrier refers to a diluent,
of introduction include but are not limited to intradermal, adjuvant, excipient, or vehicle with which the pharmaceutical
intramuscular, intraperitoneal, intravenous, Subcutaneous, composition is administered. Such pharmaceutical carriers
intranasal, epidural, and oral routes. The compounds may be are illustratively sterile liquids, such as water and oils, includ
administered by any convenient route, for example by infu ing those of petroleum, animal, vegetable or synthetic origin,
sion or bolus injection, by absorption through epithelial or Such as peanut oil, soybean oil, mineral oil, sesame oil and the
mucocutaneous linings (e.g., oral mucosa, rectal and intesti like. Water is a preferred carrier when the pharmaceutical
nal mucosa, etc.) and optionally administered together with composition is administered intravenously. Saline solutions
other biologically active agents. Administration is systemic and aqueous dextrose and glycerol Solutions are optionally
US 2012/025 1502 A1 Oct. 4, 2012

employed as liquid carriers, particularly for injectable solu 0201 Suppositories generally contain active ingredient in
tions. Suitable pharmaceutical excipients include starch, glu the range of 0.5% to 10% by weight; oral formulations pref
cose, lactose. Sucrose, gelatin, malt, rice, flour, chalk, silica erably contain 10% to 95% active ingredient.
gel, Sodium Stearate, glycerol monostearate, talc, sodium 0202 The invention also provides a pharmaceutical pack
chloride, dried skim milk, glycerol, propylene, glycol, water, or kit including one or more containers filled with one or more
ethanol and the like. The composition, if desired, also con of the ingredients of the pharmaceutical compositions of the
tains wetting or emulsifying agents, or pH buffering agents. invention. Optionally associated with Such container(s) is a
These compositions optionally take the form of Solutions, notice in the form prescribed by a governmental agency regu
Suspensions, emulsion, tablets, pills, capsules, powders, Sus lating the manufacture, use or sale of pharmaceuticals or
tained release formulations and the like. The composition is biological products, which notice reflects approval by the
optionally formulated as a Suppository, with traditional bind agency of manufacture, use or sale for human administration.
ers and carriers such as triglycerides. Oral formulation illus In a preferred embodiment, the kit contains an antiviral agent
of the invention, e.g., an antibody specific for the polypep
tratively includes standard carriers such as pharmaceutical tides encoded by a nucleotide sequence of SEQID NOs: 1 or
grades of mannitol, lactose, starch, magnesium Stearate, 10, or as shown in SEQ ID NOS: 2-9, 59, or 11-19, or any
Sodium saccharine, cellulose, magnesium carbonate, etc. hEbola epitope, or a polypeptide or protein of the present
Examples of suitable pharmaceutical carriers are described in invention, or a nucleic acid molecule of the invention, alone or
“Remington's Pharmaceutical Sciences” by E. W. Martin. in combination with adjuvants, antivirals, antibiotics, analge
The formulation should suit the mode of administration. sic, bronchodilators, or other pharmaceutically acceptable
0198 In a preferred embodiment, the composition is for excipients.
mulated in accordance with routine procedures as a pharma 0203 The present invention further encompasses kits
ceutical composition adapted for intravenous administration including a container containing a pharmaceutical composi
to human beings. Typically, compositions for intravenous tion of the present invention and instructions for use.
administration are solutions insterile isotonic aqueous buffer. Detection Assays
The composition also includes an optional Solubilizing agent
and a local anesthetic Such as lignocaine to ease pain at the 0204 The present invention provides a method for detect
site of the injection. Generally, the ingredients are Supplied ing an antibody, which immunospecifically binds to the
either separately or mixed together in unit dosage form, for hEbola virus, in a biological sample, including for example
example, as a dry lyophilized powder or water-free concen blood, serum, plasma, Saliva, urine, feces, etc., from a patient
trate in a hermetically sealed container Such as an ampoule or suffering from hEbola infection, and/or hemorrhagic fever. In
Sachette indicating the quantity of active agent. Where the a specific embodiment, the method including contacting the
composition is to be administered by infusion, it can be dis sample with the hEbola virus, for example, of Deposit Acces
pensed with an infusion bottle containing sterile pharmaceu sion No. 200706291, or having a genomic nucleic acid
tical grade water or saline. Where the composition is admin sequence of SEQID NOs: 1 or 10, directly immobilized on a
istered by injection, an ampoule of sterile water for injection substrate and detecting the virus-bound antibody directly or
or saline is optionally provided so that the ingredients may be indirectly by a labeled heterologous anti-isotype antibody. In
mixed prior to administration. another specific embodiment, the sample is contacted with a
host cell which is infected by the hEbola virus, for example,
0199 The pharmaceutical compositions of the invention of Deposit Accession No. 200706291, or having a genomic
are illustratively formulated as neutral or salt forms. Pharma nucleic acid sequence of SEQID NOs: 1 or 10, and the bound
ceutically acceptable salts illustratively include those formed antibody is optionally detected by immunofluorescent assay.
with free amino groups such as those derived from hydro 0205 An exemplary method for detecting the presence or
chloric, phosphoric, acetic, oxalic, tartaric acids, etc., and absence of a polypeptide or nucleic acid of the invention in a
those formed with free carboxyl groups such as those derived biological sample involves obtaining a biological sample
from Sodium, potassium, ammonium, calcium, ferric hydrox from various sources and contacting the sample with a com
ides, isopropylamine, triethylamine, 2 ethylamino ethanol, pound or an agent capable of detecting an epitope or nucleic
histidine, procaine, etc. acid (e.g., mRNA, genomic DNA) of the hEbola virus such
0200. The amount of the pharmaceutical composition of that the presence of the hEbola virus is detected in the sample.
the invention which will be effective in the treatment of a A preferred agent for detecting hEbola mRNA or genomic
particular disorder or condition will depend on the nature of RNA of the invention is a labeled nucleic acid probe capable
the disorder or condition, and can be determined by standard of hybridizing to mRNA or genomic RNA encoding a
clinical techniques. In addition, in vitro assays are optionally polypeptide of the invention. The nucleic acid probe is, for
employed to help identify optimal dosage ranges. The precise example, a nucleic acid molecule including the nucleotide
dose to be employed in the formulation will also depend on sequence of SEQID NOs: 1 or 10, a complement thereof, or
the route of administration, and the seriousness of the disease a portion thereof. Such as an oligonucleotide of at least 15, 20,
or disorder, and should be decided according to the judgment 25, 30, 50, 100, 250, 500, 750, 1000 or more contiguous
of the practitioner and each patient's circumstances. How nucleotides in length and sufficient to specifically hybridize
ever, Suitable dosage ranges for intravenous administration under stringent conditions to a hEbola mRNA or genomic
are generally about 20 to 500 micrograms of active compound RNA.
per kilogram body weight. Suitable dosage ranges for intra 0206. As used herein, the term “stringent conditions'
nasal administration are generally about 0.01 pg/kg body describes conditions for hybridization and washing under
weight to 1 mg/kg body weight. Effective doses may be which nucleotide sequences having at least 30%, 35%, 40%,
extrapolated from dose response curves derived from in vitro 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or
or animal model test systems. 95% identity to each other typically remain hybridized to
US 2012/025 1502 A1 Oct. 4, 2012
20

each other. Such hybridization conditions are described in, 0210 A preferred agent for detecting hEbola is an anti
for example but not limited to, Current Protocols in Molecu body that specifically binds a polypeptide of the invention or
lar Biology, John Wiley & Sons, N.Y. (1989), 6.3.16.3.6: any hEbola epitope, preferably an antibody with a detectable
Basic Methods in Molecular Biology, Elsevier Science Pub label. Antibodies are illustratively polyclonal, or more pref
lishing Co., Inc., N.Y. (1986), pp. 75 78, and 84 87; and erably, monoclonal. An intact antibody, or a fragment thereof
Molecular Cloning, Cold Spring Harbor Laboratory, N.Y. (e.g., Fab or F(ab')) is operable herein.
(1982), pp. 387389, and are well known to those skilled in the 0211. The term “labeled', with regard to the probe or
art. A preferred, non-limiting example of stringent hybridiza antibody, is intended to encompass direct labeling of the
tion conditions is hybridization in 6x sodium chloride/so probe or antibody by coupling (i.e., physically linking) a
dium citrate (SSC), 0.5% SDS at about 68° C. followed by detectable substance to the probe or antibody, optionally via
one or more washes in 2xSSC, 0.5% SDS at room tempera a linker, as well as indirect labeling of the probe or antibody
ture. Another preferred, non-limiting example of stringent by reactivity with another reagent that is directly labeled.
hybridization conditions is hybridization in 6xSSC at about Examples of indirect labeling include detection of a primary
antibody using a fluorescently labeled secondary antibody
45° C. followed by one or more washes in 0.2xSSC, 0.1% and end-labeling of a DNA probe with biotin such that it is
SDS at 50 to 65° C.
detectable with fluorescently labeled streptavidin. The detec
0207. A nucleic acid probe, polynucleotide, oligonucle tion method of the invention is optionally used to detect
otide, or other nucleic acid is preferably purified. An "iso mRNA, protein (or any epitope), or genomic RNA in a sample
lated' or “purified nucleotide sequence is substantially free in vitro as well as in vivo. Exemplary in vitro techniques for
of cellular material or other contaminating proteins from the detection of mRNA include northern hybridizations, in situ
cell or tissue source from which the nucleotide is derived, or hybridizations, RT-PCR, and RNase protection. In vitro tech
is substantially free of chemical precursors or other chemicals niques for detection of an epitope of hEbola illustratively
when chemically synthesized. The language “substantially include enzyme linked immunosorbent assays (ELISAS),
free of cellular material' includes preparations of a nucle western blots, immunoprecipitations and immunofluores
otidefoligonucleotide in which the nucleotidefoligonucle cence. In vitro techniques for detection of genomic RNA
otide is separated from cellular components of the cells from include northern hybridizations, RT-PCT, and RNase protec
which it is isolated or produced. Thus, a nucleotidefoligo tion. Furthermore, in vivo techniques for detection of hEbola
nucleotide that is substantially free of cellular material include introducing into a subject organism a labeled anti
includes preparations of the nucleotide having less than about body directed against the polypeptide. In one embodiment,
30%, 20%, 10%, 5%, 2.5%, or 1%, (by dry weight) of con the antibody is labeled with a radioactive marker whose pres
taminating material. When nucleotidefoligonucleotide is pro ence and location in the Subject organism is detected by
duced by chemical synthesis, it is preferably substantially standard imaging techniques, including autoradiography.
free of chemical precursors or other chemicals, i.e., it is 0212. In a specific embodiment, the methods further
separated from chemical precursors or other chemicals which involve obtaining a control sample from a control Subject,
are involved in the synthesis of the protein. Accordingly, Such contacting the control sample with a compound or agent
preparations of the nucleotidefoligonucleotide have less than capable of detecting hEbola, e.g., a polypeptide of the inven
about 30%, 20%, 10%, or 5% (by dry weight) of chemical tion or mRNA or genomic RNA encoding a polypeptide of the
precursors or compounds other than the nucleotidefoligo invention, such that the presence ofhEbola or the polypeptide
nucleotide of interest. In a preferred embodiment of the or mRNA or genomic RNA encoding the polypeptide is
present invention, the nucleotidefoligonucleotide is isolated detected in the sample, and comparing the absence ofhEbola
or purified. or the polypeptide or mRNA or genomic RNA encoding the
0208. In another preferred specific embodiment, the pres polypeptide in the control sample with the presence of
ence of hEbola virus is detected in the sample by a reverse hEbola, or the polypeptide or mRNA or genomic DNA
transcription polymerase chain reaction (RT-PCR) using the encoding the polypeptide in the test sample.
primers that are constructed based on a partial nucleotide 0213. The invention also encompasses kits for detecting
sequence of the genome ofhEbola virus, for example, that of the presence ofhEbola or a polypeptide or nucleic acid of the
Deposit Accession No. 200706291, or having a genomic invention in a test sample. The kit illustratively includes a
nucleic acid sequence of SEQ ID NOs: 1 or 10. In a non labeled compound or agent capable of detecting hEbola or the
limiting specific embodiment, preferred primers to be used in polypeptide or a nucleic acid molecule encoding the polypep
a RT-PCR method are the primers are described in detail tide in a test sample and, in certain embodiments, a means for
herein. determining the amount of the polypeptide or mRNA in the
0209. In more preferred specific embodiment, the present sample (e.g., an antibody which binds the polypeptide or an
invention provides a real-time quantitative PCR assay to oligonucleotide probe which binds to DNA or mRNA encod
detect the presence of hEbola virus in a biological sample by ing the polypeptide). Kits optionally include instructions for
SC.
subjecting the cDNA obtained by reverse transcription of the
extracted total RNA from the sample to PCR reactions using 0214. For antibody-based kits, the kit illustratively
the specific primers described in detail herein, and a fluores includes: (1) a first antibody (e.g., attached to a solid Support)
cence dye, such as SYBR(R) Green I, which fluoresces when which binds to a polypeptide of the invention or hEbola
bound nonspecifically to double-stranded DNA. The fluores epitope; and, optionally, (2) a second, different antibody
cence signals from these reactions are captured at the end of which binds to either the polypeptide or the first antibody and
extension steps as PCR product is generated over a range of is preferably conjugated to a detectable agent.
the thermal cycles, thereby allowing the quantitative determi 0215 For oligonucleotide-based kits, the kit illustratively
nation of the viral load in the sample based on an amplifica includes: (1) an oligonucleotide, e.g., a detectably labeled
tion plot. oligonucleotide, which hybridizes to a nucleic acid sequence
US 2012/025 1502 A1 Oct. 4, 2012

encoding a polypeptide of the invention or to a sequence is optionally measured at any time during the assay. In certain
within the hEbola genome; or (2) a pair of primers useful for embodiments, a time course of viral growth in the culture is
amplifying a nucleic acid molecule containing an hEbola determined. If the viral growth is inhibited or reduced in the
sequence. The kit optionally includes a buffering agent, a presence of the test compound, the test compound is identi
preservative, or a protein stabilizing agent. The kit optionally fied as being effective in inhibiting or reducing the growth or
includes components necessary for detecting the detectable infection of the hEbola virus. In a specific embodiment, the
agent (e.g., an enzyme or a Substrate). The kit optionally compound that inhibits or reduces the growth of the hEbola in
contains a control sample or a series of control samples which the model animal is tested for its ability to inhibit or reduce
can be assayed and compared to the test sample contained. the growth rate of other viruses to test its specificity for the
Each component of the kit is usually enclosed within an hEbola virus.
individual container and all of the various containers are 0220 According to the method of the invention, a human
within a single package along with instructions for use. or an animal is optionally treated for for EboBun or EboC,
other viral infection or bacterial infection by administering an
Screening Assays to Identify Antiviral Agents effective amount of an inventive therapeutic composition.
0216. The invention provides methods for the identifica Preferably, a vaccine is administered prophylactically. An
“effective amount' is an amount that will induce an immune
tion of a compound that inhibits the ability ofhEbola virus to response in a subject. Illustratively, an effective amount of the
infect a host or a host cell. In certain embodiments, the inven compositions of this invention ranges from nanogram/kg to
tion provides methods for the identification of a compound milligram/kg amounts for young children and adults. Equiva
that reduces the ability ofhEbola virus to replicate in a host or lent dosages for lighter or heavier body weights can readily be
a host cell. Any technique well known to the skilled artisan is determined. The dose should be adjusted to suit the individual
illustratively used to screen for a compound useful to abolish to whom the composition is administered and will vary with
or reduce the ability of hEbola virus to infect a host and/or to age, weight and metabolism of the individual. The exact
replicate in a host or a host cell. amount of the composition required will vary from Subject to
0217. In certain embodiments, the invention provides Subject, depending on the species, age, weight and general
methods for the identification of a compound that inhibits the condition of the Subject, the particular peptide or polypeptide
ability of hEbola virus to replicate in a mammal or a mam used, its mode of administration and the like. An appropriate
malian cell. More specifically, the invention provides meth amount can be determined by one of ordinary skill in the art
ods for the identification of a compound that inhibits the using only routine experimentation given the teachings
ability of hEbola virus to infect a mammal or a mammalian herein. One skilled in the art will realize that dosages are best
cell. In certain embodiments, the invention provides methods optimized by the practicing physician or veterinarian and
for the identification of a compound that inhibits the ability of methods for determining dose amounts and regimens and
hEbola virus to replicate in a mammalian cell. In a specific preparing dosage forms are described, for example, in Rem
embodiment, the mammalian cell is a human cell. ington's Pharmaceutical Sciences, (Martin, E. W., ed., latest
0218. In another embodiment, a cell is contacted with a edition), Mack Publishing Co., Easton, Pa. Preferably, a
test compound and infected with the hEbola virus. In certain single administration is operable to induce an immune
embodiments, a control culture is infected with the hEbola response.
virus in the absence of a test compound. The cell is optionally 0221 Methods involving conventional biological tech
contacted with a test compound before, concurrently with, or niques are described herein. Such techniques are generally
subsequent to the infection with the hEbola virus. In a specific known in the art and are described in detail in methodology
embodiment, the cell is a mammalian cell. In an even more treatises such as Molecular Cloning: A Laboratory Manual,
specific embodiment, the cell is a human cell. In certain 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor
embodiments, the cell is incubated with the test compound for Laboratory Press, Cold Spring Harbor, N.Y., 1989; and Cur
at least 1 minute, at least 5 minutes, at least 15 minutes, at rent Protocols in Molecular Biology, ed. Ausubel et al.,
least 30 minutes, at least 1 hour, at least 2 hours, at least 5 Greene Publishing and Wiley-Interscience, New York, 1992
hours, at least 12 hours, or at least 1 day. The titer of the virus (with periodic updates). Immunological methods (e.g., prepa
is optionally measured at any time during the assay. In certain ration of antigen-specific antibodies, immunoprecipitation,
embodiments, a time course of viral growth in the culture is and immunoblotting) are described, e.g., in Current Protocols
determined. If the viral growth is inhibited or reduced in the in Immunology, ed. Coligan et al., John Wiley & Sons, New
presence of the test compound, the test compound is identi York, 1991; and Methods of Immunological Analysis, ed.
fied as being effective in inhibiting or reducing the growth or Masseyeffet al., John Wiley & Sons, New York, 1992.
infection of the hEbola virus. In a specific embodiment, the 0222 Embodiments of inventive compositions and meth
compound that inhibits or reduces the growth of the hEbola ods are illustrated in the following detailed examples. These
virus is tested for its ability to inhibit or reduce the growth rate examples are provided for illustrative purposes and are not
of other viruses to test its specificity for the hEbola virus. considered limitations on the scope of inventive compositions
0219. In one embodiment, a test compound is adminis and methods.
tered to a model animal and the model animal is infected with
the hEbola virus. In certain embodiments, a control model EXAMPLES
animal is infected with the hEbola virus without the admin Example 1
istration of a test compound. The test compound is optionally
administered before, concurrently with, or subsequent to the Newly Discovered Ebola Virus Associated with
infection with the hEbola virus. In a specific embodiment, the Hemorrhagic Fever Outbreak in Bundibugyo,
model animal is a mammal. In an even more specific embodi Uganda
ment, the model animal is, but is not limited to, a cotton rat, a 0223) In late November 2007 HF cases were reported in
mouse, or a monkey. The titer of the virus in the model animal the townships of Bundibugyo and Kikyo in Bundibugyo Dis
US 2012/025 1502 A1 Oct. 4, 2012
22

trict, Western Uganda (FIG. 1A). These samples were

assayed as described by Towner, JS, et al., PLOS Pathog, 2008 TABLE 1-continued
November;4(11): e1000212, the contents of which are incor Sample RT Virus Q- RT
porated herein by reference for methods, results, reagents, No. PCR Ag IgM IgG Isolation PCR Ct
and all other aspects of the publication. A total of 29 blood
samples were initially collected from Suspect cases and 200706292 neg neg neg neg neg neg 40
showed evidence of acute ebolavirus infection in eight speci 200706293 neg neg neg neg neg neg 40
200706294 neg neg neg neg neg neg 40
mens using a broadly reactive ebolavirus antigen capture 200706295 neg neg neg neg neg neg 40
assay known to cross-react with the different ebolavirus spe 200706296 neg neg Pos Pos neg neg 40
cies and an IgM capture assay based on Zaire ebolavirus 200706297 neg neg Pos Pos neg neg 40
reagents (Table 1). These specimens were negative when 200706298 neg Pos Pos Pos neg POS 34.83
200706299 neg neg Pos Pos neg neg 40
initially tested with highly sensitive real-time RT-PCR assays 2007O63OO neg neg neg neg neg neg 40
specific for all known Zaire and Sudan ebolaviruses and mar 2007O6301 neg neg neg neg neg neg 40
burgviruses. However, further evidence of acute ebolavirus 2007O63O2 neg Pos Pos neg neg POS 35.01
infection was obtained using a traditionally less sensitive 2007O6303 neg neg neg neg neg neg 40
2007O6304 neg neg neg neg POS POS 38.18
(relative to the real-time RT-PCR assays) but more broadly 2007O630S neg neg neg neg neg neg 40
reactive filovirus L gene-specific RT-PCR assay (1 specimen) 2007O6306 neg neg neg neg neg neg 40
(Table 1). Sequence analysis of the PCR fragment (400 bp of 200706307 neg neg neg neg neg neg 40
the virus L gene) revealed the reason for the initial failure of 2007O632O ND Pos neg neg POS POS 30.24
2007O6321 ND neg neg neg neg neg 40
the real-time RT-PCR assays, as the sequence was distinct 2007O6322 ND neg neg neg neg neg 40
from that of the 4 known species of ebolavirus, although 2007O6323 ND neg neg neg neg neg 40
distantly related to Côte d'Ivoire ebolavirus. In total, 9 of 29 2007O6324
2007O632S
ND
ND
neg
neg
neg
neg
neg
neg
neg
neg
neg
neg
40
40
specimens showed evidence of ebolavirus infection, and all 2007O6326 ND neg neg neg neg neg 40
tests were negative for marburgvirus (data not shown). 200706327 ND Pos neg neg POS POS 34.41
0224 Approximately 70% of the virus genome was rap 2007O6328 ND neg neg neg neg neg 40
idly sequenced from total RNA extracted from a patient
serum (#200706291) using a newly established metagenom
ics pyrosequencing method (454 Life Sciences) which 0226. The entire genome sequence of this virus was com
involves successive rounds of random DNA amplification. pleted using a classic primer walking sequencing approach on
Using the newly derived draft sequence, a real-time RT-PCR RNA. The complete genome of the Eb ebolavirus was not
assay specific for the NP gene of this virus was quickly available, so it too was derived by a similar combination of
developed and evaluated. The assay was shown to have excel random primed pyrosequencing and primer walking
lent sensitivity (Table 1), finding positive all the initial six approaches. Acquisition of these sequences allowed for the
samples that tested positive by either virus antigen capture first time the phylogenetic analysis of the complete genomes
(five specimens) or virus isolation assays (four specimens). of representatives of all known species of Ebola and Marburg
The antigen-capture, IgM, IgG and newly designed real-time viruses. The analysis revealed that the newly discovered virus
PCR assays were quickly transferred to the Uganda Virus differed from the four existing ebolavirus species (FIG. 1),
Research Institute during the course of the outbreak to facili with approximately 32% nucleotide difference from even the
tate rapid identification and isolation of Ebola cases in the closest relative, EboC (Table 2). Similar complete genome
affected area for efficient control of the outbreak. The out divergence (35-45%) is seen between the previously charac
break continued through late December 2007, and resulted in terized ebolavirus species.
149 suspected cases and 37 deaths. 0227 Table 2. Identity matrix based on comparisons of
0225. Table 1. Ebolavirus diagnostic results of initial 29 full-length genome sequences of Zaire ebolaviruses 1976
specimens obtained from Bundibugyo District with numeri
cal specimen numbers assigned. RT-PCR refers to results (Genbank accession number NC 002549) and 1995 (Gen
obtained from conventional PCR using the broadly reactive bank accession number AY354458), Sudan ebolavirus 2000
Filo A/B primers'. Ag., IgM, and IgG refer to results from (Genbank accession number NC 006.432), Cote d'Ivoire
ELISA-based assays' ' with Zaire ebolavirus reagents ebolavirus 1994 (SEQ ID NO: 10), Reston ebolavirus 1989
while virus isolation refers to culture attempts on Vero E6 (Genbank accession number NC 004161), and Bundibugyo
cells'. Q-RT-PCR refers to results obtained using the opti ebolavirus 2007 (SEQID NO: 1).
mized Bundibugyo ebolavirus specific real-time RT-PCR TABLE 2
assay with cycle threshold (Ct) values of positive (Pos)
samples indicated in the far right column. * Specimen Zaire Sudan EboC EboBun Reston
#200706291 is the clinical sample from which prototype 95 OO 94 O7 89
isolate #811250 was obtained.
Zaire 76 .988 577 630 632 S81
Zaire 95 577 631 .633 S81
TABLE 1. Sudan OO 577 577 .609
EboC 94 683 575
Sample RT Virus Q- RT EboBun 07 576
No. PCR Ag IgM IgG Isolation PCR Ct
200706288 neg neg neg neg neg neg 40
200706289 neg neg neg neg neg neg 40 0228. The material and information obtained from the dis
200706290 neg neg neg neg neg neg 40 covery of the new unique virus EboBun and the realization
200706291: PoS Pos neg neg POS POS 23.64 that together with EbolC these viruses represent a Glade of
Bundibungyo-Ivory Coast Ebola virus species is valuable,
US 2012/025 1502 A1 Oct. 4, 2012

and makes possible the development of clinical, diagnostic specific primers, Ebo-U 692(-) ACAAAAAGCTATCTG
and research tools directed to human hEbola infection. CACTAT (SEQ ID NO:36) and Ebo-V18269(+) CTCA
GAAGCAAAATTAATGG (SEQ ID NO: 37), generated
Material and Methods ~700 nt long fragments containing the 3' ends of either
0229. Ebolavirus Detection and Virus Isolation. genomic and antigenomic RNAs. The resulting RT-PCR
0230 Several diagnostic techniques were used for each products were analyzed by agarose electrophoresis, and DNA
sample: (i) antigen capture, IgG, and IgM assays were per bands of the correct sizes were purified using QIAquick Gel
formed as previously described' (ii) virus isolation attempts Extraction Kit (Qiagen) and sequenced using standard proto
were performed on Vero E6 cells and monitored for 14 days; cols (ABI).
(iii) RNA was extracted and tested for Zaire' and Sudan 0234. The nucleotide sequence of the Cote d'Ivoire ebo
ebolavirus and marburgvirus' using real-time quantitative lavirus (EbolC) isolate RNA was initially determined using
RT-PCR assays designed to detect all known species of each the exact same pyrosequencing strategy as that used for
respective virus species the primers/probe for the Sudan ebo Bundibugyo ebolavirus described above. This method gener
lavirus assay were EboSudBMG 1 (+)5'-GCC ATG GITTCA ated sequence for approximately 70% of the entire genome.
GGTTTG AG-3' (SEQ ID NO: 21), EboSudBMG 1(-) This draft sequence was then used to design a whole genome
5'-GGT IAC ATT GGG CAA CAATTCA-3' (SEQ ID NO: primer walking strategy for filling any gaps and confirming
22) and Ebola Sudan BMG Probe 5'FAM-AC GGT GCA the initial sequence. The following Cote d'Ivoire ebolavirus
CAT TCT CCTTTT CTCGGA-BHQ1 (SEQ ID NO. 23): specific primers were used to generate RT-PCR fragments,
(iv) the conventional RT-PCR was performed with the filo designated A-F, as follows: Fragment A (predicted size 3.0
A/B primer set as previously described'using Superscript III kb) was amplified using forward-GTGTGCGAATAACTAT
(Invitrogen) according to the manufacturer's instructions. GAGGAAG (SEQ ID NO: 38) and reverse-GTCTGTG
The specimen 200706291 was selected as the reference CAATGTTGATGAAGG (SEQ ID NO. 39): Fragment B
sample for further sequence analysis. (predicted size 3.2 kb) was amplified using forward-CAT
0231 Genome Sequencing. GAAAACCACACTCAACAAC (SEQ ID NO: 40) and
0232 Pyrosequencing was carried out utilizing the reverse-GTTGCCTTAATCTTCATCAAGTTC (SEQ ID
approach developed by 454 Life Sciences, and the method NO: 41); Fragment C (predicted size 3.0 kb) was amplified
described by Cox-Foster et al. Subsequent virus whole using forward-GGCTATAATGAATTTCCTCCAG (SEQ ID
genome primer walking was performed as previously NO: 42) and reverse-CAAGTGTATTTGTGGTCCTAGC
described' but using the primers specific for Bundibugyo (SEQ ID NO: 43); fragment D (predicted size 3.5 kb) was
ebolavirus RT-PCR amplification. In total, the entire virus amplified using forward-GCTGGAATAGGAATCACAGG
genome was amplified in six overlapping RT-PCR fragments (SEQID NO:44) and reverse-CGGTAGTCTACAGTTCTT
(all primers listed 5' to 3'): fragment A (predicted size 2.7 kb) TAG (SEQ ID NO: 45); fragment E (predicted size 4.0 kb)
was amplified using forward-GTGAGACAAAGAATCAT was amplified using forward-GACAAAGAGATTAGATT
TCCTG (SEQ ID NO: 24) with reverse-CATCAATTGCT AGCTATAG (SEQ ID NO: 46) and reverse-GTAAT
CAGAGATCCACC (SEQ ID NO: 25); fragment B (pre GAGAAGGTGTCATTTGG (SEQ ID NO: 47); fragment F
dicted size 3.0 kb) was amplified using forward (predicted size 2.9 kb) was amplified using forward-CAC
CCAACAACACTGCATGTAAGT (SEQ ID NO: 26) with GACTTAGTTGGACAATTGG (SEQ ID NO: 48) and
reverse-AGGTCGCGTTAATCTTCATC (SEQ ID NO: 27); reverse-CAGACACTAATTAGATCTGGAAG (SEQID NO:
fragment C (predicted size 3.5 kb) was amplified using for 49); fragment G (predicted size 1.3 kb) was amplified using
ward-GATGGTTGAGTTACTTTCCGG (SEQ ID NO: 28) forward-CGGACACACAAAAAGAAWRAA (SEQID NO:
with reverse-GTCTTGAGTCATCAATGCCC (SEQID NO: 50) and reverse-CGTTCTTGACCTTAGCAGTTC (SEQ ID
29); fragment D (predicted size 3.1 kb) was amplified using NO: 51); and fragment H (predicted size 2.5 kb) was ampli
forward-CCACCAGCACCAAAGGAC (SEQ ID NO:30) fied using forward-GCACTATAAGCTCGATGAAGTC
with reverse-CTATCGGCAATGTAACTATTGG (SEQ ID (SEQID NO:52) and reverse-TGGACACACAAAAARGA
NO: 31); fragment E (predicted size 3.4 kb) was amplified RAA (SEQ ID NO. 53). A gap in the sequence contig was
using forward-GCCGTTGTAGAGGACACAC (SEQ ID located between fragments C and D and this was resolved
NO: 32) with reverse-CACATTAAATTGTTCTAACATG using the following primers to generate a predicted fragment
CAAG (SEQID NO: 33) and fragment F (predicted size 3.5 of 1.5 kb: forward-CTGAGAGGATCCAGAAGAAAG
kb) was amplified using forward-CCTAGGTTATTTA (SEQID NO:54) and reverse-GTGTAAGCGTTGATATAC
GAAGGGACTA (SEQID NO:34) with reverse-GGT AGA CTCC (SEQID NO:55). The terminal-20 nucleotides of the
TGTATTGACAGC AAT ATC (SEQID NO:35). sequence were not experimentally determined but were
0233. The exact 5' and 3' ends of Bundibugyo ebolavirus inferred by comparing with the other known Ebola genome
Sequences.
were determined by 3' RACE from virus RNA extracted from
virus infected Vero E6 cell monolayers using TriPure isola 0235 Bundibugyo ebolavirus Real-Time RT-PCR Assay.
tion reagent. RNAS were then polyadenylated in vitro using 0236. The primers and probe used in the Bundibugyo ebo
A-Plus poly(A) polymerase tailing kit (Epicenter Biotech lavirus specific Q-RT-PCR assay were as follows: Ebol J965
nologies) following the manufacturer's instructions and then (+): 5'-GAGAAAAGGCCTGTCTGGAGAA-3' (SEQ ID
purified using an RNeasy kit (Qiagen) following standard NO:56), Ebol J1039(-): 5'-TCGGGTATTGAATCAGACCT
protocols. Ten microliters of in vitro polyadenylated RNA TGTT-3' (SEQ ID NO. 57) and EboU989 Prb: 5'Fam
were added as template in RT-PCR reactions, using Super TTCAACGACAAATCCAAGTGCACGCA-3BHQ1 (SEQ
Script III One-Step RT-PCR system with Platinum Taq High ID NO 58). Q-RT-PCR reactions were set up using Super
Fidelity (Invitrogen) following the manufacturer's protocol. script III One-Step Q-RT-PCR (Invitrogen) according to the
Two parallel RT-PCR reactions using the oligo(dT)-contain manufacturer's instructions and run for 40 cycles with a 58°
ing 3"RACE-AP primer (Invitrogen) mixed with 1 of 2 viral C. annealing temperature.
US 2012/025 1502 A1 Oct. 4, 2012
24

0237 Phylogenetic Analysis. Animals in the three experimental groups are vaccinated with
0238 Modeltest 3.7 was used to examine 56 models of either: 1) 2 ml orally (OR) (n=4); 2) 1 ml dripped into each
nucleotide Substitution to determine the model most appro nostril, intranasally (IN) (n=4); or 3) 1 ml each into two sites
priate for the data. The General Time Reversible model incor intramuscularly (IM) (n=2). The two controls are injected
porating invariant sites and a gamma distribution (GTR--I--G) intramuscularly with 2 ml of 1x107 PFU/ml of VSVAG/
was selected using the Akaike Information Criterion (AIC). MARVGP. All animals are challenged intramuscularly 28
Nucleotide frequencies were A=0.3278, C=0.2101, G=0. days later with 1,000 PFU of EboBun.
1832, T=0.2789, the proportion of invariant sites=0.1412, 0243 Routine examination is conducted on 0, 2, 4, 6, 10,
and the gamma shape parameter 1.0593. A maximum like 14 and 21 days post-vaccination, then 0, 3, 6, 10, 14, 19, 26
lihood analysis was subsequently performed in PAUP 4. days, 6 and 9 months after the EboBun challenge. For the
Ob10" using the GTR--I+G model parameters. Bootstrap examinations animals are anaesthetized by intramuscular
Support values were used to assess topological Support and injection with 10 mg/kg of ketaset (Ayerst). Examinations
were calculated based on 1,000 pseudoreplicates'. include haematological analysis, monitoring temperature
0239. In addition, a Bayesian phylogenetic analysis was (rectal), respiration rate, lymph nodes, weight, hydration,
conducted in MrBayes 3.2° using the GTR+I+G model of discharges and mucous membranes. Also, Swabs (throat, oral,
nucleotide Substitution. Two simultaneous analyses, each nasal, rectal, vaginal) and blood samples are collected (4 ml
with four Markov chains, were run for 5,000,000 generations from femoral vein, 1 ml in EDTA vacutainer tube; 3 ml in
sampling every 100 generations. Prior to termination of the serum separator vacutainer tube). Cynomolgus monkey
run, the AWTY module was used to assess Markov Chain PBMCs are isolated using BD CPT sodium citrate Vacutain
Monte Carlo convergence to ensure that the length of the ers (Becton Dickinson) as per manufacturer's protocol.
analysis was sufficient’. Trees generated before the stabili 0244 All VSVAG/EboBunCP immunized animals are
zation of the likelihood scores were discarded (burn in 40), protected from high dose challenge. These animals show no
and the remaining trees were used to construct a consensus evidence of clinical illness after vaccination or EboBunchal
tree. Nodal support was assessed by posterior probability lenge. Both control animals demonstrate typical symptoms
values (>95-statistical support). associated with EboBun HF including fever, macular rashes,
lethargy, and unresponsiveness. Continued infection requires
Example 2 euthanization. Hematology analyses at each examination
Immunization against EboBun date demonstrate increases in the platelet-crit in the OR and
IN groups post-challenge, however, no significant changes
0240. To determine the capability of immunogens to elict are observed in any NHPs post-immunization or in the
an immune response in non-human primates (NHP), 12 cyno VSVAG/EboBunCP immunized NHPs post-challenge.
molgus macaques, of which 10 are immunized with VSVAG/ 0245 EboBun antibody production from humoral anti
EboBunCP either orally (OR; n=4), intranasally (IN; n=4) or body response to vaccination and challenge is examined by a
intramuscularly (IM; n=2) in accordance with all animal con virus like particle (VLP) based ELISA assay. Generation of
trol and safety guidelines and essentially as described by Qiu, EboBun VLPs is performed by the protocol for ZEBOV as
X, et al., PLoS ONE. 2009; 4(5): e5547. The remaining 2 described by Wahl-Jensen, V., et al., J Virol, 2005: 79(4):
control animals are vaccinated intramuscularly with VSVAG/ 2413-2419. ELISA is performed by the protocol described by
MARVGP VSVAG/MARVGP does not provide heterolo Qiu, X, et al., PLoS ONE. 2009; 4(5): e5547.
gous protection against EboBun, therefore these NHPs suc 0246 The VSVAG/MARVGP immunized animals do not
cumb to EboBun infection. Animals are acclimatized for 14 develop a detectable antibody response to EboBun. In con
days prior to infection. Animals are fed and monitored twice trast, potent antibody responses are detected in all VSVAG/
daily (pre- and post-infection) and fed commercial monkey EboBunCP immunized animals independent of immuniza
chow, treats and fruit. Husbandry enrichment consists of tion route. Between days 14 and 21 post-vaccination, all
commercial toys and visual stimulation. VSVAG/EboBunCPimmunized NHPs develop high levels of
0241. The recombinant VSVAG/EboBun vaccines are IgA, IgM, and IgG against EboBunCP. After challenge the
synthesized expressing the EboBunglycoprotein (GP) (SEQ IgM titres do not exceed the post-vaccination levels, however,
ID NO: 9), soluble glycoprotein (sGP) (SEQ ID NO: 4), or IgG and IgA antibody titres are increased peaking 14 days
nucleoprotein (NP) (SEQID NO:3). Control VSVAG/MAR post-challenge then slowly decreasing before maintaining a
VGP vaccines represent the analogous proteins from Lake relatively high antibody titre up to 9 months.
victoria marburgvirus (MARV) (strain Musoke). The follow 0247 The level of neutralization antibodies is detected by
ing results for GP are similar for SGP and NP. Vaccines are a EboBun-GFP flow cytometric neutralization assay in serum
generated using VSV (Indiana serotype) as described previ collected at days 0 and 21 post-vaccination. Samples are
ously. Garbutt, M, et al., J. Virol, 2004; 78(10):5458-5465; assayed in duplicate for their ability to neutralize an infection
Schnell, MJ, et al., PNAS USA, 1996: 93(21): 11359-11365. with EboBun-GFP in VeroE6 cells. Serially diluted serum
EboBunchallenge virus is passaged in Vero E6 cells prior to samples are incubated with an equal volume of EboBun-GFP
challenge, as described previously Jones, S M, et al., Nat in DMEM, at 37° C., 5% CO, for 1 hr followed by addition of
Med, 2005; 11(7):786-790; Jahrling, PB, et al., J Infect Dis, 150 ul per well of a confluent 12 well plate of VeroE6 cells
1999; 179 (Suppl 1): S224-34. An EboBun immunogen pep (MOI=0.0005). After 2 hours at 37° C., 5% CO, 1 ml of
tide pool consisting of 15mers with 11 amino acid overlaps DMEM, 2% fetal bovine serym (FBS), 100 U/ml penicillin,
(Sigma-Genosys) spanning the entire sequence of the 100 ug/ml streptomycin is added per well and incubated for 5
EboBun immunogens and strain Mayinga 1976 GP are used. days. Cells are harvested by removing the culture Superna
0242 Twelve filovirus naive cynomolgus monkeys ran tant, washing with 1 ml PBS, 0.04% EDTA, then adding 800
domized into four groups receive 2 ml of 1x107 PFU/ml of ul of PBS 0.04% EDTA for 5 minutes at 37° C. before adding
vaccine in Dulbecco's modified Eagle's medium (DMEM). 8 ml PBS, 4% paraformaldehyde (PFA) and overnight incu
US 2012/025 1502 A1 Oct. 4, 2012

bation. The cells are acquired (10,000 events) and analyzed tions in OR and IN inoculation routes demonstrate the great
with CellOuest Pro V3.3 on a Becton Dickinson FACSCalibur est potential for proliferation and IFN-Y production post
flow cytometer. challenge.
0248. The OR and IN routes produce EboBunCP-specific 0254 Any patents or publications mentioned in this speci
neutralizing antibodies with the OR route producing the high fication are incorporated herein by reference to the same
est titres post-vaccination. The IM immunization produces extent as if each individual publication is specifically and
detectable levels of neutralizing antibody. In comparison, 3/4 individually indicated to be incorporated by reference.
NHPs in the OR group demonstrate a 50% reduction in 0255. The compositions and methods described herein are
EboBun-GFP positive cells at a titre of 1:40. Similarly, the IN presently representative of preferred embodiments, exem
route results in a reduction of EboBun-GFP positive cells at plary, and not intended as limitations on the scope of the
the 1:40 dilution. invention. Changes therein and other uses will occur to those
0249 EboBunCP-specific effector cellular immune skilled in the art. Such changes and other uses can be made
responses are determined using IL-2 and IFN-y ELISPOT without departing from the scope of the invention as set forth
assays as described by Qin, X, et al., PLoS ONE. 2009; 4(5): in the claims. All numerical ranges are inclusive of the whole
e5547 to determine the number of IL-2 and IFN-y secreting integers and decimals between the endpoints, and inclusive of
lymphocytes. Prior to challenge on days 10 to 14 post-vacci the endpoints.
nation there is a detectable EboBun immunogen-specific REFERENCES
IFN-Y response in all immunized animals. The IM route is the
most potent, inducing approximately 2-fold more IFN-y (0256 1. Suzuki, Y., and Gojobori, T., (1997) The origin
secreting cells than OR (p<0.001) or IN (p=0.043) routes. A and evolution of Ebola and Marburg viruses. Mol Bio Evol.
strong post-challenge secondary IFN-Y response is induced in 14(8): 800-806.
all VSVAG/EboBun immunized animals with the IM route 0257 2. Sanchez, A., Geisbert, T. W., Feldmann, H. in
producing the most IFN-Y cells at day 6. By day 10 the OR Fields Virology (ed. Knipe, D. M., Howley, P. M.) 1409
group demonstrates a stronger response. The IFN-Y in the IN 1448 (Lippincott Williams and Wilkins, Philadelphia,
group rises steadily, peaking at day 26 post-challenge with 4.3 2007).
and 2 fold more EboBun specific IFN-y secreting cells than (0258. 3. Leroy, E. M. et al., (2005) Fruit bats as reservoirs
the IM (p=0.003) and OR (p=0.075) group, respectively. All of Ebola virus. Nature, 438,575-6.
three routes produce strong EboBun-specific IFN-y (0259 4. Towner, J. S. et al., (2007) Marburg virus infec
responses. tion detected in a common African bat. PLoS ONE, 208),
0250 Post-vaccination, the IM group also has more e764.
EboBunCP-specific IL-2 secreting cells than either of the 0260 5. Swanepoel, R. et al., (2007) Studies of reservoir
mucosally immunized groups. Post-challenge, the IM route hosts for Marburg virus. Emerg Infect Dis, 13(12), 1847
continues to dominate early after challenge peaking on day 51.
10. This difference shows a trend when compared to the IN 0261 6. Le Guenno, B. et al., (1995) Isolation and partial
group (p=0.067) and is significant when compared to the OR characterization of a new species of Ebola virus. Lancet,
group (p<0.001). Additionally, the INgroup has more IL-2 345(8960), 1271-4.
producing cells than the OR group (p=0.090) on day 10 0262 7. Ksiazek, T. G. et al. (1999) Clinical virology of
post-challenge. By day 26 post-challenge all three routes Ebola hemorrhagic fever (EHF): virus, virus antigen, IgG
continue to produce a EboBunCP-specific IL-2 response, and IgM antibody findings among EHF patients in Kikwit,
however, the INgroup response is strongest. At day 26 post 1995. J. Infect Dis 179 (suppl 1), S177-S187.
challenge the INgroup has the most potent IFN-Y and IL-2 0263 8. Cox-Foster, D. L. et al. (2007) A metagenomic
responses, as well as the highest IgA and IgG antibody titre, survey of microbes in honeybee colony collapse disorder.
indicating this immunization route, followed by a EboBun Science 318, 283-7.
challenge, results in the development of potent and Sustained 0264. 9. World Health Organization (2008) Ebola out
effector responses. break contained in Uganda. Features, 22 February, www.
0251. Absolute lymphocyte numbers for CD3", CD4", who.int/features/2008/ebola outbreak/en/.
and CD8" (CD3"4) T cell populations are determined by 0265 10. Sullivan, N.J., Sanchez, A., Rollin, P. E., Yang,
flow cytometry. No decrease is observed in the lymphocyte Z.-Y. & Nabel, G.J. (2000) Development of a preventive
populations for any of the VSVAG/EboBunCP vaccinated vaccine for Ebola virus infection in primates. Nature 408,
NHPs. In contrast, control animals who are not protected 605-609.
from EboBun show lymphocyte numbers decreased by 0266 11. Ksiazek, T.G., West, C. P. Rollin, P. E., Jahrling,
28-57%. P. B. & Peters, C.J. (1999) ELISA for the detection of
0252 Macrophage numbers are slightly increased in con antibodies to Ebola viruses. J. Infect Dis 179 (suppl 1),
trol animals. However, the number of CD14" cells is greater S191.-S198.
in the VSVAG/EboBunCP vaccinated groups with the IM 0267. 12. Rodriguez, L. et al. (1999) Persistence and
route showing the most significant increases. genetic stability of Ebola virus during the outbreak in Kik
0253) In order to determine the long term immune wit, Zaire 1995. J. Infect Dis 179 (suppl 1), S170-S176.
response after challenge, EboBunCP-specific CD4 and 0268 13. Sanchez, A. etal. Detection and molecular char
CD8 memory T-lymphocytes are examined for their ability acterization of Ebola viruses causing disease in human and
to proliferate (CFSE) or produce IFN-Y in response to nonhuman primates.J. Infect Dis 179 (suppl 1), S164-S169
EboBunCP peptides at 6 months post-vaccination. (1999).
EboBunCP-specific memory responses are observed as a 0269. 14. Jones, S.M. et al. (2005) Live attenuated recom
result of vaccination followed by a ZEBOV challenge. These binant vaccine protects nonhuman primates against Ebola
responses persist for at least 6 months. The memory popula and Marburg viruses. Nat Med 11, 786-90.
US 2012/025 1502 A1 Oct. 4, 2012
26

(0270. 15. Geisbert, T. W. et al. (2008) Recombinant (0274) 19. Swofford, D. L. (2002) PAUP*: phylogenetic
vesicular stomatitis virus vector mediates postexposure analysis using parsimony (and other methods) version
protection against Sudan Ebola hemorrhagic fever in non 4.0b 10. Sinauer Assoc., Sunderland, Mass.
human primates. J Virol 82, 5664-8. (0275 20. Felsenstein, J. (1985) Confidence limits on phy
(0271) 16. Towner, J.S., Sealy, T. K. Ksiazek, T. & Nichol, logenies: an approach using the bootstrap. Evolution 39,
S.T. (2007) High-throughput molecular detection of hem 783-791.
orrhagic fever virus threats with applications for outbreak
settings. J. Inf Dis 196 (suppl 2), S205-212. (0276) 21. Ronquist, F. & Huelsenbeck, J. P. (2003)
0272. 17. Towner, J.S. et al. (2006) Marburgvirus genom MRBAYES 3: Bayesian phylogenetic inference under
ics and association with a large hemorrhagic fever outbreak mixed models. Bioinformatics 19, 1572-1574.
in Angola. J Virol 80,6497-516. (0277. 22. Nylander, J. A. A., Wilgenbusch, J. C., Warren,
(0273) 18. Posada, D. & Crandall, K. A. (1998) MODELT D. L. & Swofford, D. L. (2008) AWTY (are wethere yet?):
EST: testing the model of DNA substitution. Bioinformat a system for graphical exploration of MCMC convergence
ics 14, 817-818. in Bayesian phylogenetics. Bioinformatics 24, 581-583.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 59

<21 Os SEQ ID NO 1
&211s LENGTH: 1894 O
&212s. TYPE: DNA
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221s NAMEAKEY: misc feature
<223> OTHER INFORMATION: Full viral sequence
<4 OOs SEQUENCE: 1
cggacacaca aaaagaatga aggattittga at ctittattgttgcgagta actacgagga 60

agattaaaga tttitcct ct c attgaaattgaaattgagat totaatctog acggat.cgat 12O

ccc caat acc aa cactgaga attggcc toga agaagt catc togct cottgg caaaac caag 18O
agcaggcc.ca aagggc.catt aggccacat C totgagcct gcagaacacg Caggacttac 24 O

ttagcagaag agagcgc.gtg cc.gaalaccag ccaacaaatt gacacagotg ct cact ctga 3 OO

ccctgaattic at aaacaata ttaagttgac aacagagata ctaatccaat atttggat.ca 360

agaatcaaaa tagtgaaacg actgactatic cct c cittaga attagcaaag at cottttgt 42O

agact attgt gctacattct citatic caaga cct caaaatg gatcct cq t c caat cagaac 48O
Ctggatgatg catalacacat ctgaagttga agcagactac catalagattic talactg.ccgg 54 O

attgtc.cgt.c cagolaaggca ttgtgagaca aagaat catt cotgtttacc aaatct caaa 6 OO

Cctggaggaa gtatgtcaac to at Cataca ggcatt.cgag gctggcgt.cg actticoagga 660
tag tigcagat agcttitttgt taatgctatgtctgcatcat go citat caag gggattataa 72O
acaatttittg gaaagtaatg cggtaaaata ccttgaaggt catggattcc gttittgagat 78O

gaagaaaaag galaggtgtca agcgc.ctgga ggaact actic cctgctgcct cagtggaaa 84 O

galacat Caag agaac attgg ctgcaatgcc caggaggala acaacagaag caaatgctgg 9 OO

acaatttctt to atttgcta gtctgtttct cocaaaattig gttgtcggag aaaaggcctg 96.O

totggagaag gttcaacgac aaatcCaagt gcacgcagaa caaggt ctga ttcaat accc 102O
gacat Cttgg caatcggtgg gaCatatgat ggtcatCtt C agactaatgc galacca actt 108O
cctgattaag titcct cotaa tacat caagg aatgcatatg gttgcagggc atgatgctaa 114 O

tgatgcc.gtc attgccaact ctdtagctica agct cottt c to cqgattgt tdatagt caa 12 OO

aacagtgctt gat catat co to caaaaaac agagcacgga gttcgc.ctgc atcc cttggc 1260

gcgalacagcc aaagttcaaaa atgaggtgag ct cttittaag gcc.gctittag cct cactago 132O

US 2012/025 1502 A1 Oct. 4, 2012
30

- Continued

ctictaataat cotaattacc ttcaaaaatc tagaactitta ttaattctica ggg tatttag 822 O

aacago caga tigacittgact aagtttgtac totaataaaa agatacttga tigaagattaa 828O

gaaaaagaca gtc.ttgttgat tdt cactaat citt catctoa aaa.cat atta ttttaccaga 834 O
agctactata gcc tacct cottgacacata gcaaaccitta ct catgttga taattgtttg 84 OO

cctgct attt acatatttac taact tacaa aattatc.ttggggatttctic tdaacatata 846 O

atcaga attg gcatttaaaa cacaagttag ticcitaatgga ct cattt cat gagagagggc 852O
gtag cagaac tatt cacag agtgcaa.gag atgggcc.gag ticatcaagta agaacaagat 858 O

catcct coag agacagocac cqcagcgaat at catacacic taggagctict tcc caagttc 864 O

gagt ccc.gac tdtgttt cat cqgaag.cgta citgattctitt gacagttcca ccago accala 87OO

agga catatg tcc tacctta aggaaaggat ttttgttgttga cagcaattitt totaaaaagg 876O

accatcaact agaaagttta acagataggg agctgcttitt gctgattgca C9gaaaacct 882O

gcc.gct coct tdaacaacaa ttgaa catca citgct cotaa agatacacga ttagdaaatc 888 O
caattgcaga tigattt coaa caaaaagacg gcc caaaaat tacactattg acacttittgg 894 O

agactg.cgga gtattggt ca aaacaagata t caagggcat tatgactica agactalaga.g 9 OOO

cattactaac cctttgttgcc gttcatgacga gqaaatticto aaaatcc cag cittagt citat 906 O

tgtgtgagag ticatctacga Cagaagggc tagga cagga t caat Cagala t ctgttcttg 912 O

aagtgitat ca gcgcttacat agcgacaaag gcggaaattt taggcagcc ctatggcaac 918O

aatggg accq acagtic ctitg at catgttta taa.ca.gcatt tottaatatt gotttacaat 924 O

taccctgtga aagttcatct gttgttattt caggattaag gctgctagtg cct caat cag 93 OO

aagataccga gacct Caacc tacaccgaga cacgtgcatg gtcagaggala ggtggcc.ccc 936 O

attaa.catct tccacagt cq aatctaccat aattt cocta ttcaacgcag ataagaatca 942O

gtactaaacc acaagtgcaa aaattaacaa alacaccagoa taagtgaaat cct gttctgtg 948O
attagdaaca cqaatgat ct t caatcctgt togcaatt cqc cagtgataat td tatt caca 954 O

ttgttggccac aatatact.gt Cittitt cocat tdaaaaataa godtgaatct attacgctac 96.OO

acaaacttac aggattagca ccacgacggc ticaatact at acctattggit cacggct cqa 966 O

tgttgttaatc actitat attg tatt catttgaaattactica ttaggcaaat actittgatta 972 O

agaaaaaata attggaaaac cagaaaatcc ctagg tattt aaatticcitat citc.cggagat 978 O.

cc.gagata at taatcaagca atgagggaac aatggtgaac aacaa.cat at tittgcc.ccc 984 O

tittagattgg tdagttccaa aaacaagtga tigaagattaa to agatgtc. Caaggalacac 9900

at atttgttga tittaaacgtt coagttagac totgttcaag gat citt catc titttgtagct 996 O

c cactctgag to acaa cata attgagttitt togct cagaac agittatcagg attaa attct 10 O2O
citcaaataac togaaac tact agcatcactic tica attt cat tacttacgac aat cattat c 10O8 O
ttaataat at ttctictaaat tactgacitta attagcttgt aat cagataa tat cqaaacc 1014 O
aattitat cat aaggcataat ttgtataagt gatttaggat ttaccc.caga agtgaaataa 102OO
ttcttagaat aaaagaccga citagaatat c cittaaggctg. tctaacgtgc cacacagota 1026 O
gggittagcct gacatctgga acaagat.cga tactaatata gggatttgtt toatact agc 1032O
t citctgcaaa cacaatggct aaggcaa.cag gtagg tacaa cittggitttca cctaaaaagg 1038 O
acct cq agag gggg.cttgtt ttgagtgatt tdtgcacgtt tittagttgat cagacitatcc 1044 O
US 2012/025 1502 A1 Oct. 4, 2012
34

- Continued

taac cctdca tdgttcactg accagaaatc tagaatc.ccc acacaagttg agattatgac 734 O

tatggatgct gaaacgacag aaaat attaa toggtcaaaa ttatatgagg c tatt cagoa 74 OO

attaattgtt toacacattg ataca agggit gctaaagatt gtt attataa aggtttittitt 746 O

aagtgatatt gaaggit ct co tdtggcttaa taccatctt gcc cc tittat t cqgatc.cgg 752O

ctatttaatt aaacct atta citt coagt cc aaagttcaagc gaatgg tact tatgtctitt c 758 O
aaattitcc tt toagcct ct c gacgacggcc ticatcagggit catgctacct g tatgcaagt 764 O
catccaaaca gcgctacgac tocaagttcaaaggagttca tactggctta gcc atttagt 77OO

gcaatatgct gat attaatt togcacttgag titatgttaat ttgggtttcc citt cattgga 776 O.

aaaggttctt taccatcgat at aacctagt tdatt cacgg aagggtccac tdgtotcgat 782O

c ctittaccat ttaacacact togcaa.gcaga gattagagaa ttagtgtgtg actataatca 788 O

gcaacgacaa agt cqaac cc aaa catacca citt catcaaa acgacaaagg gcc.ggattac 794 O

aaaattagtic aatgact acc ttaaattitta t ct cqtagtg caa.gcactga agcataattg 8 OOO

t ctittggcag gaagaactica gaacact tcc tdacttaatc aatgtttgca atcgattitta 806 O

c catataagg gactgct cat gtgaagat.cg atttittaatt caaactic titt actta accc.g 812 O
tatgcaagac tdagaa.gcaa aattaatgga gagattalacc gggtttctag gattgtatic C 818O

taatgg tatt aacgcttaag atc.ccct tag aggcatcgca atatgactic caaacattaaa 824 O

tgat attgct gtcaatacat citacctgacc gaga.gcaagg titt attataa aaaacctata 83OO

Cacatgactg caatgcgtaa titt at accga aac acagtga gggctgcaca to aggttcC 8360
tgttgagctt taaaagat.ca togcaatataa aatgatattt gtatactaat catgttagta 842O

ctaactaa.ca gtact cactg catatact ct atcaattaag aaaaattact gtggitt tatg 848 O

catttaaatg acat cacaga tiggatataat at agittaatt cittacctaaa tdttgagtta 854 O

tagtaatttgaagittata at tatgattagt gcttatacta taaataatag ctataccaag 86OO

tatacacaag aagttatgat tttgt attcaaattatatto acaggaactt gtgattaata 866 O

ataaaagt ct cagttgttgg ttgttgagtt gtaaaacticc cqttaaaaat ttattitt coa 872O

cittataacta ataataatca tagat cagta tdagttgagg ctatt caaac cittagaaaaa 878 O.

ttgttgcgatgtttitttacca tdt caatctt gatttcaatig at attggagg gcttgtcgat 884. O

aaatticagta attaac atta agt cagtgtg gaacct catt ggatatttga t cqtacacaa 89 OO

aatat ctitta caaaattgtt ttct citttitt tdtgttgtc.ca 894 O

<210s, SEQ ID NO 2
&211s LENGTH: 221 O
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Bundibugyo ebolavirus L. viral protein
<4 OOs, SEQUENCE: 2

Met Ala Thr Gln His Thr Glin Tyr Pro Asp Ala Arg Lieu Ser Ser Pro
1. 5 1O 15

Ile Val Lieu. Asp Gln Cys Asp Lieu Val Thr Arg Ala Cys Gly Lieu. Tyr
2O 25 3O

Ser Ser Tyr Ser Lieu. ASn Pro Glin Lieu Lys Asn. Cys Arg Lieu Pro Llys
35 4O 45
US 2012/025 1502 A1 Oct. 4, 2012
35

- Continued

His Ile Tyr Arg Lieu Lys Phe Asp Ala Thr Val Thr Llys Phe Lieu. Ser
SO 55 6O

Asp Val Pro Ile Val Thr Lieu Pro Ile Asp Tyr Lieu. Thr Pro Leu Lieu.
65 70 7s 8O

Lieu. Arg Thr Lieu. Ser Gly Glu Gly Lieu. Cys Pro Val Glu Pro Llys Cys
85 90 95

Ser Glin Phe Lieu. Asp Glu Ile Val Ser Tyr Val Lieu. Glin Asp Ala Arg
1OO 105 11 O

Phe Lieu. Arg Tyr Tyr Phe Arg His Val Gly Val His Asp Asp Asn. Wall
115 12 O 125

Gly Lys Asn. Phe Glu Pro Llys Ile Lys Ala Lieu. Ile Tyr Asp Asn. Glu
13 O 135 14 O

Phe Lieu. Glin Glin Lieu. Phe Tyr Trip Tyr Asp Lieu Ala Ile Lieu. Thir Arg
145 150 155 160

Arg Gly Arg Lieu. Asn Arg Gly Asn. Asn Arg Ser Thir Trp Phe Ala Asn
1.65 17O 17s

Asp Asp Lieu. Ile Asp Ile Lieu. Gly Tyr Gly Asp Tyr Ile Phe Trp Llys
18O 185 19 O

Ile Pro Lieu. Ser Lieu Lleu Ser Lieu. Asn Thr Glu Gly Ile Pro His Ala
195 2OO 2O5

Ala Lys Asp Trp Tyr His Ala Ser Ile Phe Lys Glu Ala Val Glin Gly
21 O 215 22O

His Thr His Ile Val Ser Val Ser Thr Ala Asp Val Lieu. Ile Met Cys
225 23 O 235 24 O

Lys Asp Ile Ile Thr Cys Arg Phe Asn. Thir Thr Lieu. Ile Ala Ala Lieu.
245 250 255

Ala Asn Lieu. Glu Asp Ser Ile Cys Ser Asp Tyr Pro Gln Pro Glu Thr
26 O 265 27 O

Ile Ser Asn Lieu. Tyr Lys Ala Gly Asp Tyr Lieu. Ile Ser Ile Lieu. Gly
27s 28O 285

Ser Glu Gly Tyr Llys Val Ile Llys Phe Lieu. Glu Pro Lieu. Cys Lieu Ala
29 O 295 3 OO

Lys Ile Glin Lieu. Cys Ser Asn Tyr Thr Glu Arg Lys Gly Arg Phe Lieu.
3. OS 310 315 32O

Thr Glin Met His Lieu. Ala Wall Asn His Thir Lieu. Glu Glu Lieu. Ile Glu.
3.25 330 335

Gly Arg Gly Lieu Lys Ser Glin Glin Asp Trp Llys Met Arg Glu Phe His
34 O 345 35. O

Arg Ile Lieu Val Asn Lieu Lys Ser Thr Pro Glin Gln Lieu. Cys Glu Lieu
355 360 365

Phe Ser Val Glin Lys His Trp Gly His Pro Val Lieu. His Ser Glu Lys
37 O 375 38O

Ala Ile Glin Llys Val Llys Llys His Ala Thr Val Ile Lys Ala Lieu. Arg
385 390 395 4 OO

Pro Val Ile Ile Phe Glu Thr Tyr Cys Val Phe Lys Tyr Ser Ile Ala
4 OS 41O 415

Lys His Tyr Phe Asp Ser Glin Gly Ser Trp Tyr Ser Val Ile Ser Asp
42O 425 43 O

Lys His Lieu. Thr Pro Gly Lieu. His Ser Tyr Ile Lys Arg Asin Glin Phe
435 44 O 445
US 2012/025 1502 A1 Oct. 4, 2012
36

- Continued
Pro Pro Leu Pro Met Ile Lys Asp Lieu. Leu Trp Glu Phe Tyr His Leu
450 45.5 460

Asp His Pro Pro Leu Phe Ser Thr Lys Ile Ile Ser Asp Leu Ser Ile
465 470 47s 48O

Phe Ile Lys Asp Arg Ala Thr Ala Val Glu Lys Thr Cys Trp Asp Ala
485 490 495

Val Phe Glu Pro Asn Val Lieu. Gly Tyr Ser Pro Pro Asn Llys Phe Ser
SOO 505 51O

Thr Lys Arg Val Pro Glu Glin Phe Leu Glu Gln Glu Asn Phe Ser Ile
515 52O 525

Asp Ser Val Lieu. Thir Tyr Ala Glin Arg Lieu. Asp Tyr Lieu. Lieu Pro Glin
53 O 535 54 O

Tyr Arg Asn. Phe Ser Phe Ser Lieu Lys Glu Lys Glu Lieu. Asn Val Gly
5.45 550 555 560

Arg Ala Phe Gly Lys Lieu Pro Tyr Pro Thr Arg Asn Val Glin Thr Lieu.
565 st O sts

Cys Glu Ala Lieu. Lieu Ala Asp Gly Lieu Ala Lys Ala Phe Pro Ser Asn
58O 585 59 O

Met Met Val Val Thr Glu Arg Glu Gln Lys Glu Ser Lieu. Lieu. His Glin
595 6OO 605

Ala Ser Trp His His Thr Ser Asp Asp Phe Gly Glu Asn Ala Thr Val
610 615 62O

Arg Gly Ser Ser Phe Val Thr Asp Lieu. Glu Lys Tyr Asn Lieu Ala Phe
625 630 635 64 O

Arg Tyr Glu Phe Thr Ala Pro Phe Ile Glu Tyr Cys Asn Arg Cys Tyr
645 650 655

Gly Val Lys Asn Lieu Phe Asn Trp Met His Tyr Thr Ile Pro Glin Cys
660 665 67 O

Tyr Ile His Val Ser Asp Tyr Tyr Asn Pro Pro His Gly Val Ser Lieu.
675 68O 685

Glu Asn Arg Glu Asp Pro Pro Glu Gly Pro Ser Ser Tyr Arg Gly His
69 O. 695 7 OO

Lieu. Gly Gly Ile Glu Gly Lieu. Glin Glin Llys Lieu. Trp Thir Ser Ile Ser
7 Os 71O 71s 72O

Cys Ala Glin Ile Ser Lieu Val Glu Ile Llys Thr Gly Phe Llys Lieu. Arg
72 73 O 73

Ser Ala Val Met Gly Asp Asn Gln Cys Ile Thr Val Lieu Ser Val Phe
740 74. 7 O

Pro Lieu. Glu Thir Asp Ser Asn. Glu Glin Glu. His Ser Ser Glu Asp Asn
7ss 760 765

Ala Ala Arg Val Ala Ala Ser Lieu Ala Lys Val Thir Ser Ala Cys Gly
770 775 78O

Ile Phe Leu Lys Pro Asp Glu Thr Phe Val His Ser Gly Phe Ile Tyr
78s 79 O 79. 8OO

Phe Gly Llys Lys Glin Tyr Lieu. Asn Gly Val Glin Lieu Pro Glin Ser Lieu.
805 810 815

Llys Thr Ala Thir Arg Ile Ala Pro Lieu. Ser Asp Ala Ile Phe Asp Asp
82O 825 83 O

Lieu. Glin Gly. Thir Lieu Ala Ser Ile Gly. Thir Ala Phe Glu Arg Ser Ile
835 84 O 845

Ser Glu Thr Arg His Val Tyr Pro Cys Arg Val Val Ala Ala Phe His
US 2012/025 1502 A1 Oct. 4, 2012
37

- Continued
850 855 860

Thr Phe Phe Ser Val Arg Ile Leu Gln Tyr His His Leu Gly Phe Asn
865 87O 87s 88O

Lys Gly Thr Asp Lieu. Gly Glin Lieu. Ser Lieu. Ser Llys Pro Lieu. Asp Phe
885 890 895

Gly. Thir Ile Thr Lieu Ala Lieu Ala Val Pro Glin Val Lieu. Gly Gly Lieu.
9 OO 905 91 O

Ser Phe Lieu. Asn. Pro Glu Lys Cys Phe Tyr Arg Asn Lieu. Gly Asp Pro
915 92 O 925

Val Thr Ser Gly Lieu Phe Gln Leu Arg Thr Tyr Lieu Gln Met Ile Asn
93 O 935 94 O

Met Asp Asp Lieu. Phe Lieu Pro Lieu. Ile Ala Lys Asn Pro Gly Asn. Cys
945 950 955 96.O

Ser Ala Ile Asp Phe Val Lieu. Asn Pro Ser Gly Lieu. Asn Val Pro Gly
965 97O 97.

Ser Glin Asp Lieu. Thir Ser Phe Lieu. Arg Glin Ile Val Arg Arg Thir Ile
98O 985 99 O

Thir Lieu. Ser Ala Lys Asn Llys Lieu. Ile Asn. Thir Lieu. Phe His Ser Ser
995 1OOO 1005

Ala Asp Lieu. Glu Asp Glu Met Val Cys Llys Trp Lieu. Lieu. Ser Ser
O1O O15 O2O

Thr Pro Val Met Ser Arg Phe Ala Ala Asp Ile Phe Ser Arg Thr
O25 O3 O O35

Pro Ser Gly Lys Arg Lieu. Glin Ile Lieu. Gly Tyr Lieu. Glu Gly Thr
O4 O O45 OSO

Arg Thr Lieu. Lieu Ala Ser Llys Val Ile Asn. Asn. Asn Ala Glu Thr
O55 O6 O O65

Pro Ile Lieu. Asp Arg Lieu. Arg Lys Ile Thr Lieu. Glin Arg Trp Ser
Of O O7 O8O

Lieu. Trp Phe Ser Tyr Lieu. Asp His Cys Asp Glin Val Lieu Ala Asp

Ala Lieu. Ile Llys Val Ser Cys Thr Val Asp Lieu Ala Glin Ile Lieu.
OO O5 10

Arg Glu Tyr Thir Trp Ala His Ile Lieu. Glu Gly Arg Glin Lieu. Ile

Gly Ala Thr Lieu Pro Cys Met Leu Glu Glin Phe Asn Val Phe Trp

Lieu Lys Ser Tyr Glu Gln Cys Pro Llys Cys Ala Lys Ser Arg Asn

Pro Lys Gly Glu Pro Phe Val Ser Ile Ala Ile Llys Lys Glin Val

Val Ser Ala Trp Pro Asn Glin Ser Arg Lieu. Asn Trp Thir Ile Gly

Asp Gly Val Pro Tyr Ile Gly Ser Arg Thr Glu Asp Llys Ile Gly

Glin Pro Ala Ile Llys Pro Llys Cys Pro Ser Ala Ala Lieu. Arg Glu
2O5 21 O 215

Ala Ile Glu Lieu. Thir Ser Arg Lieu. Thir Trp Val Thr Glin Gly Gly
22O 225 23 O

Ala Asn. Ser Asp Lieu. Lieu Val Llys Pro Phe Val Glu Ala Arg Val
235 24 O 245
US 2012/025 1502 A1 Oct. 4, 2012
38

- Continued

Asn Lieu. Ser Val Glin Glu Ile Leu Gln Met Thr Pro Ser His Tyr
250 255 26 O

Ser Gly Asn Ile Val His Arg Tyr Asn Asp Gln Tyr Ser Pro His
265 27 O 27s

Ser Phe Met Ala Asn Arg Met Ser Asn. Ser Ala Thr Arg Lieu Val
28O 285 29 O

Val Ser Thr Asn Thr Lieu. Gly Glu Phe Ser Gly Gly Gly Glin Ser
295 3OO 305

Ala Arg Asp Ser Asn. Ile Ile Phe Glin Asn Val Ile Asn. Phe Ser
310 315 32O

Val Ala Lieu. Phe Asp Lieu. Arg Phe Arg Asn Thr Glu Thir Ser Ser
3.25 33 O 335

Ile Glin His Asn Arg Ala His Lieu. His Lieu. Ser Glin Cys Cys Thr
34 O 345 350

Arg Glu Val Pro Ala Glin Tyr Lieu. Thr Tyr Thr Ser Thr Lieu. Ser
355 360 365

Lieu. Asp Lieu. Thir Arg Tyr Arg Glu Asn. Glu Lieu. Ile Tyr Asp Asn
37O 375 38O

Asn Pro Lieu Lys Gly Gly Lieu. Asn. Cys Asn Lieu. Ser Phe Asp Asn
385 390 395

Pro Lieu. Phe Lys Gly Glin Arg Lieu. Asn. Ile Ile Glu Glu Asp Lieu.
4 OO 405 41 O

Ile Arg Phe Pro His Lieu. Ser Gly Trp Glu Lieu Ala Lys Thir Ile
415 42O 425

Ile Glin Ser Ile Ile Ser Asp Ser Asn Asn Ser Ser Thr Asp Pro
43 O 435 44 O

Ile Ser Ser Gly Glu Thir Arg Ser Phe Thr Thr His Phe Lieu. Thr
445 450 45.5

Tyr Pro Llys Val Gly Lieu. Leu Tyr Ser Phe Gly Ala Ile Val Ser
460 465 47 O

yr Lieu. Gly Asn. Thir Ile Ile Arg Thr Llys Llys Lieu. Asp Lieu
47s 48O 485

Ser His Phe Met Tyr Tyr Lieu. Thir Thr Glin Ile His Asn Lieu Pro
490 495 SOO

His Arg Ser Lieu. Arg Ile Lieu Lys Pro Thr Phe Llys His Val Ser
5 OS 510 515

Val Ile Ser Arg Lieu Met Ser Ile Asp Pro His Phe Ser Ile Tyr
52O 525 53 O

Ile Gly Gly Thr Ala Gly Asp Arg Gly Lieu. Ser Asp Ala Thr Arg

Lieu. Phe Lieu. Arg Val Ala Ile Ser Ser Phe Lieu. Glin Phe Ile Llys
550 555 560

rp Ile Val Glu Tyr Lys Thr Ala Ile Pro Leu Trp Val Ile
565 st O sts

Tyr Pro Leu Glu Gly Glin Asn Pro Asp Pro Ile Asn Ser Phe Lieu.
58O 585 590

His Lieu. Ile Ile Ala Lieu. Lieu. Glin Asn. Glu Ser Pro Glin Asn. Asn
595 6OO 605

Ile Glin Phe Glin Glu Asp Arg Asn. Asn. Glin Glin Lieu. Ser Asp Asn
610 615 62O
US 2012/025 1502 A1 Oct. 4, 2012
39

- Continued
Lieu Val Tyr Met Cys Llys Ser Thr Ala Ser Asn Phe Phe His Ala
625 63 O 635

Ser Lieu Ala Tyr Trp Arg Ser Arg His Lys Gly Arg Pro Lys Asn
64 O 645 650

Arg Ser Thr Glu Glu Glin Thr Val Llys Pro Ile Pro Tyr Asp Asn
655 660 665

Phe His Ser Val Lys Cys Ala Ser Asn Pro Pro Ser Ile Pro Llys

Ser Lys Ser Gly Thr Glin Gly Ser Ser Ala Phe Phe Glu Lys Lieu.

Glu Tyr Asp Llys Glu Arg Glu Lieu Pro Thr Ala Ser Thr Pro Ala

Glu Glin Ser Llys Thr Tyr Ile Lys Ala Lieu. Ser Ser Arg Ile Tyr

His Gly Llys Thr Pro Ser Asn Ala Ala Lys Asp Asp Ser Thir Thr

Ser Lys Gly Cys Asp Ser Lys Glu Glu Asn Ala Val Glin Ala Ser
74. 7 O 7ss

His Arg Ile Val Lieu Pro Phe Phe Thr Lieu Ser Glin Asn Asp Tyr
760 765 770

Arg Thr Pro Ser Ala Lys Llys Ser Glu Tyr Ile Thr Glu Ile Thr
775 78O 78s

Llys Lieu. Ile Arg Glin Lieu Lys Ala Ile Pro Asp Thir Thr Val Tyr
79 O 79. 8OO

Cys Arg Phe Thr Gly Val Val Ser Ser Met His Tyr Lys Lieu. Asp
805 810 815

Glu Val Lieu. Trp Glu Phe Asp Ser Phe Llys Thr Ala Val Thr Lieu.
82O 825 83 O

Ala Glu Gly Glu Gly Ser Gly Ala Lieu. Lieu Lleu Lleu Gln Llys Tyr
835 84 O 845

Llys Val Arg Thr Ile Phe Phe Asn Thr Lieu Ala Thr Glu. His Ser
850 855 86 O

Ile Glu Ala Glu Ile Val Ser Gly Thr Thr Thr Pro Arg Met Leu
865 87 O 87s

Lieu Pro Wal Met Ala Lys Lieu. His Asp Asp Glin Ile Asn Val Ile
88O 885 890

Lieu. Asn. Asn. Ser Ala Ser Glin Val Thr Asp Ile Thir ASn Pro Ala
895 9 OO 905

Trp Phe Thr Asp Glin Lys Ser Arg Ile Pro Thr Glin Val Glu Ile
910 915 92 O

Met Thr Met Asp Ala Glu Thir Thr Glu Asn Ile Asn Arg Ser Lys
925 93 O 935

Lieu. Tyr Glu Ala Ile Glin Glin Lieu. Ile Val Ser His Ile Asp Thr
94 O 945 950

Arg Val Lieu Lys Ile Val Ile Ile Llys Val Phe Lieu. Ser Asp Ile
955 96.O 965

Glu Gly Lieu Lleu Trp Lieu. Asn Asp His Lieu Ala Pro Lieu. Phe Gly
97O 97. 98 O

Ser Gly Tyr Lieu. Ile Llys Pro Ile Thr Ser Ser Pro Llys Ser Ser
985 990 995

Glu Trp Tyr Lieu. Cys Lieu. Ser Asn. Phe Lieu. Ser Ala Ser Arg Arg
US 2012/025 1502 A1 Oct. 4, 2012
40

- Continued
2OOO 2005 2010

Arg Pro His Glin Gly His Ala Thr Cys Met Glin Val Ile Glin Thr
2015 2O2O 2O25

Ala Lieu. Arg Lieu. Glin Val Glin Arg Ser Ser Tyr Trp Lieu. Ser His
2O3O 2O35 2O4. O

Lieu Val Glin Tyr Ala Asp Ile Asn Lieu. His Lieu. Ser Tyr Val Asn
2O45 2OSO 2O55

Lieu. Gly Phe Pro Ser Lieu. Glu Lys Val Lieu. Tyr His Arg Tyr Asn
2O60 2O65 2. Of O

Lieu Val Asp Ser Arg Lys Gly Pro Lieu Val Ser Ile Lieu. Tyr His
2O75 2O8 O 2O85

Lieu. Thir His Lieu. Glin Ala Glu Ile Arg Glu Lieu Val Cys Asp Tyr
2O90 2095 21OO

Asn Glin Glin Arg Glin Ser Arg Thr Glin Thr Tyr His Phe Ile Lys

Thir Thr Lys Gly Arg Ile Thir Lys Lieu Val Asn Asp Tyr Lieu Lys

Phe Tyr Lieu Val Val Glin Ala Lieu Lys His Asn. Cys Lieu. Trp Glin

Glu Glu Lieu. Arg Thr Lieu Pro Asp Lieu. Ile Asn Val Cys Asn Arg

Phe Tyr His Ile Arg Asp Cys Ser Cys Glu Asp Arg Phe Lieu. Ile

Glin Thr Lieu. Tyr Lieu. Thir Arg Met Glin Asp Ser Glu Ala Lys Lieu.

Met Glu Arg Lieu. Thr Gly Phe Leu Gly Lieu. Tyr Pro Asn Gly Ile
21.95 22 OO 22O5

Asn Ala

<210s, SEQ ID NO 3
&211s LENGTH: 739
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Bundibugyo ebolavirus NP viral protein
<4 OOs, SEQUENCE: 3

Met Asp Pro Arg Pro Ile Arg Thr Trp Met Met His Asn Thr Ser Glu
1. 5 1O 15

Val Glu Ala Asp Tyr His Lys Ile Lieu. Thir Ala Gly Lieu. Ser Val Glin
2O 25 3O

Gln Gly Ile Val Arg Glin Arg Ile Ile Pro Val Tyr Glin Ile Ser Asn
35 4O 45

Lieu. Glu Glu Val Cys Glin Lieu. Ile Ile Glin Ala Phe Glu Ala Gly Val
SO 55 6O

Asp Phe Glin Asp Ser Ala Asp Ser Phe Lieu. Lieu Met Lieu. Cys Lieu. His
65 70 7s 8O

His Ala Tyr Glin Gly Asp Tyr Lys Glin Phe Lieu. Glu Ser Asn Ala Val
85 90 95

Llys Tyr Lieu. Glu Gly His Gly Phe Arg Phe Glu Met Llys Llys Lys Glu
1OO 105 11 O
US 2012/025 1502 A1 Oct. 4, 2012
41

- Continued
Gly Val Lys Arg Lieu. Glu Glu Lieu. Lieu Pro Ala Ala Ser Ser Gly Lys
115 12 O 125

Asn. Ile Lys Arg Thr Lieu Ala Ala Met Pro Glu Glu Glu Thir Thr Glu
13 O 135 14 O

Ala Asn Ala Gly Glin Phe Lieu. Ser Phe Ala Ser Lieu. Phe Lieu Pro Llys
145 150 155 160

Lieu Val Val Gly Glu Lys Ala Cys Lieu. Glu Lys Val Glin Arg Glin Ile
1.65 17O 17s

Glin Val His Ala Glu Glin Gly Lieu. Ile Glin Tyr Pro Thr Ser Trp Glin
18O 185 19 O

Ser Val Gly His Met Met Val Ile Phe Arg Lieu Met Arg Thr Asn Phe
195 2OO 2O5

Lieu. Ile Llys Phe Lieu. Lieu. Ile His Glin Gly Met His Met Val Ala Gly
21 O 215 22O

His Asp Ala Asn Asp Ala Val Ile Ala Asn. Ser Val Ala Glin Ala Arg
225 23 O 235 24 O

Phe Ser Gly Lieu. Lieu. Ile Val Lys Thr Val Lieu. Asp His Ile Lieu. Glin
245 250 255

Llys Thr Glu. His Gly Val Arg Lieu. His Pro Lieu Ala Arg Thir Ala Lys
26 O 265 27 O

Val Lys Asn. Glu Val Ser Ser Phe Lys Ala Ala Lieu Ala Ser Lieu Ala
27s 28O 285

Glin His Gly Glu Tyr Ala Pro Phe Ala Arg Lieu. Lieu. Asn Lieu. Ser Gly
29 O 295 3 OO

Val Asn. Asn Lieu. Glu. His Gly Lieu. Phe Pro Glin Lieu. Ser Ala Ile Ala
3. OS 310 315 32O

Lieu. Gly Val Ala Thr Ala His Gly Ser Thr Lieu Ala Gly Val Asn. Wall
3.25 330 335

Gly Glu Glin Tyr Glin Gln Lieu. Arg Glu Ala Ala Thr Glu Ala Glu Lys
34 O 345 35. O

Glin Lieu Gln Lys Tyr Ala Glu Ser Arg Glu Lieu. Asp His Lieu. Gly Lieu.
355 360 365

Asp Asp Glin Glu Lys Lys Ile Lieu Lys Asp Phe His Glin Llys Lys Asn
37 O 375 38O

Glu Ile Ser Phe Glin Glin Thir Thr Ala Met Val Thr Lieu. Arg Lys Glu
385 390 395 4 OO

Arg Lieu Ala Lys Lieu. Thr Glu Ala Ile Thir Ser Thr Ser Ile Lieu Lys
4 OS 41O 415

Thr Gly Arg Arg Tyr Asp Asp Asp Asn Asp Ile Pro Phe Pro Gly Pro
42O 425 43 O

Ile Asin Asp Asn. Glu Asn. Ser Gly Glin Asn Asp Asp Asp Pro Thr Asp
435 44 O 445

Ser Glin Asp Thir Thir Ile Pro Asp Val Ile Ile Asp Pro Asn Asp Gly
450 45.5 460

Gly Tyr Asn. Asn Tyr Ser Asp Tyr Ala Asn Asp Ala Ala Ser Ala Pro
465 470 47s 48O

Asp Asp Lieu Val Lieu. Phe Asp Lieu. Glu Asp Glu Asp Asp Ala Asp Asn
485 490 495

Pro Ala Glin Asn. Thr Pro Glu Lys Asn Asp Arg Pro Ala Thir Thr Lys
SOO 505 51O

Lieu. Arg Asn Gly Glin Asp Glin Asp Gly Asn Glin Gly Glu Thir Ala Ser
US 2012/025 1502 A1 Oct. 4, 2012
42

- Continued
515 52O 525

Pro Arg Val Ala Pro Asn Glin Tyr Arg Asp Llys Pro Met Pro Glin Val
53 O 535 54 O

Glin Asp Arg Ser Glu Asn His Asp Glin Thir Lieu. Glin Thr Glin Ser Arg
5.45 550 555 560

Val Lieu. Thr Pro Ile Ser Glu Glu Ala Asp Pro Ser Asp His Asn Asp
565 st O sts

Gly Asp Asn. Glu Ser Ile Pro Pro Lieu. Glu Ser Asp Asp Glu Gly Ser
58O 585 59 O

Thr Asp Thir Thr Ala Ala Glu Thr Llys Pro Ala Thr Ala Pro Pro Ala
595 6OO 605

Pro Val Tyr Arg Ser Ile Ser Val Asp Asp Ser Val Pro Ser Glu Asn
610 615 62O

Ile Pro Ala Glin Ser Asn Glin Thir Asn. Asn. Glu Asp Asn Val Arg Asn
625 630 635 64 O

Asn Ala Glin Ser Glu Glin Ser Ile Ala Glu Met Tyr Gln His Ile Lieu
645 650 655

Lys Thr Glin Gly Pro Phe Asp Ala Ile Leu Tyr Tyr His Met Met Lys
660 665 67 O

Glu Glu Pro Ile Ile Phe Ser Thr Ser Asp Gly Lys Glu Tyr Thr Tyr
675 68O 685

Pro Asp Ser Lieu. Glu. Asp Glu Tyr Pro Pro Trp Lieu. Ser Glu Lys Glu.
69 O. 695 7 OO

Ala Met Asn. Glu Asp Asn Arg Phe Ile Thr Met Asp Gly Glin Glin Phe
7 Os 71O 71s 72O

Tyr Trp Pro Val Met Asn His Arg Asn Llys Phe Met Ala Ile Leu Gln
72 73 O 73

His His Arg

<210s, SEQ ID NO 4
&211s LENGTH: 373
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Bundibugyo ebolavirus SGP viral protein
<4 OOs, SEQUENCE: 4

Met Val Thir Ser Gly Ile Lieu. Glin Lieu Pro Arg Glu Arg Phe Arg Llys
1. 5 1O 15

Thir Ser Phe Phe Val Trp Val Ile Ile Leu Phe His Llys Val Phe Pro
2O 25 3O

Ile Pro Lieu. Gly Val Val His Asn. Asn. Thir Lieu. Glin Val Ser Asp Ile
35 4O 45

Asp Llys Lieu Val Cys Arg Asp Llys Lieu. Ser Ser Thr Ser Glin Lieu Lys
SO 55 6O

Ser Val Gly Lieu. Asn Lieu. Glu Gly Asn Gly Val Ala Thr Asp Val Pro
65 70 7s 8O

Thr Ala Thr Lys Arg Trp Gly Phe Arg Ala Gly Val Pro Pro Llys Val
85 90 95

Val Asn Tyr Glu Ala Gly Glu Trp Ala Glu Asn. Cys Tyr Asn Lieu. Asp
1OO 105 11 O

Ile Llys Lys Ala Asp Gly Ser Glu. Cys Lieu Pro Glu Ala Pro Glu Gly
US 2012/025 1502 A1 Oct. 4, 2012
43

- Continued
115 12 O 125

Val Arg Gly Phe Pro Arg Cys Arg Tyr Val His Llys Val Ser Gly Thr
13 O 135 14 O

Gly Pro Cys Pro Glu Gly Tyr Ala Phe His Lys Glu Gly Ala Phe Phe
145 150 155 160

Lieu. Tyr Asp Arg Lieu Ala Ser Thr Ile Ile Tyr Arg Ser Thr Thr Phe
1.65 17O 17s

Ser Glu Gly Val Val Ala Phe Lieu. Ile Lieu Pro Glu Thir Lys Lys Asp
18O 185 19 O

Phe Phe Glin Ser Pro Pro Leu. His Glu Pro Ala Asn Met Thr Thr Asp
195 2OO 2O5

Pro Ser Ser Tyr Tyr His Thr Val Thr Lieu. Asn Tyr Val Ala Asp Asn
21 O 215 22O

Phe Gly Thr Asn Met Thr Asn Phe Leu Phe Glin Val Asp His Lieu. Thr
225 23 O 235 24 O

Tyr Val Glin Leu Glu Pro Arg Phe Thr Pro Glin Phe Leu Val Glin Leu
245 250 255

Asn Glu Thir Ile Tyr Thr Asn Gly Arg Arg Ser Asn Thr Thr Gly Thr
26 O 265 27 O

Lieu. Ile Trp Llys Val Asn Pro Thr Val Asp Thr Gly Val Gly Glu Trp
27s 28O 285

Ala Phe Trp Glu ASn Llys Llys Thr Ser Gln Llys Pro Phe Glin Val Lys
29 O 295 3 OO

Ser Cys Lieu Ser Tyr Lieu. Tyr Glin Glu Pro Arg Ile Glin Ala Ala Thr
3. OS 310 315 32O

Arg Arg Arg Arg Ser Lieu Pro Pro Ala Ser Pro Thr Thr Llys Pro Pro
3.25 330 335

Arg Thr Thr Lys Thr Trp Phe Glin Arg Ile Pro Leu Gln Trp Phe Lys
34 O 345 35. O

Cys Glu Thir Ser Arg Gly Lys Thr Glin Cys Arg Pro His Pro Gln Thr
355 360 365

Glin Ser Pro Gln Leu

37 O

<210s, SEQ ID NO 5
&211s LENGTH: 251
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Bundibugyo ebolavirus VP24 viral protein
<4 OOs, SEQUENCE: 5
Met Ala Lys Ala Thr Gly Arg Tyr Asn Lieu Val Ser Pro Llys Lys Asp
1. 5 1O 15

Lieu. Glu Arg Gly Lieu Val Lieu. Ser Asp Lieu. Cys Thr Phe Lieu Val Asp
2O 25 3O

Gln Thr Ile Glin Gly Trp Arg Val Thir Trp Val Gly Ile Glu Phe Asp
35 4O 45

Ile Ala Glin Lys Gly Met Ala Lieu. Lieu. His Arg Lieu Lys Thir Ala Asp
SO 55 6O

Phe Ala Pro Ala Trp Ser Met Thr Arg Asn Lieu Phe Pro His Leu Phe
65 70 7s 8O
US 2012/025 1502 A1 Oct. 4, 2012
44

- Continued
Glin Asn. Ser Asn. Ser Thir Ile Glu Ser Pro Lieu. Trp Ala Lieu. Arg Val
85 90 95

Ile Lieu Ala Ala Gly Ile Glin Asp Glin Lieu. Ile Asp Glin Ser Lieu Val
1OO 105 11 O

Glu Pro Lieu Ala Gly Ala Lieu. Ser Lieu Val Ser Asp Trp Lieu. Lieu. Thir
115 12 O 125

Thr Asn Thr Asn His Phe Gln Met Arg Thr Gln His Ala Lys Glu Gln
13 O 135 14 O

Lieu. Ser Lieu Lys Met Lieu. Ser Lieu Val Arg Ser Asn. Ile Lieu Lys Phe
145 150 155 160

Ile Ser Glin Lieu. Asp Ala Lieu. His Val Val Asn Tyr Asn Gly Lieu. Lieu.
1.65 17O 17s

Ser Ser Ile Glu Ile Gly Thr Arg Asn His Thr Ile Ile Ile Thr Arg
18O 185 19 O

Thir Asn Met Gly Phe Lieu Val Glu Lieu. Glin Glu Pro Asp Llys Ser Ala
195 2OO 2O5

Met Asn Gln Lys Llys Pro Gly Pro Val Llys Phe Ser Lieu. Lieu. His Glu
21 O 215 22O

Ser Thr Phe Lys Ala Lieu. Ile Llys Llys Pro Ala Thr Llys Met Glin Ala
225 23 O 235 24 O

Lieu. Ile Lieu. Glu Phe Asn. Ser Ser Lieu Ala Ile
245 250

<210s, SEQ ID NO 6
&211s LENGTH: 289
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Bundibugyo ebolavirus VP3O viral protein
<4 OOs, SEQUENCE: 6
Met Asp Ser Phe His Glu Arg Gly Arg Ser Arg Thir Ile Arg Glin Ser
1. 5 1O 15

Ala Arg Asp Gly Pro Ser His Glin Val Arg Thr Arg Ser Ser Ser Arg
2O 25 3O

Asp Ser His Arg Ser Glu Tyr His Thr Pro Arg Ser Ser Ser Glin Val
35 4O 45

Arg Val Pro Thr Val Phe His Arg Lys Arg Thr Asp Ser Lieu. Thr Val
SO 55 6O

Pro Pro Ala Pro Lys Asp Ile Cys Pro Thir Lieu. Arg Lys Gly Phe Lieu.
65 70 7s 8O

Cys Asp Ser Asn. Phe Cys Llys Lys Asp His Glin Lieu. Glu Ser Lieu. Thir
85 90 95

Asp Arg Glu Lieu Lleu Lleu Lieu. Ile Ala Arg Llys Thr Cys Gly Ser Lieu
1OO 105 11 O

Glu Glin Glin Lieu. Asn. Ile Thr Ala Pro Lys Asp Thr Arg Lieu Ala Asn
115 12 O 125

Pro Ile Ala Asp Asp Phe Glin Glin Lys Asp Gly Pro Llys Ile Thr Lieu.
13 O 135 14 O

Lieu. Thir Lieu. Lieu. Glu Thir Ala Glu Tyr Trp Ser Lys Glin Asp Ile Llys
145 150 155 160

Gly Ile Asp Asp Ser Arg Lieu. Arg Ala Lieu. Lieu. Thir Lieu. Cys Ala Val
1.65 17O 17s
US 2012/025 1502 A1 Oct. 4, 2012
45

- Continued

Met Thr Arg Llys Phe Ser Lys Ser Glin Lieu. Ser Lieu. Lieu. Cys Glu Ser
18O 185 19 O

His Lieu. Arg Arg Glu Gly Lieu. Gly Glin Asp Glin Ser Glu Ser Val Lieu.
195 2OO 2O5

Glu Val Tyr Glin Arg Lieu. His Ser Asp Llys Gly Gly Asn. Phe Glu Ala
21 O 215 22O

Ala Leu Trp Glin Gln Trp Asp Arg Glin Ser Lieu. Ile Met Phe Ile Thr
225 23 O 235 24 O

Ala Phe Lieu. Asn. Ile Ala Lieu. Glin Lieu Pro Cys Glu Ser Ser Ser Val
245 250 255

Val Ile Ser Gly Lieu. Arg Lieu. Lieu Val Pro Glin Ser Glu Asp Thr Glu
26 O 265 27 O

Thir Ser Thr Tyr Thr Glu Thr Arg Ala Trp Ser Glu Glu Gly Gly Pro
27s 28O 285

His

<210s, SEQ ID NO 7
&211s LENGTH: 341
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Bundibugyo ebolavirus VP35 viral protein
<4 OO > SEQUENCE: 7

Met Thr Ser Asn Arg Ala Arg Val Thr Tyr Asn Pro Pro Pro Thr Thr
1. 5 1O 15

Thr Gly Thr Arg Ser Cys Gly Pro Glu Lieu Ser Gly Trp Ile Ser Glu
2O 25 3O

Gln Leu Met Thr Gly Lys Ile Pro Ile Thr Asp Ile Phe Asin Glu Ile
35 4O 45

Glu Thir Lieu Pro Ser Ile Ser Pro Ser Ile His Ser Lys Ile Llys Thr
SO 55 6O

Pro Ser Val Glin Thr Arg Ser Val Glin Thr Glin Thr Asp Pro Asn Cys
65 70 7s 8O

Asn His Asp Phe Ala Glu Val Val Lys Met Lieu. Thir Ser Lieu. Thir Lieu
85 90 95

Val Val Glin Lys Glin Thr Lieu Ala Thr Glu Ser Lieu. Glu Glin Arg Ile
1OO 105 11 O

Thir Asp Lieu. Glu Gly Ser Lieu Lys Pro Val Ser Glu Ile Thir Lys Ile
115 12 O 125

Val Ser Ala Lieu. Asn Arg Ser Cys Ala Glu Met Val Ala Lys Tyr Asp
13 O 135 14 O

Lieu. Leu Val Met Thr Thr Gly Arg Ala Thr Ala Thr Ala Ala Ala Thr
145 150 155 160

Glu Ala Tyr Trp Ala Glu. His Gly Arg Pro Pro Pro Gly Pro Ser Lieu.
1.65 17O 17s

Tyr Glu Glu Asp Ala Ile Arg Thr Lys Ile Gly Lys Glin Gly Asp Met
18O 185 19 O

Val Pro Lys Glu Val Glin Glu Ala Phe Arg Asn Lieu. Asp Ser Thr Ala
195 2OO 2O5

Lieu. Lieu. Thr Glu Glu Asn. Phe Gly Llys Pro Asp Ile Ser Ala Lys Asp
21 O 215 22O
US 2012/025 1502 A1 Oct. 4, 2012
46

- Continued

Lieu. Arg Asn Ile Met Tyr Asp His Leu Pro Gly Phe Gly Thr Ala Phe
225 23 O 235 24 O

His Glin Lieu Val Glin Val Ile Cys Llys Lieu. Gly Lys Asp Asn. Ser Ser
245 250 255

Lieu. Asp Val Ile His Ala Glu Phe Glin Ala Ser Lieu Ala Glu Gly Asp
26 O 265 27 O

Ser Pro Gln Cys Ala Lieu. Ile Glin Ile Thr Lys Arg Ile Pro Ile Phe
27s 28O 285

Glin Asp Ala Ala Pro Pro Val Ile His Ile Arg Ser Arg Gly Asp Ile
29 O 295 3 OO

Pro Lys Ala Cys Gln Lys Ser Lieu. Arg Pro Val Pro Pro Ser Pro Llys
3. OS 310 315 32O

Ile Asp Arg Gly Trp Val Cys Ile Phe Glin Lieu. Glin Asp Gly Lys Thr
3.25 330 335

Lieu. Gly Lieu Lys Ile

34 O

<210s, SEQ ID NO 8
&211s LENGTH: 326
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Bundibugyo ebolavirus VP4O viral protein
<4 OOs, SEQUENCE: 8

Met Arg Arg Ala Ile Leu Pro Thr Ala Pro Pro Glu Tyr Ile Glu Ala
1. 5 1O 15

Val Tyr Pro Met Arg Thr Val Ser Thr Ser Ile Asn Ser Thr Ala Ser
2O 25 3O

Gly Pro Asn Phe Pro Ala Pro Asp Val Met Met Ser Asp Thr Pro Ser
35 4O 45

Asn Ser Lieu. Arg Pro Ile Ala Asp Asp Asn. Ile Asp His Pro Ser His
SO 55 6O

Thr Pro Thir Ser Wal Ser Ser Ala Phe Ile Lieu. Glu Ala Met Wall Asn
65 70 7s 8O

Val Ile Ser Gly Pro Llys Val Lieu Met Lys Glin Ile Pro Ile Trp Leu
85 90 95

Pro Leu Gly Val Ala Asp Gln Lys Thr Tyr Ser Phe Asp Ser Thir Thr
1OO 105 11 O

Ala Ala Ile Met Leu Ala Ser Tyr Thr Ile Thr His Phe Gly Lys Thr
115 12 O 125

Ser Asn Pro Lieu Val Arg Ile Asin Arg Lieu. Gly Pro Gly Ile Pro Asp
13 O 135 14 O

His Pro Lieu. Arg Lieu. Lieu. Arg Ile Gly Asn. Glin Ala Phe Lieu. Glin Glu
145 150 155 160

Phe Val Lieu Pro Pro Val Glin Leu Pro Glin Tyr Phe Thr Phe Asp Leu
1.65 17O 17s

Thr Ala Leu Lys Lieu. Ile Thr Glin Pro Leu Pro Ala Ala Thr Trp Thr
18O 185 19 O

Asp Asp Thr Pro Thr Gly Pro Thr Gly Ile Leu Arg Pro Gly Ile Ser
195 2OO 2O5

Phe His Pro Llys Lieu. Arg Pro Ile Lieu. Lieu Pro Gly Llys Thr Gly Lys
US 2012/025 1502 A1 Oct. 4, 2012
47

- Continued
21 O 215 22O

Arg Gly Ser Ser Ser Asp Lieu. Thir Ser Pro Asp Llys Ile Glin Ala Ile
225 23 O 235 24 O

Met Asn. Phe Lieu. Glin Asp Lieu Lys Lieu Val Pro Ile Asp Pro Ala Lys
245 250 255

Asn. Ile Met Gly Ile Glu Val Pro Glu Lieu. Lieu Val His Arg Lieu. Thr
26 O 265 27 O

Gly Lys Lys Ile Thr Thr Lys Asn Gly Glin Pro Ile Ile Pro Ile Leu
27s 28O 285

Lieu Pro Llys Tyr Ile Gly Met Asp Pro Ile Ser Glin Gly Asp Lieu. Thr
29 O 295 3 OO

Met Val Ile Thr Glin Asp Cys Asp Thr Cys His Ser Pro Ala Ser Lieu.
3. OS 310 315 32O

Pro Pro Val Ser Glu Lys

3.25

<210s, SEQ ID NO 9
&211s LENGTH: 676
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Bundibugyo ebolavirus GP viral protein
< 4 OO > SEQUENCE: 9
Met Val Thir Ser Gly Ile Lieu. Glin Lieu Pro Arg Glu Arg Phe Arg Llys
1. 5 1O 15

Thir Ser Phe Phe Val Trp Val Ile Ile Leu Phe His Llys Val Phe Pro
2O 25 3O

Ile Pro Lieu. Gly Val Val His Asn. Asn. Thir Lieu. Glin Val Ser Asp Ile
35 4O 45

Asp Llys Lieu Val Cys Arg Asp Llys Lieu. Ser Ser Thr Ser Glin Lieu Lys
SO 55 6O

Ser Val Gly Lieu. Asn Lieu. Glu Gly Asn Gly Val Ala Thr Asp Val Pro
65 70 7s 8O

Thr Ala Thr Lys Arg Trp Gly Phe Arg Ala Gly Val Pro Pro Llys Val
85 90 95

Val Asn Tyr Glu Ala Gly Glu Trp Ala Glu Asn. Cys Tyr Asn Lieu. Asp
1OO 105 11 O

Ile Llys Lys Ala Asp Gly Ser Glu. Cys Lieu Pro Glu Ala Pro Glu Gly
115 12 O 125

Val Arg Gly Phe Pro Arg Cys Arg Tyr Val His Llys Val Ser Gly Thr
13 O 135 14 O

Gly Pro Cys Pro Glu Gly Tyr Ala Phe His Lys Glu Gly Ala Phe Phe
145 150 155 160

Lieu. Tyr Asp Arg Lieu Ala Ser Thr Ile Ile Tyr Arg Ser Thr Thr Phe
1.65 17O 17s

Ser Glu Gly Val Val Ala Phe Lieu. Ile Lieu Pro Glu Thir Lys Lys Asp
18O 185 19 O

Phe Phe Glin Ser Pro Pro Leu. His Glu Pro Ala Asn Met Thr Thr Asp
195 2OO 2O5

Pro Ser Ser Tyr Tyr His Thr Val Thr Lieu. Asn Tyr Val Ala Asp Asn
21 O 215 22O
US 2012/025 1502 A1 Oct. 4, 2012
48

- Continued
Phe Gly Thr Asn Met Thr Asn Phe Leu Phe Glin Val Asp His Lieu. Thr
225 23 O 235 24 O

Tyr Val Glin Leu Glu Pro Arg Phe Thr Pro Glin Phe Leu Val Glin Leu
245 250 255

Asn Glu Thir Ile Tyr Thr Asn Gly Arg Arg Ser Asn Thr Thr Gly Thr
26 O 265 27 O

Lieu. Ile Trp Llys Val Asn Pro Thr Val Asp Thr Gly Val Gly Glu Trp
27s 28O 285

Ala Phe Trp Glu Asn Llys Lys Asn. Phe Thir Lys Thr Lieu. Ser Ser Glu
29 O 295 3 OO

Glu Lieu. Ser Val Ile Phe Val Pro Arg Ala Glin Asp Pro Gly Ser Asn
3. OS 310 315 32O

Gln Lys Thr Llys Val Thr Pro Thr Ser Phe Ala Asn Asn Glin Thr Ser
3.25 330 335

Lys Asn His Glu Asp Lieu Val Pro Glu Asp Pro Ala Ser Val Val Glin
34 O 345 35. O

Val Arg Asp Leu Glin Arg Glu Asn Thr Val Pro Thr Pro Pro Pro Asp
355 360 365

Thr Val Pro Thr Thr Lieu. Ile Pro Asp Thr Met Glu Glu Glin Thir Thr
37 O 375 38O

Ser His Tyr Glu Pro Pro Asn Ile Ser Arg Asn His Glin Glu Arg Asn
385 390 395 4 OO

Asn Thr Ala His Pro Glu Thir Lieu Ala Asn Asn Pro Pro Asp Asn Thr
4 OS 41O 415

Thr Pro Ser Thr Pro Pro Glin Asp Gly Glu Arg Thr Ser Ser His Thr
42O 425 43 O

Thr Pro Ser Pro Arg Pro Val Pro Thr Ser Thr Ile His Pro Thir Thr
435 44 O 445

Arg Glu Thir His Ile Pro Thir Thr Met Thr Thr Ser His Asp Thr Asp
450 45.5 460

Ser Asn Arg Pro Asn Pro Ile Asp Ile Ser Glu Ser Thr Glu Pro Gly
465 470 47s 48O

Pro Lieu. Thir Asn. Thir Thr Arg Gly Ala Ala Asn Lieu. Lieu. Thr Gly Ser
485 490 495

Arg Arg Thr Arg Arg Glu Ile Thr Lieu. Arg Thr Glin Ala Lys Cys Asn
SOO 505 51O

Pro Asn Lieu. His Tyr Trp Thr Thr Glin Asp Glu Gly Ala Ala Ile Gly
515 52O 525

Lieu Ala Trp Ile Pro Tyr Phe Gly Pro Ala Ala Glu Gly Ile Tyr Thr
53 O 535 54 O

Glu Gly Ile Met His Asn Glin Asn Gly Lieu. Ile Cys Gly Lieu. Arg Glin
5.45 550 555 560

Lieu Ala Asn. Glu Thir Thr Glin Ala Lieu. Glin Lieu. Phe Lieu. Arg Ala Thr
565 st O sts

Thr Glu Lieu. Arg Thr Phe Ser Ile Lieu. Asn Arg Lys Ala Ile Asp Phe
58O 585 59 O

Lieu. Lieu. Glin Arg Trp Gly Gly Thr Cys His Ile Lieu. Gly Pro Asp Cys
595 6OO 605

Cys Ile Glu Pro His Asp Trp Thir Lys Asn. Ile Thr Asp Llys Ile Asp
610 615 62O

Glin Ile Ile His Asp Phe Ile Asp Llys Pro Lieu Pro Asp Glin Thr Asp
US 2012/025 1502 A1 Oct. 4, 2012
54

- Continued

cittct cagta gcattgaaat tdgcaccalaa agc catacaa ttataattac ccgga caaat O92O
atgggtttitt tdtagagtt gcaa.gagcct gacaaat cag C catgaacac Cagaaaacca O98O

ggaccagt ca aattct coct c ct coatgaa totalaccttga agacacttgc taaaaaacct O4 O

gccacccaga tigcaag cact aat cittagaa ttcaatagitt ct citcgctat tta acticaac 1OO
t catcaaaat gctaacttgt gatcc ttaag ctgcaccitta gacttittgat aagaatact a 16 O

actattgatg attgtctttg acatgaggat aagaacactg. CCC attagat agatggggitt 22 O

caccattaat acacaattac ccaat catgt taa.ca.gcagt tagat coctic aagtatat ca 28O

agttcattct acc ctittgca ttgtcact ct aattaaatca cct gatacaa titatgttaat 34 O
tagctagatt citct catttt tag acttgtt togctagaata attgat catc. cacttgatta 4 OO

cacatccaac tagggit ctag tt catagatt gctaataatc tittagttcaa tactaatgac 460

aaagagatta gattagct at agcttgagga agattaagaa aaagtgtctg tdgggtctitt 52O

cc.gtgtagaa goggcacacag ccataattct tcc totttat acaacatggc tacacaacat 58 O

acgcaatat c cagacgcaag gttat catca cctatagittt tagat cagtg tdatc.ttgtc 64 O

acticgtgctt gtggattgta titcc.gcatac toctitaaatc cccaactaaa gaactgtaga 7 OO

ctaccgaaac atatat accq actaaaatat gacac cactg ttacagagtt tttgagtgat 760

gtgc.cgg tag caa.cattgcc agcggattitt ttagtaccta catttct tag gactictato a 82O

ggaaatggitt cittgtc.ca at tdatccaaaa tdcagt caat ttittagaaga aattgtcaat 88O

tatact ctac aagatatt cq ctitcc taaac tattacctica atcgagc.cgg agtgcataac 94 O

gat catgtgg at agggattt tacaaaaa attcgcaatc taatttgcga caatgaggitt 2 OOO

ttacatcaaa tottt cactg g tatgat citt gcaattic tag cacgtagagg gcgactaaat 2O6 O
agagggaata atcgct Caac atggtttgca agtgataatt ttagatat cct aggttat 212 O

ggagattata ttttittggaa aataccatta t cact actac cagtggatac acaaggcctic 218O

C Cacatgcag C caaggactg gitat catgaa ticggtttitca aggaggct at t caaggc cat 224 O

acacacat cq tdtccatc to tacagcagat gtc.ttaatca totgtaagga cataatcacc 23 OO

tgtcgattta at actt tact gattgctgct gtggcaaatc tagaggattic agttcattca 2360

gattaccott taccagaaac agtgtctgac ctatacaaag caggagatta tittaatctoa 242 O

ttgctaggat cagaaggitta caaagt cata aaatticcittg agc.cgittatg cittagcaaag 248O

atccaact cit gct caaatta cactgagagg aaaggaagat tcc to actica aatgcattta 254 O
gctgtaaatc atacacttga ggaacttaca gggtc.ccgag aattalaggcc acaacagatt 26 OO

cggalaggtaa goggaattic catcaaatgctg ataaaccitta aggcaactic c ticaacaactic 266 O

tgtgagttgt titt cagtgca aaa.gcattgg gggcaccctg. tcttgcatag caaaaggct 272 O

atccaaaaag taaagaagica togcaa.cagtgataaaag cat togcgc.ccaat aataatctitt 2780

gaaacatatt gtgtgtttaa atacagoatt gcaaaacatt attittgatag tdagggitacg 284 O

tggtacagtg tdacttctga cagatgctta acaccaggcc titt cotcitta catcaaaaga 29 OO

aaccaatttic ctic cact acc tatgatcaaa gaactitttgt giggaattitta t cacttagat 296 O

catcct cogt tatt ct coac caaagtgatt agtgatttga gitatic tittat taaagat cqt 3O2O
gctactgcag ticgagaaaac atgctgggac gcagtttittg aacccaatgt t cttggittat 3O8O
aacccaccga ataaatttgc tacaaaaagg gtacctgagc aattic cttga acaggagaat 314 O
US 2012/025 1502 A1 Oct. 4, 2012
57

- Continued

cagtatgcca at cataattit gcatttagat tat attaatc. tcggittt coc titcattggag 776 O.

agggittittat accatagata caatttagt c gattcticaga aaggc cctitt gact tcc att 782O
gtcCaacatc tagcgcacct gcagaccgag attagggagt tdgittaatga ctata at Caa 788 O

caaaga caaa gtcgaaccca aacatat cat tt cattaaaa caataaaagg togt attaca 794 O
aaattggtaa atgattacct taagttctitt ctaataatac aagcc ttaaa goacaattgc 8 OOO

acatggcaag aggaactaag agctic titcca gatctaatta gtgtctgcac togattictat 806 O

catact cqaa actgttcatg togaaaaccogg titcc tag tac agactittata cittat cacgc 812 O
atgcaggatt cqgaaatcaa actaatagat agattgaccq gcc ttct tag totatgtc.ca 818O
aatggtttitt titcggtaagg act cittgacg tacaaacticc acatagittat acaatgg tac 824 O

caggacacta tatgtaaatt gaccctaaga aagagtaatt coacacacag agttct caag 83OO

tgaaac cc ct catctoragat tatctgtggit togcaatticta at atc.cgatt gttaccc.cgt. 8360

gagtataact coagattaat ataagaaaat accttttgtc. citgcaaattt at cittaaatt 842O

caagtacata cqcticcaaat cqtataaaat attaagaaaa agittaatctg. cittgctittaa 848 O

ttataactitt aatatt cqac aaatagittaa cqgtct catc act caaaaat tt cattaa.ca 854 O
aaagaagtact ctdagtata t t cacatat catatgtgatt aacatataag caacgcatga 86OO

tgcgcct tcc tict tactitat tdtgttgtca cqcagtcgtt gtactacct c gaaaatticca 866 O

aacaataaat cqtgtctato cogcatttag tdt ctittaat ttaagat ct c aaatccaaaa 872O

aactgggttt atgttgatgt aaatcaataa taccgaaatt gcttgatatt aaaataaagc 878 O.

ttaaaggatt ttt Cottaala C9gtgatgtt aggtatatag gaaagctica t cacgatgtc. 884. O

cct tacticag aaaaagaaaa acggaag.ccc tattggc cat ttaatcgtac acaaaaatat 89 OO

Ctttaccalaa ttgttittct c tttitttgttgt gtc.ca 8935

<210s, SEQ ID NO 11
&211s LENGTH: 739
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Cote dIvoire ebolavirus NP protein
<4 OOs, SEQUENCE: 11

Met Glu Ser Arg Ala His Lys Ala Trp Met Thr His Thr Ala Ser Gly
1. 5 1O 15

Phe Glu Thir Asp Tyr His Lys Ile Lieu. Thir Ala Gly Lieu Ser Val Glin
2O 25 3O

Glin Gly Ile Val Arg Glin Arg Val Ile Glin Val His Glin Val Thr Asn
35 4O 45

Lieu. Glu Glu Ile Cys Glin Lieu. Ile Ile Glin Ala Phe Glu Ala Gly Val
SO 55 6O

Asp Phe Glin Glu Ser Ala Asp Ser Phe Lieu. Lieu Met Lieu. Cys Lieu. His
65 70 7s 8O

His Ala Tyr Glin Gly Asp Tyr Lys Glin Phe Lieu. Glu Ser Asn Ala Val
85 90 95

Llys Tyr Lieu. Glu Gly His Gly Phe Arg Phe Glu Val Arg Llys Lys Glu
1OO 105 11 O

Gly Val Lys Arg Lieu. Glu Glu Lieu. Lieu Pro Ala Ala Ser Ser Gly Lys
US 2012/025 1502 A1 Oct. 4, 2012
58

- Continued
115 12 O 125

Ser Ile Arg Arg Thr Lieu Ala Ala Met Pro Glu Glu Glu Thir Thr Glu
13 O 135 14 O

Ala Asn Ala Gly Glin Phe Lieu. Ser Phe Ala Ser Lieu. Phe Lieu Pro Llys
145 150 155 160

Lieu Val Val Gly Glu Lys Ala Cys Lieu. Glu Lys Val Glin Arg Glin Ile
1.65 17O 17s

Glin Val His Ser Glu Glin Gly Lieu. Ile Glin Tyr Pro Thr Ala Trp Glin
18O 185 19 O

Ser Val Gly His Met Met Val Ile Phe Arg Lieu Met Arg Thr Asn Phe
195 2OO 2O5

Lieu. Ile Llys Phe Lieu. Lieu. Ile His Glin Gly Met His Met Val Ala Gly
21 O 215 22O

His Asp Ala Asn Asp Ala Val Ile Ala Asn. Ser Val Ala Glin Ala Arg
225 23 O 235 24 O

Phe Ser Gly Lieu. Lieu. Ile Val Lys Thr Val Lieu. Asp His Ile Lieu. Glin
245 250 255

Llys Thr Glu. His Gly Val Arg Lieu. His Pro Lieu Ala Arg Thir Ala Lys
26 O 265 27 O

Val Lys Asn. Glu Val Asn. Ser Phe Lys Ala Ala Lieu. Ser Ser Lieu Ala
27s 28O 285

Gln His Gly Glu Tyr Ala Pro Phe Ala Arg Lieu. Lieu. Asn Lieu. Ser Gly
29 O 295 3 OO

Val Asn. Asn Lieu. Glu. His Gly Lieu. Phe Pro Glin Lieu. Ser Ala Ile Ala
3. OS 310 315 32O

Lieu. Gly Val Ala Thr Ala His Gly Ser Thr Lieu Ala Gly Val Asn. Wall
3.25 330 335

Gly Glu Glin Tyr Glin Gln Lieu. Arg Glu Ala Ala Thr Glu Ala Glu Lys
34 O 345 35. O

Glin Lieu Gln Lys Tyr Ala Glu Ser Arg Glu Lieu. Asp His Lieu. Gly Lieu.
355 360 365

Asp Asp Glin Glu Lys Lys Ile Lieu Lys Asp Phe His Glin Llys Lys Asn
37 O 375 38O

Glu Ile Ser Phe Glin Glin Thir Thr Ala Met Val Thr Lieu. Arg Lys Glu
385 390 395 4 OO

Arg Lieu Ala Lys Lieu. Thr Glu Ala Ile Thir Ser Thr Ser Lieu. Lieu Lys
4 OS 41O 415

Thr Gly Lys Glin Tyr Asp Asp Asp Asn Asp Ile Pro Phe Pro Gly Pro
42O 425 43 O

Ile Asin Asp Asn. Glu Asn. Ser Glu Glin Glin Asp Asp Asp Pro Thr Asp
435 44 O 445

Ser Glin Asp Thir Thir Ile Pro Asp Ile Ile Val Asp Pro Asp Asp Gly
450 45.5 460

Arg Tyr Asn. Asn Tyr Gly Asp Tyr Pro Ser Glu Thir Ala Asn Ala Pro
465 470 47s 48O

Glu Asp Lieu Val Lieu. Phe Asp Lieu. Glu Asp Gly Asp Glu Asp Asp His
485 490 495

Arg Pro Ser Ser Ser Ser Glu Asn. Asn. Asn Llys His Ser Lieu. Thr Gly
SOO 505 51O

Thr Asp Ser Asn Lys Thir Ser Asn Trp Asin Arg Asn Pro Thr Asn Met
515 52O 525
US 2012/025 1502 A1 Oct. 4, 2012
59

- Continued

Pro Llys Lys Asp Ser Thr Glin Asn. Asn Asp Asn. Pro Ala Glin Arg Ala
53 O 535 54 O

Glin Glu Tyr Ala Arg Asp Asn. Ile Glin Asp Thr Pro Thr Pro His Arg
5.45 550 555 560

Ala Lieu. Thr Pro Ile Ser Glu Glu Thr Gly Ser Asn Gly His Asn Glu
565 st O sts

Asp Asp Ile Asp Ser Ile Pro Pro Lieu. Glu Ser Asp Glu Glu Asn. Asn
58O 585 59 O

Thr Glu Thir Thr Ile Thir Thr Thr Lys Asn Thr Thr Ala Pro Pro Ala
595 6OO 605

Pro Val Tyr Arg Ser Asn Ser Glu Lys Glu Pro Leu Pro Glin Glu Lys
610 615 62O

Ser Glin Lys Glin Pro Asn Glin Val Ser Gly Ser Glu Asn. Thir Asp Asn
625 630 635 64 O

Llys Pro His Ser Glu Gln Ser Val Glu Glu Met Tyr Arg His Ile Leu
645 650 655

Gln Thr Glin Gly Pro Phe Asp Ala Ile Leu Tyr Tyr Tyr Met Met Thr
660 665 67 O

Glu Glu Pro Ile Val Phe Ser Thr Ser Asp Gly Lys Glu Tyr Val Tyr
675 68O 685

Pro Asp Ser Lieu. Glu Gly Glu. His Pro Pro Trp Lieu. Ser Glu Lys Glu
69 O. 695 7 OO

Ala Lieu. Asn. Glu Asp Asn Arg Phe Ile Thr Met Asp Asp Glin Glin Phe
7 Os 71O 71s 72O

Tyr Trp Pro Val Met Asn His Arg Asn Llys Phe Met Ala Ile Leu Gln
72 73 O 73

His His Lys

<210s, SEQ ID NO 12
&211s LENGTH: 341
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Cote dIvoire ebolavirus VP35 NP protein
<4 OOs, SEQUENCE: 12

Met Ile Ser Thr Arg Ala Ala Ala Ile Asin Asp Pro Ser Lieu Pro Ile
1. 5 1O 15

Arg Asn Glin Cys Thr Arg Gly Pro Glu Lieu. Ser Gly Trp Ile Ser Glu
2O 25 3O

Gln Leu Met Thr Gly Lys Ile Pro Val His Glu Ile Phe Asn Asp Thr
35 4O 45

Glu Pro His Ile Ser Ser Gly Ser Asp Cys Lieu Pro Arg Pro Lys Asn
SO 55 6O

Thr Ala Pro Arg Thr Arg Asn Thr Glin Thr Glin Thr Asp Pro Val Cys
65 70 7s 8O

Asn His Asn. Phe Glu Asp Val Thr Glin Ala Lieu. Thir Ser Lieu. Thir Asn
85 90 95

Val Ile Glin Lys Glin Ala Lieu. Asn Lieu. Glu Ser Lieu. Glu Glin Arg Ile
1OO 105 11 O

Ile Asp Lieu. Glu Asn Gly Lieu Lys Pro Met Tyr Asp Met Ala Lys Val
115 12 O 125
US 2012/025 1502 A1 Oct. 4, 2012
60

- Continued

Ile Ser Ala Luell Asn Arg Ser Ala Glu Met Wall Ala Lys Tyr Asp
13 O 135 14 O

Lell Luell Wall Met Thir Thir Gly Arg Ala Thir Ala Thir Ala Ala Ala Thir
145 150 155 160

Glu Ala Trp Glu Glu His Gly Glin Pro Pro Pro Gly Pro Ser Luell
1.65 17O 17s

Glu Glu Ser Ala Ile Arg Gly Lys Ile ASn Glin Glu Asp Lys
18O 185 19 O

Wall Pro Lys Glu Wall Glin Ala Phe Arg ASn Lell Asp Ser Thir Ser
195

Ser Luell Thir Glu Glu Asn Gly Pro Asp Ile Ser Ala Asp
21 O 22O

Lell Arg Asp Ile Met Tyr His Luell Pro Gly Phe Gly Thir Ala Phe
225 23 O 235 24 O

His Glin Luell Wall Glin Wall Luell Gly Asp Asn Ser Ala
245 250 255

Lell Asp Ile Ile His Ala Phe Glin Ala Ser Lell Ala Glu Gly Asp
26 O 265 27 O

Ser Pro Glin Ala Lell Glin Ile Thir Lys Arg Ile Pro Ile Phe
27s 285

Glin Asp Ala Thir Pro Pro Thir Ile His Ile Arg Ser Arg Gly Asp Ile
29 O 295 3 OO

Pro Arg Ala Glin Lys Ser Luell Arg Pro Wall Pro Pro Ser Pro Lys
3. OS 310 315

Ile Asp Arg Gly Trp Wall Ile Phe Glin Luell Glin Asp Gly Lys Thir
3.25 330 335

Lell Gly Luell Lys Ile

34 O

SEQ ID NO 13
LENGTH: 326
TYPE : PRT
ORGANISM: Bundibugyo ebolavirus
FEATURE:
NAMEAKEY: misc feature
OTHER INFORMATION: Cote d'Ivoire ebolavirus VP4 O NP protein
SEQUENCE: 13
Met Arg Arg Ile Ile Lell Pro Thir Ala Pro Pro Glu Met Glu Ala
1. 5 15

Wall Tyr Pro Met Arg Thir Met Asn Ser Gly Ala Asp Asn Thir Ala Ser
2O 25

Gly Pro Asn Thir Thir Thir Gly Wall Met Thir Asn Asp Thir Pro Ser
35 4O 45

Asn Ser Luell Arg Pro Wall Ala Asp Asp Asn Ile Asp His Pro Ser His
SO 55 6O

Thir Pro Asn Ser Wall Ala Ser Ala Phe Ile Luell Glu Ala Met Wall Asn
65 70

Wall Ile Ser Gly Pro Wall Luell Met Lys Glin Ile Pro Ile Trp Luell
85 90 95

Pro Luell Gly Wall Ser Asp Glin Thir Ser Phe Asp Ser Thir Thir
105 11 O

Ala Ala Ile Met Lell Ala Ser Thir Ile Thir His Phe Gly Thir
US 2012/025 1502 A1 Oct. 4, 2012
61

- Continued
115 12 O 125

Ser Asn Pro Lieu Val Arg Ile Asin Arg Lieu. Gly Pro Gly Ile Pro Asp
13 O 135 14 O

His Pro Lieu. Arg Lieu. Lieu. Arg Ile Gly Asn. Glin Ala Phe Lieu. Glin Glu
145 150 155 160

Phe Val Lieu Pro Pro Val Glin Leu Pro Glin Tyr Phe Thr Phe Asp Leu
1.65 17O 17s

Thr Ala Leu Lys Lieu. Ile Thr Glin Pro Leu Pro Ala Ala Thr Trp Thr
18O 185 19 O

Asp Glu Thr Pro Ala Val Ser Thr Gly Thr Lieu. Arg Pro Gly Ile Ser
195 2OO 2O5

Phe His Pro Llys Lieu. Arg Pro Ile Lieu. Lieu Pro Gly Arg Ala Gly Lys
21 O 215 22O

Lys Gly Ser Asn. Ser Asp Lieu. Thir Ser Pro Asp Llys Ile Glin Ala Ile
225 23 O 235 24 O

Met Asn. Phe Lieu. Glin Asp Lieu Lys Ile Val Pro Ile Asp Pro Thir Lys
245 250 255

Asn. Ile Met Gly Ile Glu Val Pro Glu Lieu. Lieu Val His Arg Lieu. Thr
26 O 265 27 O

Gly Lys Llys Thr Thr Thr Lys Asn Gly Glin Pro Ile Ile Pro Ile Leu
27s 28O 285

Lieu. Pro Llys Tyr Ile Gly Lieu. Asp Pro Leu Ser Glin Gly Asp Lieu. Thr
29 O 295 3 OO

Met Val Ile Thr Glin Asp Cys Asp Ser Cys His Ser Pro Ala Ser Lieu.
3. OS 310 315 32O

Pro Pro Val Asn Glu Lys

3.25

<210s, SEQ ID NO 14
&211s LENGTH: 676
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Cote dIvoire ebolavirus GP NP protein
<4 OOs, SEQUENCE: 14

Met Gly Ala Ser Gly Ile Lieu. Glin Lieu Pro Arg Glu Arg Phe Arg Llys
1. 5 1O 15

Thir Ser Phe Phe Val Trp Val Ile Ile Leu Phe His Llys Val Phe Ser
2O 25 3O

Ile Pro Lieu. Gly Val Val His Asn. Asn. Thir Lieu. Glin Val Ser Asp Ile
35 4O 45

Asp Llys Phe Val Cys Arg Asp Llys Lieu. Ser Ser Thr Ser Glin Lieu Lys
SO 55 6O

Ser Val Gly Lieu. Asn Lieu. Glu Gly Asn Gly Val Ala Thr Asp Val Pro
65 70 7s 8O

Thr Ala Thr Lys Arg Trp Gly Phe Arg Ala Gly Val Pro Pro Llys Val
85 90 95

Val Asn. Cys Glu Ala Gly Glu Trp Ala Glu Asn. Cys Tyr Asn Lieu Ala
1OO 105 11 O

Ile Llys Llys Val Asp Gly Ser Glu. Cys Lieu Pro Glu Ala Pro Glu Gly
115 12 O 125
US 2012/025 1502 A1 Oct. 4, 2012
62

- Continued
Val Arg Asp Phe Pro Arg Cys Arg Tyr Val His Llys Val Ser Gly Thr
13 O 135 14 O

Gly Pro Cys Pro Gly Gly Lieu Ala Phe His Lys Glu Gly Ala Phe Phe
145 150 155 160

Lieu. Tyr Asp Arg Lieu Ala Ser Thr Ile Ile Tyr Arg Gly Thr Thr Phe
1.65 17O 17s

Ala Glu Gly Val Ile Ala Phe Lieu. Ile Lieu Pro Lys Ala Arg Lys Asp
18O 185 19 O

Phe Phe Glin Ser Pro Pro Leu. His Glu Pro Ala Asn Met Thr Thr Asp
195 2OO 2O5

Pro Ser Ser Tyr Tyr His Thr Thr Thr Ile Asn Tyr Val Val Asp Asn
21 O 215 22O

Phe Gly Thr Asn Thr Thr Glu Phe Leu Phe Glin Val Asp His Lieu. Thr
225 23 O 235 24 O

Tyr Val Glin Leu Glu Ala Arg Phe Thr Pro Glin Phe Leu Val Lieu. Leu
245 250 255

Asn Glu Thir Ile Tyr Ser Asp Asn Arg Arg Ser Asn. Thir Thr Gly Lys
26 O 265 27 O

Lieu. Ile Trp Lys Ile Asn Pro Thr Val Asp Thr Ser Met Gly Glu Trp
27s 28O 285

Ala Phe Trp Glu Asn Llys Lys Asn. Phe Thir Lys Thr Lieu. Ser Ser Glu
29 O 295 3 OO

Glu Lieu Ser Phe Val Pro Val Pro Glu Thr Glin Asn Glin Val Lieu. Asp
3. OS 310 315 32O

Thir Thir Ala Thr Wal Ser Pro Pro Ile Ser Ala His Asn His Ala Ala
3.25 330 335

Glu Asp His Lys Glu Lieu Val Ser Glu Asp Ser Thr Pro Val Val Glin
34 O 345 35. O

Met Glin Asn Ile Lys Gly Lys Asp Thr Met Pro Thr Thr Val Thr Gly
355 360 365

Val Pro Thir Thr Thr Pro Ser Pro Phe Pro Ile Asn Ala Arg Asn Thr
37 O 375 38O

Asp His Thir Lys Ser Phe Ile Gly Lieu. Glu Gly Pro Glin Glu Asp His
385 390 395 4 OO

Ser Thir Thr Glin Pro Ala Lys Thr Thr Ser Gln Pro Thr Asn Ser Thr
4 OS 41O 415

Glu Ser Thr Thr Lieu. Asn Pro Thr Ser Glu Pro Ser Ser Arg Gly Thr
42O 425 43 O

Gly Pro Ser Ser Pro Thr Val Pro Asn. Thir Thr Glu Ser His Ala Glu
435 44 O 445

Lieu. Gly Lys Thr Thr Pro Thr Thr Lieu Pro Glu Gln His Thr Ala Ala
450 45.5 460

Ser Ala Ile Pro Arg Ala Wal His Pro Asp Glu Lieu. Ser Gly Pro Gly
465 470 47s 48O

Phe Lieu. Thir Asn. Thir Ile Arg Gly Val Thr Asn Lieu Lleu. Thr Gly Ser
485 490 495

Arg Arg Lys Arg Arg Asp Val Thr Pro Asn Thr Glin Pro Llys Cys Asn
SOO 505 51O

Pro Asn Lieu. His Tyr Trp Thr Ala Lieu. Asp Glu Gly Ala Ala Ile Gly
515 52O 525

Lieu Ala Trp Ile Pro Tyr Phe Gly Pro Ala Ala Glu Gly Ile Tyr Thr
US 2012/025 1502 A1 Oct. 4, 2012
63

- Continued
53 O 535 54 O

Glu Gly Ile Met Glu Asn Glin Asn Gly Lieu. Ile Cys Gly Lieu. Arg Glin
5.45 550 555 560

Lieu Ala Asn. Glu Thir Thr Glin Ala Lieu. Glin Lieu. Phe Lieu. Arg Ala Thr
565 st O sts

Thr Glu Lieu. Arg Thr Phe Ser Ile Lieu. Asn Arg Lys Ala Ile Asp Phe
58O 585 59 O

Lieu. Lieu. Glin Arg Trp Gly Gly Thr Cys His Ile Lieu. Gly Pro Asp Cys
595 6OO 605

Cys Ile Glu Pro Glin Asp Trp Thir Lys Asn. Ile Thr Asp Llys Ile Asp
610 615 62O

Glin Ile Ile His Asp Phe Val Asp Asn. Asn Lieu Pro Asn Glin Asn Asp
625 630 635 64 O

Gly Ser Asn Trp Trp Thr Gly Trp Lys Glin Trp Val Pro Ala Gly Ile
645 650 655

Gly Ile Thr Gly Val Ile Ile Ala Ile Ile Ala Lieu. Lieu. Cys Ile Cys
660 665 67 O

Llys Phe Met Leu

675

<210s, SEQ ID NO 15
&211s LENGTH: 365
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Cote dIvoire ebolavirus SGP NP protein
<4 OOs, SEQUENCE: 15

Met Gly Ala Ser Gly Ile Lieu. Glin Lieu Pro Arg Glu Arg Phe Arg Llys
1. 5 1O 15

Thir Ser Phe Phe Val Trp Val Ile Ile Leu Phe His Llys Val Phe Ser
2O 25 3O

Ile Pro Lieu. Gly Val Val His Asn. Asn. Thir Lieu. Glin Val Ser Asp Ile
35 4O 45

Asp Llys Phe Val Cys Arg Asp Llys Lieu. Ser Ser Thr Ser Glin Lieu Lys
SO 55 6O

Ser Val Gly Lieu. Asn Lieu. Glu Gly Asn Gly Val Ala Thr Asp Val Pro
65 70 7s 8O

Thr Ala Thr Lys Arg Trp Gly Phe Arg Ala Gly Val Pro Pro Llys Val
85 90 95

Val Asn. Cys Glu Ala Gly Glu Trp Ala Glu Asn. Cys Tyr Asn Lieu Ala
1OO 105 11 O

Ile Llys Llys Val Asp Gly Ser Glu. Cys Lieu Pro Glu Ala Pro Glu Gly
115 12 O 125

Val Arg Asp Phe Pro Arg Cys Arg Tyr Val His Llys Val Ser Gly Thr
13 O 135 14 O

Gly Pro Cys Pro Gly Gly Lieu Ala Phe His Lys Glu Gly Ala Phe Phe
145 150 155 160

Lieu. Tyr Asp Arg Lieu Ala Ser Thr Ile Ile Tyr Arg Gly Thr Thr Phe
1.65 17O 17s

Ala Glu Gly Val Ile Ala Phe Lieu. Ile Lieu Pro Lys Ala Arg Lys Asp
18O 185 19 O
US 2012/025 1502 A1 Oct. 4, 2012
64

- Continued
Phe Phe Glin Ser Pro Pro Leu. His Glu Pro Ala Asn Met Thr Thr Asp
195 2OO 2O5

Pro Ser Ser Tyr Tyr His Thr Thr Thr Ile Asn Tyr Val Val Asp Asn
21 O 215 22O

Phe Gly Thr Asn Thr Thr Glu Phe Leu Phe Glin Val Asp His Lieu. Thr
225 23 O 235 24 O

Tyr Val Glin Leu Glu Ala Arg Phe Thr Pro Glin Phe Leu Val Lieu. Leu
245 250 255

Asn Glu Thir Ile Tyr Ser Asp Asn Arg Arg Ser Asn. Thir Thr Gly Lys
26 O 265 27 O

Lieu. Ile Trp Lys Ile Asn Pro Thr Val Asp Thr Ser Met Gly Glu Trp
27s 28O 285

Ala Phe Trp Glu Asn Lys Llys Thr Ser Glin Llys Pro Phe Glin Val Lys
29 O 295 3 OO

Ser Cys Lieu Ser Tyr Lieu. Tyr Glin Llys Pro Arg Thr Arg Ser Lieu. Thr
3. OS 310 315 32O

Arg Glin Arg Arg Ser Lieu. Leu Pro Ser Pro Pro Thr Thr Thr Glin Pro
3.25 330 335

Lys. Thir Thr Lys Asn Trp Phe Glin Arg Ile Pro Leu Gln Trp Phe Arg
34 O 345 35. O

Cys Llys Thr Ser Arg Glu Arg Thr Glin Cys Gln Pro Gln
355 360 365

<210s, SEQ ID NO 16
&211s LENGTH: 3O2
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Cote dIvoire ebolavirus SSGP NP protein
<4 OOs, SEQUENCE: 16

Met Gly Ala Ser Gly Ile Lieu. Glin Lieu Pro Arg Glu Arg Phe Arg Llys
1. 5 1O 15

Thir Ser Phe Phe Val Trp Val Ile Ile Leu Phe His Llys Val Phe Ser
2O 25 3O

Ile Pro Lieu. Gly Val Val His Asn. Asn. Thir Lieu. Glin Val Ser Asp Ile
35 4O 45

Asp Llys Phe Val Cys Arg Asp Llys Lieu. Ser Ser Thr Ser Glin Lieu Lys
SO 55 6O

Ser Val Gly Lieu. Asn Lieu. Glu Gly Asn Gly Val Ala Thr Asp Val Pro
65 70 7s 8O

Thr Ala Thr Lys Arg Trp Gly Phe Arg Ala Gly Val Pro Pro Llys Val
85 90 95

Val Asn. Cys Glu Ala Gly Glu Trp Ala Glu Asn. Cys Tyr Asn Lieu Ala
1OO 105 11 O

Ile Llys Llys Val Asp Gly Ser Glu. Cys Lieu Pro Glu Ala Pro Glu Gly
115 12 O 125

Val Arg Asp Phe Pro Arg Cys Arg Tyr Val His Llys Val Ser Gly Thr
13 O 135 14 O

Gly Pro Cys Pro Gly Gly Lieu Ala Phe His Lys Glu Gly Ala Phe Phe
145 150 155 160

Lieu. Tyr Asp Arg Lieu Ala Ser Thr Ile Ile Tyr Arg Gly Thr Thr Phe
1.65 17O 17s
US 2012/025 1502 A1 Oct. 4, 2012
65

- Continued

Ala Glu Gly Val Ile Ala Phe Lieu. Ile Lieu Pro Lys Ala Arg Lys Asp
18O 185 19 O

Phe Phe Glin Ser Pro Pro Leu. His Glu Pro Ala Asn Met Thr Thr Asp
195 2OO 2O5

Pro Ser Ser Tyr Tyr His Thr Thr Thr Ile Asn Tyr Val Val Asp Asn
21 O 215 22O

Phe Gly Thr Asn Thr Thr Glu Phe Leu Phe Glin Val Asp His Lieu. Thr
225 23 O 235 24 O

Tyr Val Glin Leu Glu Ala Arg Phe Thr Pro Glin Phe Leu Val Lieu. Leu
245 250 255

Asn Glu Thir Ile Tyr Ser Asp Asn Arg Arg Ser Asn. Thir Thr Gly Lys
26 O 265 27 O

Lieu. Ile Trp Lys Ile Asn Pro Thr Val Asp Thr Ser Met Gly Glu Trp
27s 28O 285

Ala Phe Trp Glu Asn Llys Llys Lieu. His Lys Asn Pro Phe Lys
29 O 295 3 OO

<210s, SEQ ID NO 17
&211s LENGTH: 289
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Cote dIvoire ebolavirus VP3O NP protein
<4 OOs, SEQUENCE: 17

Met Glu Val Val His Glu Arg Gly Arg Ser Arg Ile Ser Arg Glin Asn
1. 5 1O 15

Thir Arg Asp Gly Pro Ser His Lieu Val Arg Ala Arg Ser Ser Ser Arg
2O 25 3O

Ala Ser Tyr Arg Ser Glu Tyr His Thr Pro Arg Ser Ala Ser Glin Ile
35 4O 45

Arg Val Pro Thr Val Phe His Arg Llys Llys Thr Asp Lieu. Lieu. Thr Val
SO 55 6O

Pro Pro Ala Pro Lys Asp Val Cys Pro Thir Lieu Lys Lys Gly Phe Lieu.
65 70 7s 8O

Cys Asp Ser Asn. Phe Cys Llys Lys Asp His Glin Lieu. Glu Ser Lieu. Thir
85 90 95

Asp Arg Glu Lieu Lleu Lleu Lieu. Ile Ala Arg Llys Thr Cys Gly Ser Thr
1OO 105 11 O

Glu Glin Glin Lieu. Ser Ile Val Ala Pro Lys Asp Ser Arg Lieu Ala Asn
115 12 O 125

Pro Ile Ala Glu Asp Phe Glin Glin Lys Asp Gly Pro Llys Val Thir Lieu.
13 O 135 14 O

Ser Met Lieu. Ile Glu Thir Ala Glu Tyr Trp Ser Lys Glin Asp Ile Llys
145 150 155 160

Asn. Ile Asp Asp Ser Arg Lieu. Arg Ala Lieu. Lieu. Thir Lieu. Cys Ala Val
1.65 17O 17s

Met Thr Arg Llys Phe Ser Lys Ser Glin Lieu. Ser Lieu. Lieu. Cys Glu Ser
18O 185 19 O

His Lieu. Arg Arg Glu Gly Lieu. Gly Glin Asp Glin Ser Glu Ser Val Lieu.
195 2OO 2O5

Glu Val Tyr Glin Arg Lieu. His Ser Asp Llys Gly Gly Asn. Phe Glu Ala
US 2012/025 1502 A1 Oct. 4, 2012
66

- Continued
21 O 215 22O

Ala Leu Trp Glin Gln Trp Asp Arg Glin Ser Lieu. Ile Met Phe Ile Thr
225 23 O 235 24 O

Ala Phe Lieu. Asn. Ile Ala Lieu. Glin Lieu Pro Cys Glu Ser Ser Ser Val
245 250 255

Val Ile Ser Gly Lieu. Arg Met Lieu. Ile Pro Glin Ser Glu Ala Thr Glu
26 O 265 27 O

Val Val Thr Pro Ser Glu Thir Cys Thr Trp Ser Glu Gly Gly Ser Ser
27s 28O 285

His

<210s, SEQ ID NO 18
&211s LENGTH: 251
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Cote dIvoire ebolavirus VP24 NP protein
<4 OOs, SEQUENCE: 18

Met Ala Lys Ala Thr Gly Arg Tyr Asn Lieu. Ile Ser Pro Llys Lys Asp
1. 5 1O 15

Lieu. Glu Lys Gly Lieu Val Lieu. Asn Asp Lieu. Cys Thr Lieu. Ser Val Ala
2O 25 3O

Gln Thr Val Glin Gly Trp Llys Val Thir Trp Ala Gly Ile Glu Phe Asp
35 4O 45

Val Thr Glin Lys Gly Met Ala Lieu. Lieu. His Arg Lieu Lys Thir Ser Asp
SO 55 6O

Phe Ala Pro Ala Trp Ser Met Thr Arg Asn Lieu Phe Pro His Leu Phe
65 70 7s 8O

Glin Asn Pro Asn. Ser Thir Ile Glu Ser Pro Lieu. Trp Ala Lieu. Arg Val
85 90 95

Ile Lieu Ala Ala Gly Ile Glin Asp Glin Lieu. Ile Asp Glin Ser Lieu. Ile
1OO 105 11 O

Glu Pro Lieu Ala Gly Ala Lieu. Gly Lieu. Ile Ala Asp Trp Lieu. Lieu. Thir
115 12 O 125

Thr Gly Thr Asn His Phe Gln Met Arg Thr Glin Glin Ala Lys Glu Gln
13 O 135 14 O

Lieu. Ser Lieu Lys Met Lieu. Ser Lieu Val Arg Ser Asn. Ile Lieu Lys Phe
145 150 155 160

Ile Asin Glin Lieu. Asp Ala Lieu. His Val Val Asn Tyr Asn Gly Lieu. Lieu.
1.65 17O 17s

Ser Ser Ile Glu Ile Gly. Thir Lys Ser His Thr Ile Ile Ile Thr Arg
18O 185 19 O

Thir Asn Met Gly Phe Lieu Val Glu Lieu. Glin Glu Pro Asp Llys Ser Ala
195 2OO 2O5

Met Asn Thr Arg Llys Pro Gly Pro Val Llys Phe Ser Lieu. Lieu. His Glu
21 O 215 22O

Ser Thr Lieu Lys Thr Lieu Ala Lys Llys Pro Ala Thr Gln Met Glin Ala
225 23 O 235 24 O

Lieu. Ile Lieu. Glu Phe Asn. Ser Ser Lieu Ala Ile
245 250
US 2012/025 1502 A1 Oct. 4, 2012
67

- Continued
<210s, SEQ ID NO 19
&211s LENGTH: 221 O
212. TYPE: PRT
<213> ORGANISM: Bundibugyo ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223> OTHER INFORMATION: Cote dIvoire ebolavirus L. NP protein
<4 OOs, SEQUENCE: 19

Met Ala Thr Gln His Thr Glin Tyr Pro Asp Ala Arg Lieu Ser Ser Pro
1. 5 1O 15

Ile Val Lieu. Asp Gln Cys Asp Lieu Val Thr Arg Ala Cys Gly Lieu. Tyr
2O 25 3O

Ser Ala Tyr Ser Lieu. ASn Pro Glin Lieu Lys Asn. Cys Arg Lieu Pro Llys
35 4O 45

His Ile Tyr Arg Lieu Lys Tyr Asp Thir Thr Val Thr Glu Phe Leu Ser
SO 55 6O

Asp Val Pro Val Ala Thr Lieu Pro Ala Asp Phe Leu Val Pro Thr Phe
65 70 7s 8O

Lieu. Arg Thr Lieu. Ser Gly Asn Gly Ser Cys Pro Ile Asp Pro Llys Cys
85 90 95

Ser Glin Phe Lieu. Glu Glu Ile Val Asn Tyr Thr Lieu. Glin Asp Ile Arg
1OO 105 11 O

Phe Lieu. Asn Tyr Tyr Lieu. Asn Arg Ala Gly Val His Asn Asp His Val
115 12 O 125

Asp Arg Asp Phe Gly Glin Lys Ile Arg Asn Lieu. Ile Cys Asp Asn. Glu
13 O 135 14 O

Val Lieu. His Glin Met Phe His Trp Tyr Asp Lieu Ala Ile Lieu Ala Arg
145 150 155 160

Arg Gly Arg Lieu. Asn Arg Gly Asn. Asn Arg Ser Thir Trp Phe Ala Ser
1.65 17O 17s

Asp Asn Lieu Val Asp Ile Lieu. Gly Tyr Gly Asp Tyr Ile Phe Trp Llys
18O 185 19 O

Ile Pro Lieu. Ser Lieu Lleu Pro Val Asp Thr Glin Gly Lieu Pro His Ala
195 2OO 2O5

Ala Lys Asp Trp Tyr His Glu Ser Val Phe Lys Glu Ala Ile Glin Gly
21 O 215 22O

His Thr His Ile Val Ser Ile Ser Thr Ala Asp Val Lieu. Ile Met Cys
225 23 O 235 24 O

Lys Asp Ile Ile Thr Cys Arg Phe Asn. Thir Lieu. Lieu. Ile Ala Ala Val
245 250 255

Ala Asn Lieu. Glu Asp Ser Val His Ser Asp Tyr Pro Lieu Pro Glu Thr
26 O 265 27 O

Val Ser Asp Lieu. Tyr Lys Ala Gly Asp Tyr Lieu. Ile Ser Lieu. Lieu. Gly
27s 28O 285

Ser Glu Gly Tyr Llys Val Ile Llys Phe Lieu. Glu Pro Lieu. Cys Lieu Ala
29 O 295 3 OO

Lys Ile Glin Lieu. Cys Ser Asn Tyr Thr Glu Arg Lys Gly Arg Phe Lieu.
3. OS 310 315 32O

Thr Gln Met His Lieu Ala Val Asn His Thr Lieu. Glu Glu Lieu. Thr Gly
3.25 330 335

Ser Arg Glu Lieu. Arg Pro Glin Glin Ile Arg Llys Val Arg Glu Phe His
34 O 345 35. O
US 2012/025 1502 A1 Oct. 4, 2012
68

- Continued
Glin Met Lieu. Ile Asn Lieu Lys Ala Thr Pro Glin Glin Lieu. Cys Glu Lieu.
355 360 365

Phe Ser Val Glin Lys His Trp Gly His Pro Val Lieu. His Ser Glu Lys
37 O 375 38O

Ala Ile Glin Llys Val Llys Llys His Ala Thr Val Ile Lys Ala Lieu. Arg
385 390 395 4 OO

Pro Ile Ile Ile Phe Glu Thr Tyr Cys Val Phe Lys Tyr Ser Ile Ala
4 OS 41O 415

Lys His Tyr Phe Asp Ser Glin Gly. Thir Trp Tyr Ser Val Thr Ser Asp
42O 425 43 O

Arg Cys Lieu. Thr Pro Gly Lieu. Ser Ser Tyr Ile Lys Arg Asn Glin Phe
435 44 O 445

Pro Pro Leu Pro Met Ile Lys Glu Lieu. Leu Trp Glu Phe Tyr His Leu
450 45.5 460

Asp His Pro Pro Leu Phe Ser Thr Llys Val Ile Ser Asp Leu Ser Ile
465 470 47s 48O

Phe Ile Lys Asp Arg Ala Thr Ala Val Glu Lys Thr Cys Trp Asp Ala
485 490 495

Val Phe Glu Pro Asn Val Lieu. Gly Tyr Asn Pro Pro Asn Llys Phe Ala
SOO 505 51O

Thr Lys Arg Val Pro Glu Glin Phe Leu Glu Gln Glu Asn Phe Ser Ile
515 52O 525

Glu Ser Val Lieu. His Tyr Ala Glin Arg Lieu. Glu Tyr Lieu. Lieu Pro Glu
53 O 535 54 O

Tyr Arg Asn. Phe Ser Phe Ser Lieu Lys Glu Lys Glu Lieu. Asn. Ile Gly
5.45 550 555 560

Arg Ala Phe Gly Lys Lieu Pro Tyr Pro Thr Arg Asn Val Glin Thr Lieu.
565 st O sts

Cys Glu Ala Lieu. Lieu Ala Asp Gly Lieu Ala Lys Ala Phe Pro Ser Asn
58O 585 59 O

Met Met Val Val Thr Glu Arg Glu Gln Lys Glu Ser Lieu. Lieu. His Glin
595 6OO 605

Ala Ser Trp His His Thr Ser Asp Asp Phe Gly Glu Asn Ala Thr Val
610 615 62O

Arg Gly Ser Ser Phe Val Thr Asp Lieu. Glu Lys Tyr Asn Lieu Ala Phe
625 630 635 64 O

Arg Tyr Glu Phe Thr Ala Pro Phe Ile Glu Tyr Cys Asn Arg Cys Tyr
645 650 655

Gly Val Arg Asn Lieu Phe Asn Trp Met His Tyr Thr Ile Pro Glin Cys
660 665 67 O

Tyr Ile His Val Ser Asp Tyr Tyr Asn Pro Pro His Gly Val Ser Lieu.
675 68O 685

Glu Asn Arg Glu Asn Pro Pro Glu Gly Pro Ser Ser Tyr Arg Gly His
69 O. 695 7 OO

Lieu. Gly Gly Ile Glu Gly Lieu. Glin Glin Llys Lieu. Trp Thir Ser Ile Ser
7 Os 71O 71s 72O

Cys Ala Glin Ile Ser Lieu Val Glu Ile Llys Thr Gly Phe Llys Lieu. Arg
72 73 O 73

Ser Ala Val Met Gly Asp Asn Gln Cys Ile Thr Val Lieu Ser Val Phe
740 74. 7 O

Pro Lieu. Glu Thr Glu Ser Ser Glu Glin Glu Lieu. Ser Ser Glu Asp Asn
US 2012/025 1502 A1 Oct. 4, 2012
69

- Continued
7ss 760 765

Ala Ala Arg Val Ala Ala Ser Lieu Ala Lys Val Thir Ser Ala Cys Gly
770 775 78O

Ile Phe Leu Lys Pro Asp Glu Thr Phe Val His Ser Gly Phe Ile Tyr
78s 79 O 79. 8OO

Phe Gly Llys Lys Glin Tyr Lieu. Asn Gly Val Glin Lieu Pro Glin Ser Lieu.
805 810 815

Llys Thr Ala Thir Arg Ile Ala Pro Lieu. Ser Asp Ala Ile Phe Asp Asp
82O 825 83 O

Lieu. Glin Gly. Thir Lieu Ala Ser Ile Gly. Thir Ala Phe Glu Arg Ser Ile
835 84 O 845

Ser Glu Thr Arg His Val Val Pro Cys Arg Val Ala Ala Ala Phe His
850 855 860

Thr Phe Phe Ser Val Arg Ile Leu Gln Tyr His His Leu Gly Phe Asn
865 87O 87s 88O

Lys Gly Thr Asp Lieu. Gly Glin Lieu. Ser Lieu. Ser Llys Pro Lieu. Asp Phe
885 890 895

Gly. Thir Ile Thr Lieu Ala Lieu Ala Val Pro Glin Val Lieu. Gly Gly Lieu.
9 OO 905 91 O

Ser Phe Lieu. Asn. Pro Glu Lys Cys Phe Tyr Arg Asn Lieu. Gly Asp Pro
915 92 O 925

Val Thr Ser Gly Lieu Phe Gln Leu Lys Thr Tyr Lieu Gln Met Ile His
93 O 935 94 O

Met Asp Asp Lieu. Phe Lieu Pro Lieu. Ile Ala Lys Asn Pro Gly Asn. Cys
945 950 955 96.O

Ser Ala Ile Asp Phe Val Lieu. Asn Pro Ser Gly Lieu. Asn Val Pro Gly
965 97O 97.

Ser Glin Asp Lieu. Thir Ser Phe Lieu. Arg Glin Ile Val Arg Arg Thir Ile
98O 985 99 O

Thir Lieu. Ser Ala Lys Asn Llys Lieu. Ile Asn. Thir Lieu. Phe His Ser Ser
995 1OOO 1005

Ala Asp Lieu. Glu Asp Glu Met Val Cys Llys Trp Lieu. Lieu. Ser Ser
O1O O15 O2O

Thr Pro Val Met Ser Arg Phe Ala Ala Asp Ile Phe Ser Arg Thr
O25 O3 O O35

Pro Ser Gly Lys Arg Lieu. Glin Ile Lieu. Gly Tyr Lieu. Glu Gly Thr
O4 O O45 OSO

Arg Thr Lieu. Lieu Ala Ser Lys Ile Ile Asn His Asn Thr Glu Thr
O55 O6 O O65

Pro Ile Lieu. Asp Arg Lieu. Arg Lys Ile Thr Lieu. Glin Arg Trp Ser
Of O O7 O8O

Lieu. Trp Phe Ser Tyr Lieu. Asp His Cys Asp Glin Val Lieu Ala Asp
O85 O9 O O95

Ala Lieu. Thr Glin Ile Thr Cys Thr Val Asp Lieu Ala Glin Ile Lieu.
1 OO 105 11 O

Arg Glu Tyr Thir Trp Ala His Ile Lieu. Glu Gly Arg Glin Lieu. Ile
115 12 O 125

Gly Ala Thr Lieu Pro Cys Ile Lieu. Glu Glin Lieu. Asn Val Ile Trp
13 O 135 14 O

Lieu Lys Pro Tyr Glu. His Cys Pro Llys Cys Ala Lys Ser Ala Asn
145 15 O 155
US 2012/025 1502 A1 Oct. 4, 2012
70

- Continued

Pro Lys Gly Glu Pro Phe Val Ser Ile Ala Ile Llys Llys His Val
16 O 1.65 17 O

Val Ser Ala Trp Pro Asp Glin Ser Arg Lieu Ser Trp Thr Ile Gly
17s 18O 185

Asp Gly Ile Pro Tyr Ile Gly Ser Arg Thr Glu Asp Llys Ile Gly
190 195 2OO

Glin Pro Ala Ile Llys Pro Llys Cys Pro Ser Ala Ala Lieu. Arg Glu
2O5 21 O 215

Ala Ile Glu Lieu. Thir Ser Arg Lieu. Thir Trp Val Thr Glin Gly Gly
22O 225 23 O

Ala Asn. Ser Asp Lieu. Lieu Val Llys Pro Phe Ile Glu Ala Arg Val
235 24 O 245

Asn Lieu. Ser Val Glin Glu Ile Leu Gln Met Thr Pro Ser His Tyr
250 255 26 O

Ser Gly Asn Ile Val His Arg Tyr Asn Asp Gln Tyr Ser Pro His
265 27 O 27s

Ser Phe Met Ala Asn Arg Met Ser Asn. Ser Ala Thr Arg Lieu Val
28O 285 29 O

Val Ser Thr Asn Thr Lieu. Gly Glu Phe Ser Gly Gly Gly Glin Ser
295 3OO 305

Ala Arg Asp Ser Asn. Ile Ile Phe Glin Asn Val Ile Asn. Phe Ala

Val Ala Lieu. Phe Asp Lieu. Arg Phe Arg Asn. Wall Ala Thir Ser Ser

Ile Glin His His Arg Ala His Lieu. His Lieu. Ser Lys Cys Cys Thr
34 O 345 350

Arg Glu Val Pro Ala Glin Tyr Lieu Val Tyr Thr Ser Thr Lieu Pro
355 360 365

Lieu. Asp Lieu. Thir Arg Tyr Arg Asp Asn. Glu Lieu. Ile Tyr Asp Asp
37O 375 38O

Asn Pro Lieu. Arg Gly Gly Lieu. Asn. Cys Asn Lieu. Ser Phe Asp Asn
385 390 395

Pro Lieu. Phe Lys Gly Glin Arg Lieu. Asn. Ile Ile Glu Glu Asp Lieu.
4 OO 405 41 O

Ile Arg Lieu Pro Tyr Lieu. Ser Gly Trp Glu Lieu Ala Lys Thr Val
415 42O 425

Ile Glin Ser Ile Ile Ser Asp Ser Asn Asn Ser Ser Thr Asp Pro
43 O 435 44 O

Ile Ser Ser Gly Glu Thir Arg Ser Phe Thr Thr His Phe Lieu. Thr
445 450 45.5

Tyr Pro Lys Ile Gly Lieu. Leu Tyr Ser Phe Gly Ala Lieu. Ile Ser
460 465 47 O

yr Lieu. Gly Asn. Thir Ile Ile Arg Thr Llys Llys Lieu. Thir Lieu
47s 48O 485

Asn Asn Phe Ile Tyr Tyr Lieu Ala Thr Glin Ile His Asn Lieu Pro
490 495 SOO

His Arg Ser Lieu. Arg Ile Lieu Lys Pro Thr Lieu Lys His Ala Ser
5 OS 510 515

Val Ile Ser Arg Lieu. Ile Ser Ile Asp Ser His Phe Ser Ile Tyr
52O 525 53 O
US 2012/025 1502 A1 Oct. 4, 2012
71

- Continued
Ile Gly Gly Thr Ala Gly Asp Arg Gly Lieu. Ser Asp Ala Ala Arg
535 54 O 545

Lieu. Phe Lieu. Arg Thr Ala Ile Thr Val Phe Leu Glin Phe Val Arg
550 555 560

Llys Trp Ile Val Glu Arg Llys Thir Ala Ile Pro Lieu. Trp Val Ile
565 st O sts

Tyr Pro Leu Glu Gly Glin Ser Pro Ser Pro Ile Asn Ser Phe Lieu.
58O 585 590

His His Val Ile Ala Lieu. Lieu Gln His Glu Ser Ser His Asp His
595 6OO 605

Val Cys Ala Ala Glu Ala His Ser Arg Val Glu Thir Phe Asp Asn
610 615 62O

Lieu Val Tyr Met Cys Llys Ser Thr Ala Ser Asn Phe Phe His Ala
625 63 O 635

Ser Lieu Ala Tyr Trp Arg Ser Arg Ser Lys Asn Glin Asp Lys Arg
64 O 645 650

Glu Met Thr Lys Ile Leu Ser Lieu. Thr Glin Thr Glu Lys Lys Asn
655 660 665

Ser Phe Gly Tyr Thr Ala His Pro Glu Ser Thr Ala Val Lieu. Gly
670 675 68O

Ser Lieu. Glin Thir Ser Lieu Ala Pro Pro Pro Ser Ala Asp Glu Ala
685 69 O. 695

Thir Tyr Asp Arg Lys Asn Llys Val Lieu Lys Ala Ser Arg Pro Gly
7 OO 7Os 71O

yr Ser Glin Asn. Thir Thr Lys Ala Pro Pro Asn Gln Thr Ser
71s 72 O 72

Cys Arg Asp Val Ser Pro Asn Ile Thr Gly Thr Asp Gly Cys Pro
73 O 73 74 O

Ser Ala Asn. Glu Gly Ser Asn. Ser Asn. Asn. Asn. Asn Lieu Val Ser
74. 7 O 7ss

His Arg Ile Val Lieu Pro Phe Phe Thr Lieu Ser His Asn Tyr Asn
760 765 770

Glu Arg Pro Ser Ile Arg Llys Ser Glu Gly. Thir Thr Glu Ile Val
775 78O 78s

Arg Lieu. Thir Arg Glin Lieu. Arg Ala Ile Pro Asp Thir Thir Ile Tyr
79 O 79. 8OO

Cys Arg Phe Thr Gly Ile Val Ser Ser Met His Tyr Lys Lieu. Asp
805 810 815

Glu Val Lieu. Trp Glu Phe Asp Asin Phe Llys Ser Ala Ile Thr Lieu.
82O 825 83 O

Ala Glu Gly Glu Gly Ser Gly Ala Lieu. Lieu Lleu Lleu Gln Llys Tyr
835 84 O 845

Llys Val Glu Thir Lieu. Phe Phe Asn Thr Lieu Ala Thr Glu. His Ser
850 855 86 O

Ile Glu Ala Glu Ile Ile Ser Gly Ile Thr Thr Pro Arg Met Leu
865 87 O 87s

Lieu Pro Ile Met Ser Arg Phe His Gly Gly Glin Ile Llys Val Thr
88O 885 890

Lieu. Asn Asn Ser Ala Ser Glin Ile Thr Asp Ile Thr Asn Pro Ser
895 9 OO 905

Trp Lieu Ala Asp Gln Lys Ser Arg Ile Pro Llys Glin Val Glu Ile
US 2012/025 1502 A1 Oct. 4, 2012
72

- Continued
910 915 92 O

Ile Thr Met Asp Ala Glu Thir Thr Glu ASn Ile Asn Arg Ser
925 93 O 935

Lieu. Tyr Glu Ala Val Glin Glin Lieu. Ile Wall Ser His Ile Asp Pro
94 O 945 950

Asn Ala Lieu Lys Val Val Val Lieu Wall Phe Lell Ser Asp Ile
955 96.O 965

Asp Gly Ile Lieu. Trp Lieu. Asn Asp Asn Luell Thir Pro Luell Phe Gly
97O 97. 98 O

Lieu. Gly Tyr Lieu. Ile Llys Pro Ile Thir Ser Ser Pro Ser Ser
985 990 995

Glu Trp Tyr Lieu. Cys Lieu. Ser Asn Luell Luell Ser Ser Arg Arg
2OOO 2005 2010

Lieu. Pro His Glin Ser His Thir Thr Met His Wall Ile Glin Thir
2015 2O2O 2O25

Ala Lieu. Glin Lieu. Glin Ile Glin Arg Ser Ser Trp Luell Ser His
2O3O 2O35 2O4. O

Lieu Val Glin Tyr Ala Asn His Asn Luell His Lell Asp Ile Asn
2O45 2OSO 2O55

Lieu. Gly Phe Pro Ser Lieu. Glu Arg Wall Luell His Arg Asn
2O60 2O65 2. Of O

Lieu Val Asp Ser Glin Lys Gly Pro Luell Thir Ser Wall Glin His
2O75 2O8 O

Lieu Ala His Lieu. Glin Thr Glu Ile Arg Glu Lell ASn Asp
2O90 2095

Asn Glin Glin Arg Glin Ser Arg Thr Glin Thir Phe Ile
2105 211 O

Thir Ile Lys Gly Arg Ile Thir Lys Luell Wall Asn Lell
212O 2125

Phe Phe Lieu. Ile Ile Glin Ala Lieu. His Asn Thir Trp Glin
2135 214 O

Glu Glu Lieu. Arg Ala Lieu Pro Asp Luell Ile Ser Thir Arg
2150 215.5

Phe Tyr His Thr Arg Asn Cys Ser Glu Asn Phe Lell Wall
21 65 217 O

Gln Thr Lieu. Tyr Lieu Ser Arg Met Glin Asp Ser Ile Lell
218O 21.85

Ile Asp Arg Lieu. Thr Gly Lieu. Lieu. Ser Luell Pro ASn Gly Phe
21.95 22 OO 22O5

Phe Arg
221 O

<210s, SEQ ID NO 2 O
&211s LENGTH: 18959
&212s. TYPE: DNA
<213> ORGANISM; Zaire ebolavirus
22 Os. FEATURE:
<221 > NAMEAKEY: misc feature
<223s OTHER INFORMATION: Full viral sequence

<4 OOs, SEQUENCE: 2O

cggacacaca aaaagaaaga agaatttitta ggat Cttttgttgc gaata act atgagga
agattaataa tttitcc tict c attgaaattt at atcggaat ttaaattgaa attgttactg 12 O