See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/228442160

Variations in the occurrence of specific rpoB mutations in rifampicin-resistant

Mycobacterium tuberculosis isolates from patients of different ethnic groups in
Kuwait

Article  in  The Indian Journal of Medical Research · May 2012

Source: PubMed

CITATIONS READS

24 73

3 authors, including:

Suhail Ahmad
Kuwait University
301 PUBLICATIONS   5,008 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Molecular characterization of multidrug -resistant Mycobacterium tuberculosis strains isolated in Kuwait View project

All content following this page was uploaded by Suhail Ahmad on 25 November 2014.

The user has requested enhancement of the downloaded file.

Indian J Med Res 135, May 2012, pp 756-762

Variations in the occurrence of specific rpoB mutations in rifampicin-

resistant Mycobacterium tuberculosis isolates from patients of
different ethnic groups in Kuwait

Suhail Ahmad, Noura M. Al-Mutairi & Eiman Mokaddas

Department of Microbiology, Faculty of Medicine, Kuwait University, Kuwait

Received January 18, 2011

Background & objectives: Frequency of resistance-conferring mutations vary among isoniazid- and
ethambutol-resistant Mycobacterium tuberculosis isolates obtained from patients of various ethnic
groups. This study was aimed to determine the occurrence of specific rpoB mutations in rifampicin-
resistant M. tuberculosis isolates from tuberculosis patients of various ethnic groups in Kuwait.
Methods: Rifampicin-resistant M. tuberculosis isolates (n=119) from South Asian (n=55), Southeast Asian
(n=23), Middle Eastern (n=39) and other (n=2) patients and 107 rifampicin-susceptible isolates were
tested. Mutations in rpoB were detected by DNA sequencing. Polymorphisms at katG463 and gyrA95
were detected by PCR-RFLP for genetic group assignment.
Results: None of rifampicin-susceptible but 116 of 119 rifampicin-resistant isolates showed rpoB
mutation(s). Mutations among isolates from South Asian patients were distributed at rpoB516 (20%),
rpoB526 (24%) and rpoB531 (27%) while 78 and 51 per cent of isolates from Southeast Asian and Middle
Eastern patients, respectively, contained a mutated rpoB531. All isolates with rpoB N-terminal and
cluster II mutations were obtained from Middle Eastern and South Asian patients. Most isolates from
South Asian (84%) and Southeast Asian (70%) patients belonged to genetic group I while nearly all
remaining isolates belonged to genetic group II. Isolates from Middle Eastern patients were distributed
among genetic group I (46%), genetic group II (33%) and genetic group III (21%).
Interpretation & conclusions: The occurrence of specific rpoB mutations varied considerably in
rifampicin-resistant M. tuberculosis isolates obtained from patients of different ethnic groups within the
same country. The present data have important implications for designing region-specific rapid methods
for detecting majority of rifampicin-resistant strains.

Key words Ethnic differences - Mycobacterium tuberculosis - rifampicin resistance - rpoB mutations

The global burden of tuberculosis (TB) is being TB drugs1,2. Incomplete or improper treatment of TB
sustained by the expanding human immunodeficiency patients leads to selection of strains with resistance-
virus (HIV) infection and its association with active TB conferring mutations in genes encoding drug targets3.
disease and increasing resistance of Mycobacterium Sequential accumulation of mutations in target genes
tuberculosis to the most-effective (first-line) anti- generate multidrug-resistant (MDR, resistant at least to
756
 AHMAD et al: ETHNIC DIFFERENCES IN FREQUENCY OF rpoB MUTATIONS IN M. TUBERCULOSIS 757

rifampicin and isoniazid) M. tuberculosis (MDR-TB) reported that the occurrence of katG315 mutations
strains3,4. Rifampicin (RMP) is an important anti-TB in isoniazid-resistant isolates vary considerably
drug in the current therapy regimens. Monoresistance among patients of different ethnic groups at the same
to RMP is rare except in TB patients co-infected with geographical location19. However, similar studies have
HIV or with other underlying conditions3-6. Resistance not been carried out with RMP-resistant M. tuberculosis
of M. tuberculosis to RMP is also a surrogate marker isolates from patients of different ethnic background
for MDR-TB since about 90 per cent RMP-resistant within the same country.
strains are also resistant to isoniazid3,7. While proper
This study was undertaken to determine the
treatment of drug-susceptible TB has a cure rate >95
occurrence of specific rpoB mutations in rifampicin-
per cent, proper management of MDR-TB is difficult,
resistant M. tuberculosis isolates from TB patients of
particularly in resource-poor settings, due to delays
various ethnic groups in Kuwait.
in diagnosis and chemotherapy with less effective but
more expensive and toxic second-line drugs for an Material & Methods
extended period that makes adherence to therapy more Clinical M. tuberculosis isolates and drug susceptibility
difficult3. testing: A total of 7268 M. tuberculosis isolates from
Rapid drug susceptibility testing (DST) of M. TB patients were obtained during the study period
tuberculosis isolates ensures effective treatment of TB (1998 to 2008) at National Tuberculosis Reference
patients and limits further transmission of infection Laboratory in Kuwait. The isolation and identification
and emergence of additional drug resistance, MDR- of mycobacterial isolates was done by using the
TB and extensively drug-resistant (XDR)-TB3,4. The mycobacterial growth indicator tube (MGIT) 960 TB
DST on solid medium takes about 3 wk while broth- system (Becton Dickinson, Sparks, MD, USA) as
based radiometric, semi-automated BACTEC 460 TB described previously20. The identity of M. tuberculosis
and nonradioactive, fully-automated BACTEC MGIT was further confirmed by a multiplex PCR assay21.
960 TB systems report results within 4-12 days8. Other The phenotypic DST was performed for all the 7268
low cost rapid methods have also been developed for clinical M. tuberculosis isolates using BACTEC 460 TB
resource-poor settings but still require 10-14 days system by recording bacterial growth in the presence
to report the results8. Molecular methods have the of RMP (2 µg/ml), isoniazid (0.1 µg/ml), ethambutol
potential to report DST results within 1-2 days3. (2.5 µg/ml) or streptomycin (2 µg/ml) as described
previously20. A total of 226 M. tuberculosis isolates
The RMP binds to β-subunit of RNA polymerase were analyzed in this study. These included all RMP-
(encoded by rpoB) and inhibits RNA transcription and resistant M. tuberculosis isolates (n=119) that were
protein synthesis in M. tuberculosis3,7. Mutations within isolated during the study period. The RMP-resistant M.
81-bp hot-spot region of rpoB gene (mainly involving tuberculosis strains were recovered from TB patients
codons 516, 526 and 531) are primary mechanism of South Asian (n=55), Southeast Asian (n=23),
conferring RMP resistance in 90-95 per cent RMP- Middle Eastern (n=39) and other ethnic (n=2) origin.
resistant M. tuberculosis strains7,9. Resistance in 5-10 A total of 107 randomly selected drug-susceptible M.
per cent RMP-resistant isolates is due to mutations tuberculosis isolates were also included to ensure that
in N-terminal or other (such as cluster II) rpoB gene RMP resistance-conferring mutations in the rpoB gene
regions3,10. Frequency of specific mutations in hot- are not found in pansusceptible M. tuberculosis strains.
spot region codons 516, 526 and 531 was found to Most RMP-resistant isolates included in this study
vary among M. tuberculosis isolates collected from have been analyzed previously for rpoB mutations
different geographical locations3,11-13. However, it has by the line probe assays and/or DNA sequencing13,22,
not been ascertained whether these variations are due to however, the frequency of rpoB mutations in the
differences in the genetic background of M. tuberculosis context of ethnic origin of the TB patient and genetic
isolates or due to differences in ethnic origin of background of M. tuberculosis was not determined.
the infected TB patients or both. The frequency of The M. tuberculosis reference strain H37Rv was used
mutations at katG codon 315 (katG315) conferring as a control in DST, DNA sequencing of three rpoB
resistance to isoniazid and embB306 conferring gene regions and genetic group analysis of clinical M.
resistance to ethambutol have also been shown to vary tuberculosis isolates.
among M. tuberculosis isolates obtained from different DNA extraction for molecular assays: One ml of MGIT
geographical locations3,13-18. We have previously 960 culture of reference or clinical M. tuberculosis
758 INDIAN J MED RES, MAY 2012

isolate was heated with 40 mg Chelex-100 (Sigma- of three principal genetic groups (genetic group I, II
Aldrich, St. Louis, MO, USA) at 95oC for 20 min and and III) based on polymorphisms at katG463 (R463 or
then centrifuged at 12,000 x g for 15 min. For a PCR, 2 L463) and gyrA95 (S95 or T95)25. Thus, genetic group of
µl of supernatant was used as a source of DNA. each clinical M. tuberculosis isolate was determined by
detecting polymorphisms at katG463 and gyrA95. The
Sequencing of hot-spot, N-terminal and cluster
presence of R463/L463 at katG463 was detected by PCR
II regions of rpoB gene: The rpoB gene fragment
amplification of katG463 DNA region with KATG463F
containing codons 462 to 591 including hot-spot region
(5’-CCCGAGGAATTGGCCGACGAGTTC-3’) and
codons 507 to 533 from M. tuberculosis isolates was
KATG463R (5’-GGTGCGAATGACCTTGCGCAGATC-3’)
amplified by touchdown PCR with primers RPOHSF
primers followed by purification of 360 bp amplicons
(5’-GACGACATCGACCACTTCGGCAAC-3’) and
with QIAQuick PCR product purification kit and
RPOHSR (5’-GAACGGGTTGACCCGCGCGTACA-3’)
digestion with restriction enzyme Nci I, to generate RFLP
and reaction and thermal cycling conditions, as
patterns, as described previously26. The presence of S95/
described previously23,24. The 426 bp amplicons were
T95 at gyrA95 was also determined by PCR amplification
purified by using QIAQuick PCR product purification kit
of gyrA95 DNA region with primers GYRA95F (5’-
(QIAGEN, Hilden, Germany). Both strands of purified
CGCAGCTACATCGACTATGCGATG-3’) and
amplicons were sequenced by using DTCS CEQ2000
GYRA95R (5’-GGGCTTCGGTGTACCTCATCGCC-3’)
DNA sequencing kit (Beckman-Coulter, Fullerton, CA,
followed by purification of 322 bp amplicons with
USA) as described previously23 except that HSRFS (5’-
QIAQuick PCR product purification kit and restriction
AAACCAGATCCGGGTCGGCATGT or HSRRS (5’-
digestion with Ale I, to generate RFLP patterns, as
GCGTACACCGACAGCGAGCCGA-3’) was used as
described previously26. Based on these polymorphisms,
sequencing primer. For all RMP-resistant M. tuberculosis
the isolates were then assigned to one of the three
isolates with wild-type sequence of the hot-spot region of
genetic groups (L463 + T95, genetic group I; R463 +
rpoB gene and 10 selected pansusceptible M. tuberculosis
T95, genetic group II and R463 + S95, genetic group
isolates, N-terminal and cluster II regions were also
III).
sequenced. The N-terminal rpoB gene region was
amplified by touchdown PCR by using primers RPONF Fingerprinting of RMP-resistant M. tuberculosis
(5’-CGACGAGTGCAAAGACAAGGACA-3’) and isolates: Molecular fingerprinting of RMP-resistant M.
RPONR (5’-GACGGTGTCGCGCTTGTCGAC-3’) tuberculosis isolates carrying identical rpoB mutation
and reaction and thermal cycling conditions as was carried out by double-repetitive-element (DRE)-
described previously23,24. The PCR generated 310 PCR, and those yielding unique DNA banding patterns
bp amplicons were purified and both strands were were classified as genotypically distinct isolates13.
sequenced by using internal primers (RPONFS,
Statistical analysis: Differences in proportions were
5’-TTCGTCACCGCCGAGTTCATCAA-3’ or
compared using Fisher’s two-tailed Exact test. The
RPONRS, 5’-CTTGACGCTGTGCAGCGTCTTGT-
95% confidence interval (CI) was also calculated by
3’)23,24. The cluster II region of rpoB gene was
large-sample method. All statistical analyses were
also PCR amplified by using primers RPOIIF (5’-
performed by using WinPepi software ver. 3.8 (PEPI-
TCATGGACCAGAACAACCCGCTGT-3’) and
for Windows, www.brixtonhealth.com).
RPOIIR (5’-ACATCACTGTGATGCACGACAACG-3’)
with reaction and thermal cycling conditions as described Results
previously22,23. The 679 bp amplicons were purified Phenotypic DST is performed on all cultured M.
and sequenced with internal primers RPOIIFS (5’- tuberculosis isolates as part of routine patient care in
CGCGACGTGCACCCGTCGCACT-3’) and RPOIIRS Kuwait. Based on the results of phenotypic DST by
(5’-ACATCACTGTGATGCACGACAACG-3’) as BACTEC 460 TB system, 119 of 7268 M. tuberculosis
describe above for the hot-spot region of rpoB gene. isolates were resistant to RMP with or without additional
The nucleotide and deduced amino acid sequences resistance to other first-line drugs. A total of 107 M.
were compared with corresponding sequences from tuberculosis isolates susceptible to all first-line drugs
susceptible strain M. tuberculosis H37Rv using (pansusceptible strains) were also tested to ensure that
BLAST. resistance-conferring mutations in the rpoB gene are
Genetic group analysis of clinical M. tuberculosis not present in RMP-susceptible strains. All 226 clinical
isolates: Clinical M. tuberculosis isolates belong to one isolates were identified as M. tuberculosis based on
 AHMAD et al: ETHNIC DIFFERENCES IN FREQUENCY OF rpoB MUTATIONS IN M. TUBERCULOSIS 759

while the remaining 23 (19%) isolates were cultured

from specimens collected from extra-pulmonary
sites. Majority (76 of 119, 64%) of RMP-resistant
M. tuberculosis isolates were cultured from male
patients. All RMP-resistant  M. tuberculosis  isolates
were obtained from adult (range 18-65 yr) TB patients.
Only 10 were isolated from Kuwaiti nationals while
the remaining isolates were cultured from expatriate
workers or their family members. The date of arrival
in Kuwait or history of previous treatment with anti-
TB drugs was not available for expatriate patients.
Amplification and interpretable sequencing results
were obtained for all isolates. No mutation was detected
by DNA sequencing in any of the pansusceptible M.
tuberculosis isolate in the three (hot-spot, N-terminal
Fig. Representative agarose gel of multiplex PCR products from and cluster II) regions of rpoB gene (Table I). Most
six selected multidrug-resistant isolates (lanes 1-6) showing M.
(116 of 119, 97%) RMP-resistant M. tuberculosis
tuberculosis-specific amplification of 473 bp and 235 bp fragments
(marked by arrows) of oxyR and rpoB genes, respectively. Lane M
isolates contained at least one RMP resistance-
is 100 bp DNA ladder and the position of migration of 100 and 600 conferring mutation while three isolates contained
bp fragments are marked. wild-type sequences in all the three regions of the rpoB
gene (Table I).
specific amplification of two DNA fragments of 473 Three major ethnic groups were identified among
bp and 235 bp (Fig.)21. Only six of 119 RMP-resistant TB patients yielding RMP-resistant M. tuberculosis
M. tuberculosis isolates were resistant to RMP alone isolates and included patients of South Asian (n=55),
(monorifampicin-resistant) while the remaining 113 Southeast Asian (n=23) and Middle Eastern (n=39)
isolates were additionally resistant at least to isoniazid. origin (Table II). The country of origin of South Asian
Thirty-nine (33%) and 40 of 119 (34%) RMP-resistant patients included India (n=47), Bangladesh (n=6)
M. tuberculosis isolates were resistant to three and all and Nepal (n=2). Southeast Asian patients were from
four first-line drugs tested, respectively (Table I). Philippines (n=19) and Indonesia (n=4). The countries
of origin of Middle Eastern patients were Egypt (n=17),
Of the 119 RMP-resistant M. tuberculosis isolates,
Kuwait (n=10), Syria (n=4), Pakistan (n=4), Iran (n=2),
96 (81%) were recovered from pulmonary specimens
and Iraq (n=2). The remaining two patients were from
Ethiopia and Nigeria. Overall, 106 of 119 (89%) RMP-
Table I. Phenotypic susceptibility testing by BACTEC 460 resistant M. tuberculosis isolates contained mutation(s)
TB system and detection of rifampicin resistance-associated
mutations in rpoB gene by DNA sequencing among 226 M.
in hot-spot region of rpoB gene. Among these 106
tuberculosis isolates isolates, only five contained two mutations in the hot-
Resistance pattern of No. of No. (%) spot region (Table II). Of the remaining 13 isolates,
M. tuberculosis isolate isolates of isolates seven contained a mutation in the N-terminal region
tested* with rpoB (V176F) and three in the cluster II region (I572F) whilst
mutation(s) three other isolates contained wild-type sequences in all
None 107 0 (0) the three regions of the rpoB gene. Interestingly, all the
RMP 6 6 (100) three isolates with I572F mutation in cluster II region
RMP, INH 34 33 (97) and the three isolates with no mutation in rpoB gene
RMP, INH, EMB 27 27 (100) were cultured from patients of South Asian origin. The
RMP, INH, SM 12 11 (92) seven isolates with V176F mutation in the N-terminal
RMP, INH, EMB, SM 40 39 (98)
region were recovered from patients of Middle Eastern
origin only (Table II). Among isolates recovered from
RMP, rifampicin; INH, isoniazid; EMB, ethambutol; SM, South Asian patients, mutations at rpoB516 (11 of 55,
streptomycin; *A total of 226 M. tuberculosis isolates were
tested by both phenotypic and molecular susceptibility testing
20%), rpoB526 (13 of 55, 24%) and rpoB531 (15 of 55,
methods and the numbers shown are specific for a particular 27%) were nearly evenly distributed and several other
pattern only codons were mutated in the remaining isolates. On the
contrary, most of RMP-resistant isolates cultured from
760 INDIAN J MED RES, MAY 2012

Table II. Distribution of specific rpoB mutations in rifampicin-resistant M. tuberculosis isolates from TB patients belonging to the three
major ethnic groups in Kuwait
Ethnic group No. of No. of strains with mutation at rpoB hot-spot or N-terminal or cluster II region codon No rpoB
of TB patient M. tuberculosis Q513 Ins. 514 D516 S522 H526 S531 L533 2 codons V176 I572 mutation
isolates tested
South Asian 55 3 2 11* 0 13 15 1 4a 0 3 3
Southeast Asian 23 2 0 0 0 3 18 *
0 0 0 0 0
Middle Eastern 39 2 3 0 2 4 20* 0 1b 7* 0 0
Others 2 0 0 0 0 1 1 0 0 0 0 0
a
Two mutations were identified as M516E + S522L in one isolate, as D516G + H526Q in another isolate and as M515I + D516Y in
two strains; bThe two mutations were identified as M515I + D516Y; *The frequency of occurrence of these mutations was statistically
significant in the indicated ethnic groups compared with that in South Asians (P<0.05 and <0.001)

Southeast Asian (18 of 23, 78%) and Middle Eastern resistant M. tuberculosis isolates from South Asian (46,
(20 of 39, 51%) patients contained a mutation at 84%) and Southeast Asian (16, 70%) patients belonged
rpoB531 (Table II). Although no statistically significant to genetic group I while nearly all remaining isolates
difference was noted among isolates containing a from patients of these two ethnic groups belonged to
mutation at rpoB526 isolated from patients of the three genetic group II (Table III). However, the isolates from
ethnic groups, mutations at rpoB516 were detected Middle Eastern patients were nearly equally distributed
only among isolates from patients of South Asian origin among genetic group I (46%) and genetic group II
(Table II). Further, frequency of mutations at rpoB531 (33%). The frequency of genetic group I isolates among
was also different among isolates cultured from South patients of Middle Eastern origin was significantly
Asian patients compared to patients of Southeast Asian (P<0.001) different compared to patients of South Asian
(P<0.001) and Middle Eastern (P<0.05) origin. The origin. Nearly all (8 of 9) genetic group III isolates were
second most common mutation among the isolates recovered from Middle Eastern patients compared to
from Middle Eastern patients was in the N-terminal only 1 of 55 (P<0.01) and none (P<0.05) from patients
region which was not detected among patients of of South Asian and Southeast Asian origin (Table III).
South Asian and Southeast Asian origin (P<0.001) The frequency of mutations at rpoB516, rpoB526 and
(Table II). The DRE-PCR data showed that majority of rpoB531 varied considerably among M. tuberculosis
RMP-resistant M. tuberculosis isolates obtained from isolates belonging to different genetic groups. Nearly
different patients but carrying identical rpoB mutation all (18 of 21, 90%) isolates with a mutation at rpoB526
were genotypically distinct (data not shown). belonged to genetic group I. Eight of 11 (73%) isolates
with a mutation at rpoB516 belonged to genetic group
The genetic group analysis based on polymorphisms
I while the remaining three belonged to genetic group
at katG463 and gyrA95 showed that majority of RMP-
II. On the contrary, only 33 of 54 (61%) isolates with a
Table III. Distribution of rifampicin-resistant M. tuberculosis mutation at rpoB531 belonged to genetic group I while
isolates belonging to principal genetic group (GP) I, GP II and the remaining belonged to genetic groups II or III.
GP III among TB patients from the three major ethnic groups in
Kuwait Discussion
Ethnic group No. of M. No. (%) of isolates belonging This study was focused to determine the frequency
of TB patient tuberculosis toa
isolates tested GP I
of specific rpoB mutations in RMP-resistant M.
GP II GP III
tuberculosis isolates from TB patients of various
South Asian 55 46 (84) 8 (15) 1 (2)
ethnic groups in Kuwait, a low TB incidence country
Southeast Asian 23 16 (70) 7 (30) 0 (0)
Middle Eastern 39 18* (46) 13* (33) 8* (21)
in the Arabian Gulf region of the Middle East20. Three
Others 2 1 (50) 1 (50) 0
major ethnic groups (Middle Eastern, South Asian and
Southeast Asian) are represented among TB patients in
a
Genetic group (GP) I, KatG L463 + GyrA T95; genetic group
Kuwait. The data were also correlated with the genetic
(GP) II, KatG R463 + GyrA T95; genetic group (GP) III, KatG
R463 + GyrA S95; *The frequency of occurrence of these genetic
group of M. tuberculosis strains that are circulating
groups was statistically significant in the indicated ethnic group among different populations. Consistent with low
(P<0.001, P=0.003 for GP I, GP II and GP III respectively), incidence of TB and RMP-resistant TB in Kuwait,
compared to South Asian patients only 4 per cent RMP-resistant M. tuberculosis isolates
 AHMAD et al: ETHNIC DIFFERENCES IN FREQUENCY OF rpoB MUTATIONS IN M. TUBERCULOSIS 761

contained mutations in two codons of rpoB gene. Since country/geographical setting have yielded variable
nearly all drug-resistant strains in low TB incidence frequency of specific rpoB mutations11,13,24,27,28. Since
countries contain single point mutations while >10 per majority of active disease cases in low TB incidence
cent drug-resistant strains in high TB incidence countries countries occur as a result of reactivation of previously
contain multiple mutations in target genes24,26-28, the acquired infection30, the present data suggest that the
data suggest limited previous exposure of TB patients evolution of a mutation at rpoB516, rpoB526 and
to anti-TB drugs. Based on fingerprinting studies, rpoB531 is also influenced by genetic background of
majority of RMP-resistant isolates from different TB M. tuberculosis. Taken together these observations
patients were genotypically distinct. The data rule suggest that the selection of specific rpoB mutation
out active transmission of infection in majority of TB during evolution of RMP resistance in M. tuberculosis
patients infected with RMP-resistant M. tuberculosis is influenced by both, the genetic background of the
strain in Kuwait. This is contrary to high TB incidence infecting M. tuberculosis strain and by the ethnic
countries where recent acquisition of infection with origin of the TB patient.
drug-resistant strains is more common2,3.
The major drawback of the present study was lack
Although only 8 per cent RMP-resistant isolates of information about the date of arrival of expatriate
contained a mutation in N-terminal or cluster II region subjects in Kuwait, their travel history, and history of
(outside the hot-spot region) of rpoB gene, their previous exposure to anti-TB drugs. Another limitation
distribution in the three ethnic groups was interesting. was the small number of TB patients representing
Our data suggest the inclusion of probes that interrogate various nationalities and ethnic groups that were
the N-terminal codon V176 for molecular detection studied which may not be representative of the entire
of RMP resistance among M. tuberculosis isolates ethnic group.
collected from Middle Eastern patients and cluster II
In conclusion, our findings showed that the
region probes for isolates from South Asian patients
occurrence of specific rpoB mutations varied
for greater sensitivity.
considerably in RMP-resistant M. tuberculosis isolates
Previous studies carried out on RMP-resistant obtained from patients of different ethnic groups within
M. tuberculosis isolates from TB patients at various the same country. The data have important implications
geographic locations have shown that the frequency for designing region-specific and ethnic group-specific
of specific rpoB mutations vary considerably9,11,13,29. rapid methods for detecting majority of RMP-resistant
Initially, these variations were attributed to the strains.
geographical differences in RMP-resistant M.
Acknowledgment
tuberculosis strains circulating in different settings
and their clonal propagation11-13,29. For instance, the Authors acknowledge the financial support from Research
Administration grant YM 03/06 and College of Graduate Studies,
high (90%) frequency of rpoB531 mutation in MDR-
Kuwait University.
TB strains from Samara region in Russian Federation
was attributed to the high frequency of Beijing References
genotype strains in that setting29. Similarly, molecular 1. World Health Organization. Global tuberculosis control:
epidemiological studies carried out on isoniazid- epidemiology, strategy and financing. WHO report 2009.
resistant M. tuberculosis have also shown that the WHO/HTM/TB/2009.411. Geneva, Switzerland: WHO;
2009.
frequency of katG315 mutations varies from 50 to
95 per cent at different geographical locations14-16,19. 2. Wright A, Zignol M, Van Deun A, Falzon D, Gerdes
SR, Feldman K, et al. for the Global Project on Anti-
The high (90-95%) frequency of katG315 mutations Tuberculosis Drug Resistance Surveillance. Epidemiology of
among M. tuberculosis strains in Russia was also antituberculosis drug resistance 2002-07: an updated analysis
attributed to the high frequency of Beijing genotype of the Global Project on Anti-Tuberculosis Drug Resistance
strains14,16,19. However, the frequency of rpoB531 Surveillance. Lancet 2009; 373 : 1861-73.
and katG315 mutations in RMP-resistant and INH- 3. Ahmad S, Mokaddas E. Recent advances in the diagnosis
resistant strains, respectively, are much lower in M. and treatment of multidrug-resistant tuberculosis. Respir Med
2009; 103 : 1777-90.
tuberculosis strains isolated in China and Taiwan,
4. World Health Organization. Multidrug and extensively drug-
even though the frequency of Beijing genotype strains resistant TB (M/XDR-TB): 2010 global report on surveillance
in these settings are also high9,27,28. Multiple studies and response. WHO/HTM/TB/2010.3, Geneva, Switzerland:
carried out at different time periods in the same WHO; 2010.
 762 INDIAN J MED RES, MAY 2012

5. Sandman L, Schluger NW, Davidow AL, Bonk S. Risk factors resistant Mycobacterium tuberculosis isolates from the Middle
for rifampin-monoresistant tuberculosis: a case-control study. East. Int J Antimicrob Agents 2004; 23 : 473-9.
Am J Respir Crit Care Med 1999; 159 : 468-72.
18. Ahmad S, Itani LY, Fares E, Araj GF. Varying prevalence of
6. Mokaddas E, Ahmad S, Abal AT, Al-Shami AS. Molecular embB codon 306 mutations in ethambutol-resistant clinical
fingerprinting reveals familial transmission of rifampin- Mycobacterium tuberculosis isolates from Beirut and Dubai.
resistant tuberculosis in Kuwait. Ann Saudi Med 2005; 25 : J Chemother 2008; 20 : 285-7.
150-3.
19. Abal AT, Ahmad S, Mokaddas E. Variations in the occurrence
7. Telenti A, Imboden P, Marchesi F, Lowrie D, Cole S, Colston of the S315T mutation within the katG gene in isoniazid-
MJ, et al. Detection of rifampicin-resistance mutations in resistant clinical Mycobacterium tuberculosis isolates from
Mycobacterium tuberculosis. Lancet 1993; 341 : 647-50. Kuwait. Microb Drug Resist 2002; 8 : 99-105.
8. Palomino JC, Martin A, Von Groll A, Portaels F. Rapid culture- 20. Mokaddas E, Ahmad S, Samir I. Secular trends in susceptibility
based methods for drug-resistance detection in Mycobacterium patterns of Mycobacterium tuberculosis isolates in Kuwait,
tuberculosis. J Microbiol Methods 2008; 75 : 161-6. 1996-2005. Int J Tuberc Lung Dis 2008; 12 : 319-25.
9. Jou R, Chen HY, Chiang CY, Yu MC, Su IJ. Genetic diversity 21. Mokaddas E, Ahmad S. Development and evaluation of a
of multidrug-resistant Mycobacterium tuberculosis isolates multiplex PCR for rapid detection and differentiation of
and identification of 11 novel rpoB alleles in Taiwan. J Clin Mycobacterium tuberculosis complex members from non-
Microbiol 2005; 43 : 1390-4. tuberculous mycobacteria. Jpn J Infect Dis 2007; 60 : 140-4.
10. Heep M, Brandstatter B, Rieger U, Lehn N, Richter E, 22. Al-Mutairi NM, Ahmad S, Mokaddas E. Performance
Rüsch-Gerdes S, et al. Frequency of rpoB mutations inside comparison of four methods for rapid detecting of multidrug-
and outside the cluster I region in rifampin-resistant clinical resistant Mycobacterium tuberculosis strains. Int J Tuberc
Mycobacterium tuberculosis isolates. J Clin Microbiol 2001; Lung Dis 2011; 15 : 110-5.
39 : 107-10.
23. Ahmad S, Mokaddas E, Jaber, AA. Rapid detection of
11. Hirano K, Abe C, Takahashi M. Mutations in the rpoB gene ethambutol-resistant Mycobacterium tuberculosis strains by
of rifampin-resistant Mycobacterium tuberculosis strains PCR-RFLP targeting embB codons 306 and 497 and iniA codon
isolated mostly in Asian countries and their rapid detection by 501 mutations. Mol Cell Probes 2004; 18 : 299-306.
line probe assay. J Clin Microbiol 1999; 37 : 2663-6.
24. Ahmad S Mokaddas E. The occurrence of rare rpoB mutations in
12. Sintchenko V, Chew WK, Jelfs PJ, Gilbert GL. Mutations in rifampicin-resistant clinical Mycobacterium tuberculosis isolates
rpoB gene and rifabutin susceptibility of multidrug-resistant from Kuwait. Int J Antimicrob Agents 2005; 26 : 205-12.
Mycobacterium tuberculosis strains isolated in Australia.
Pathology 1999; 31 : 257-60. 25. Sreevatsan S, Pan X, Stockbauer KE, Connell ND,
Kreiswirth BN, Whittam TS, et al. Restricted structural gene
13. Ahmad S, Mokaddas E, Fares E. Characterization of rpoB polymorphism in the Mycobacterium tuberculosis complex
mutations in rifampin-resistant clinical Mycobacterium indicates evolutionarily recent global dissemination. Proc
tuberculosis isolates from Kuwait and Dubai. Diagn Microbiol Natl Acad Sci USA 1997; 94 : 9869-74.
Infect Dis 2002; 44 : 245-52.
26. Ahmad S, Jaber AA, Mokaddas E. Frequency of embB codon
14. Marttila HJ, Soini H, Eerola E, Vyshnevskaya E, Vyshnevskiy
306 mutations in ethambutol-susceptible and -resistant clinical
BI, Otten TF, et al. A Ser315Thr substitution in KatG is Mycobacterium tuberculosis isolates in Kuwait. Tuberculosis
predominant in genetically heterogeneous multidrug-resistant (Edinb) 2007; 87 : 123-9.
Mycobacterium tuberculosis isolates originating from the
St. Petersburg area in Russia. Antimicrob Agents Chemother 27. Hwang HY, Chang CY, Chang LL, Chang SF, Chang YH, Chen
1998; 42 : 2443-5. YJ. Characterization of rifampin-resistant Mycobacterium
tuberculosis in Taiwan. J Med Microbiol 2003; 52 : 239-45.
15. Ahmad S, Fares E, Araj GF, Chugh TD, Mustafa AS. Prevalence
of S315T mutation within the katG gene in isoniazid-resistant 28. Huang H, Jin Q, Chen X, Zhuang Y. Characterization of rpoB
clinical Mycobacterium tuberculosis isolates from Dubai and mutations in rifampin-resistant Mycobacterium tuberculosis
Beirut. Int J Tuberc Lung Dis 2002; 6 : 920-6. isolates in China. Tuberculosis (Edinb) 2002; 82 : 79-83.
16. Mokrousov I, Narvskaya O, Otten T, Limeschenko E, Steklova 29. Nikolayevsky V, Brown T, Balabanova Y, Ruddy M,
L, Vyshnevskiy B. High prevalence of KatG Ser315Thr Fedorin I, Drobniewski F. Detection of mutations associated
substitution among isoniazid-resistant Mycobacterium with isoniazid and rifampin resistance in Mycobacterium
tuberculosis clinical isolates from northwestern Russia, 1996- tuberculosis isolates from Samara region, Russian Federation.
2001. Antimicrob Agents Chemother 2002; 46 : 1417-24. J Clin Microbiol 2004; 42 : 4498-502.
17. Ahmad S, Mokaddas E. Contribution of AGC to ACC and 30. Ahmad S. New approaches in the diagnosis and treatment of
other mutations at codon 315 of the katG gene in isoniazid- latent tuberculosis infection. Respir Res 2010; 11 : 169.

Reprint requests: Prof. Suhail Ahmad, Department of Microbiology, Faculty of Medicine, Kuwait University,
P.O. Box 24923, Safat, 13110, Kuwait
e-mail: [email protected], [email protected]

View publication stats