MICROBIAL DRUG RESISTANCE

Volume 26, Number 6, 2020

Mary Ann Liebert, Inc.
DOI: 10.1089/mdr.2019.0406

Antimicrobial Resistance and Molecular Characterization

of Gene Cassettes from Class 1 Integrons
in Pseudomonas aeruginosa Strains

Mi Liu, Jie Ma, Wei Jia, and Wanxiang Li

We investigated the antibiotic-resistance phenotypes and molecularly characterized class 1 integron gene cassettes
from 113 Pseudomonas aeruginosa isolates from patients. Primers specific for the class 1 integron integrase (intI1)
gene were used to screen for these integrons using polymerase chain reactions (PCRs). The variable regions of the
integrons were PCR-amplified and sequenced. Sputum was the most common specimen (69.9%; 79/113) followed
by aseptic sites (21.2%; 24/113). Of the 113 isolates with phenotypic resistance to the tested antimicrobials, the
highest resistances were to ciprofloxacin (CIP) (26.55%), imipenem (IPM) (23.89%), and meropenem (MEM)
(23%). Carbapenem-sensitive P. aeruginosa (CS-PA) isolates displayed 23 patterns, and the predominant multidrug
resistance phenotype was CIP-levofloxacin (7.23%, 6/83). Carbapenem-resistant P. aeruginosa (CR-PA) isolates
displayed 12 patterns, and the predominant multidrug resistance phenotype was IPM-MEM (23.33%, 7/30). Class 1
integrons were detected in 14 (12.4%, 14/113) isolates, 7.22% (6/83) in CS-PA isolates, and 26.67% (8/30) in CR-
PA isolates. Six gene cassette arrays were detected, the most prevalent being aacA4-blaOXA101-aadA5 in five
isolates (4.4%, 5/113). Seventeen gene cassettes were detected. The most prevalent antibiotic-resistance gene
cassettes were aacA4 (6.2%, 7/113), blaOXA-1, and blaOXA-101. Extended-spectrum b-lactamase resistance genes
were detected. Some of the genes carried were similar to those in other species, but some had shared characteristics
among the P. aeruginosa isolates. Long-standing drug resistance genes appeared to be under elimination in
P. aeruginosa, whereas integrons conferring resistance to commonly used clinical drugs such as b-lactamases,
fluoroquinolones, and even carbapenems, as well as some other gene elements, were found to be newly integrated.

Keywords: molecular characterization, antibiotics resistance, class 1 integrons, Pseudomonas aeruginosa

Introduction Currently, more than 130 different gene cassettes have

been found in class 1 integrons, most of which are the

W idespread and long-term use of antibiotics may be

responsible for the emergence of antibiotic-resistant
strains in several bacterial species.1–5 Recent surveillance
antibiotic-resistance gene cassettes encoding proteins with
resistance to all main antibiotic classes.12,13 These include
the quaternary ammonium-compound family, erythromycin,
studies have shown that such strains are markedly resistant aminoglycosides, sulfonamides, quinolones, chlorampheni-
to the main antibiotic types and have transformed into the col, fosfomycin, trimethoprim, b-lactamases, and other
multidrug-resistant (MDR) strains that are nonsusceptible to clinically relevant antibiotics.8,10,14
‡3 antimicrobial categories.6,7 Pseudomonas aeruginosa, an important Pseudomonas ge-
Mobile genetic elements such as plasmids, transposons, nus member, is noted for its ability to cause severe hospital-
and integrons play an important role in increasing antibiotic acquired bloodstream infections, pneumonia, surgical-site
resistance.6,8,9 Class 1 integrons can capture exogenous gene infections, and urinary tract infections in intensive care
cassettes, thereby ensuring the expression of the genes units8,15,16 with high morbidity and mortality.17–19 Studies
within these cassettes; hence, they play important roles in have shown that the mortality rate for mechanical ventila-
the horizontal dissemination of antibiotic resistance genes tion complicated by P. aeruginosa pneumonia is *40%.
among bacteria.1–5,10,11 This pathogen is also the main cause of respiratory tract

Department of Clinical Laboratory, Weifang People’s Hospital, Weifang, Shandong, China.

ª Mi Liu et al., 2020; Published by Mary Ann Liebert, Inc. This Open Access article is distributed under the terms of the Creative
Commons Attribution Noncommercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits any noncommercial use,
distribution, and reproduction in any medium, provided the original author(s) and the source are cited.

670
CLASS 1 INTEGRONS IN PSEUDOMONAS AERUGINOSA 671

infections in patients with cystic fibrosis, as well as a Antimicrobial susceptibility testing

common cause of disease aggravation in patients with ad- Several antibiotics were selected as representative drugs.
vanced chronic obstructive pulmonary disease. Antimicrobial susceptibility testing on these antibiotics was
Therefore, P. aeruginosa attracts attention from medical done using the disk diffusion method according to the
staff.8 Previously, it was thought that carbapenem antibiotics Clinical and Laboratory Standards Institute (CLSI) guide-
were the last line of defense against multiple drug-resistant, lines.20 The antibiotics chosen were amikacin (AK), cefta-
gram-negative bacterial infections. However, with the inap- zidime, ciprofloxacin (CIP), levofloxacin (LEV), cefepime,
propriate and overuse of antibiotics, there has been a selection gentamicin, tobramycin (TOB), imipenem (IPM), aztreonam
pressure for antibiotic-resistant strains to evolve. P. aeruginosa (ATM), cefoperazone/sulbactam (CSL), piperacillin (PRL),
has a multiple drug resistance phenotype, and even harbors piperacillin/tazobactam (TZP), and meropenem (MEM).
carbapenem resistance.8 Many studies have investigated the Isolates shown to be resistant to IPM or MEM were defined
prevalence of integrons in P. aeruginosa, but its drug resistance as ‘‘CR-PA,’’ and those resistant to three or more drugs
spectrum is rarely reported. Therefore, comparison of the in- class were defined as ‘‘MDR-PA.’’ P. aeruginosa ATCC
tegrons carried by carbapenem-resistant P. aeruginosa (CR- 27853 was used as the control for antibiotic resistance.
PA) strains with carbapenem-sensitive P. aeruginosa (CS-PA)
strains and characterizing and comparing the gene cassettes
from this bacterium are a worthwhile exercise.17 Polymerase chain reaction assay for screening class
Therefore, we investigated drug resistance in P. aeruginosa 1 integrons
isolated from the clinic, the carriage of class I integrons
among CR-PA strains and CS-PA strains, and the character- All strains were streaked onto Luria Bertani (Oxoid, UK)
istics of the variable regions of class I integrons from this agar plates and incubated overnight at 37C. A single clone
bacterium. from each strain was picked and suspended in 50 mL of
distilled water. After incubation (100C water bath, 10
minutes) and centrifugation (13,750g, 2 minutes), the su-
Materials and Methods pernatant was used as the polymerase chain reaction (PCR)
template for screening of class 1 integrons. Primers intF and
Bacterial strains P2R (Table 1), which target the class 1 integron integrase
Altogether, 113 P. aeruginosa strains were isolated from (intI1), were used. A blank control (distilled water), a neg-
patients hospitalized in Weifang People’s Hospital (Weifang, ative control (E. coli DH5a), and a positive control (P.
China). These isolates were collected from September to mirabilis 47437) were included in each run.
October 2018. We have received and archived written patient
consent from all patients included in this study, and the ap-
Identifying the variable regions of class 1 integrons
proval by the hospital ethics committee for the use of samples
for human patients. Patients needed to have been hospitalized Because boiling method is a rough extraction method,
>3 days to qualify for specimen collection. There were ob- which nucleic acid concentration may decrease over time,
vious symptoms of infection in each system. Symptoms of this method can be used in the preliminary screening of in-
tissue infection were redness, necrosis, or exudation. Symp- tegron. To ensure the reproducibility and stability of the ex-
toms of respiratory tract infection were fever, cough, and perimental results, the reagent extraction method should be
imaging findings. Examples of systemic symptoms were used in further experiments. Therefore, we adopt the method
shivering, fever, as well as increases in levels of leukocytes, of extracting DNA by kit to screen the variable region of
erythrocyte sedimentation rate, and C-reactive protein. integron. Total genomic DNA was isolated from the class 1
All specimens were collected and transported in aseptic integron-positive strains using the EZ-10 Spin Column Bac-
containers. For respiratory specimens, the patient had to terial Genomic DNA Miniprep Kit (Bio Basic, Canada) ac-
gargle before coughing-up sputum. After each sputum cording to the supplier’s instructions. Table 1 shows the
sample had been sent to the laboratory, the number of white primers used in this study. Primers 5CS and 3CS were used to
cells was >25 per low magnification, and the number of amplify the variable regions of the class 1 integrons.
squamous cells was <10 per low magnification, and all were For the PCRs, LA Taq DNA polymerase (TaKaRa Bio-
identified by Vitek-2 Compact (BioMérieux, Marcy- technology, Japan) was used according to the manufacturer’s
l’Étoile, France). Escherichia coli DH5a was from our instructions. After electrophoresis on a 1% agarose gel, the PCR
laboratory. Proteus mirabilis 47437 was gifted by the products were excised and purified according to the manufac-
Clinical Laboratory of Zhejiang Province People’s Hospital turer’s instructions of the EZ-10 Spin Column Gel Extraction Kit
(Zhejiang, China). (Bio Basic). All amplicons were sequenced by primer walking,

Table 1. PCR Primers Used in This Study

Gene Description Sequence (5¢/3¢) Reference
5
intF Screening primer for class 1 integrons CCAAGCTCTCGGGTAACATC
5
P2R Screening primer for class 1 integrons GCCCAGCTTCTGTATGGAAC
5
5CS Screening primer for the variable region of class 1 integrons GGCATCCAAGCAGCAAG
5
3CS Screening primer for the variable region of class 1 integrons AAGCAGACTTGACCTGA
672 LIU ET AL.

starting with 3CS and 5CS. Nucleotide sequences were analyzed Resistance patterns
and compared using BLAST software. The strains were divided into two groups based on their
carbapenem resistance levels (CR-PA, 30 strains; CS-PA, 83
Statistical analysis strains) and the definition rules. The total number of
The data were analyzed using SSPS v17.0 (IBM, Armonk, multidrug-resistant P. aeruginosa (MDR-PA) isolates in the
NY). Comparisons were considered significant if p < 0.05. CS-PA group was 16.87% (14/83), whereas that of CR-PA
was 40% (12/30) (Table 3). The CS-PA isolates displayed
Results 23 patterns, the predominant multidrug resistance pattern of
which was CIP-LEV (7.23%, 6/83) followed by CIP–LEV-
Clinical samples and bacterial isolation IPM-MEM (3.61%, 3/83). ATM and CIP-LEV-IPM patterns
Altogether, 113 P. aeruginosa isolates were collected from were displayed by two strains. Only one strain exhibited
hospitalized patients. Most specimens were sputum (69.9%; another resistance pattern. Twelve patterns were seen for the
79/113), followed by aseptic site specimens (21.2%; 24/113), CR-PA isolates, and the predominant multidrug resistance
blood (5.3%; 6/113), and urine (3.5%; 4/113). CR-PA and pattern was IPM-MEM (23.33%, 7/30), followed by AK-
CS-PA were 30 and 83, respectively. ATM-CAZ-CIP-CSL-FEP-IPM-LEV-MEN-PRL-TOB-TZP
(10%, 3/30). Sixty P. aeruginosa isolates displayed sensi-
Resistance phenotypes tivity to all 13 antimicrobial agents.
Table 2 shows the antimicrobial resistance phenotypes of
Prevalence of class 1 integrons and amplification
the isolates toward 13 antimicrobial agents. Antimicrobial
products from the variable regions
susceptibility testing revealed that of the 113 isolates ex-
pressing phenotypic resistance to the tested antimicrobials, Class 1 integrons were detected in 14 (12.4%, 14/113)
the most common resistance was to CIP (26.55%) followed isolates (Table 3), 7.22% (6/83) in the CS-PA isolates and
by IPM (23.89%) and MEM (23%); all other antimicrobials 26.67% (8/30) in the CR-PA isolates. The variable regions
had values of <20% (Table 2). P. aeruginosa multidrug- of the class 1 integrons were amplified and analyzed suc-
resistant isolates (resistant to at least three antimicrobial cessfully for 10 intI1-positive isolates, but these regions
classes) were recovered from the two sets of isolates inves- failed to amplify in four intI1-positive isolates. In the re-
tigated in our study. Isolates with resistance to all the anti- maining 10 intI1-positive isolates, only partial variable re-
microbials tested occurred only in the CR-PA isolates. The gion sequences were amplified and sequenced.
highest prevalence of resistance in the CR-PA isolates was to Six gene cassette arrays were detected (Table 3), the most
IPM (93.33%) followed by MEM (86.67%), LEV (56.67%), prevalent of which were aacA4-blaOXA101-aadA5 (detected
and CIP (53.33%); all other antimicrobials had values of in five strains), whereas qnrvc-gcu165-arr2-dfrA22e, aacA4-
<40%. In the CS-PA isolates, the most common resistance gcu35-blaOXA-1-catB3, aadB-aac(6¢)-1I-pse-1, dhfr2-aacA4-
was to LEV (16.87%), followed by CIP (15.66%); all other aadA1-tna, and AadA22 were detected in 2, 2, 1, 1, and 1
antimicrobials had values of <20%. Comparison of drug re- isolates, respectively. aacA4-blaOXA101-aadA5, aacA4-
sistance in the CS-PA and CR-PA groups revealed that, with gcu35-blaOXA-1-catB3, and qnrvc-gcu165-arr2-dfrA22e gene
the exception of GEN and ATM, the other 11 antimicrobial cassette arrays were detected in CR-PA at 5/30, 2/30, and 2/30,
agents differed, and the differences were significant. respectively, whereas aadB-aac(6¢)-1I-pse-1, dhfr2-aacA4-
aadA1-tna, and AadA22 were detected in CS-PA in 1, 1, and 1
Table 2. Resistance Phenotypes and Comparison isolates, respectively. Strain numbers 39 and 70 both contained
of Carbapenem-Resistant Pseudomonas aeruginosa two gene cassette arrays (qnrvc-gcu165-arr2-dfrA22e and
with Carbapenem-Sensitive P. aeruginosa aacA4-gcu35-blaOXA-1-catB3).
CR-PA CS-PA Total (%) p Seventeen gene cassettes were detected, including
blaOXA-1/101, pse-1, aacA4, aac6-II, aadA1/A5//B,
AK 23.33 0 7.07 0.000 AadA22, arr2, catB3, dfrA22e, dhfr2, tna, qnrvc, and gcu35/
ATM 26.67 14.46 17.70 0.222 165 (Table 3). The most prevalent antibiotic resistance gene
CAZ 36.67 3.61 12.39 0.000 cassettes were aacA4 (7/113), which confers resistance to
CIP 53.33 15.66 26.55 0.000 aminoglycosides, aadA5 (5/113), which confers resistance
CSL 36.67 6.02 15.04 0.000 to streptomycin and spectinomycin, and blaOXA-101 (5/
FEP 36.67 0 9.73 0.000 113), which confers resistance to b-lactamases. The struc-
GEN 16.67 6.02 9.73. 0.079 tural characteristics and translation directions of the variable
IPM 93.33 0 23.89 —
LEV 56.67 16.87 27.4 0.000 region gene cassettes are shown in Fig. 1.
MEM 86.67 0 23.0 —
PIP 36.67 13.25 19.46 0.006 Comparison between integron-positive
TOB 30.00 4.81 12.39 0.001 and integron-negative isolates
TZP 30.00 6.02 12.39 0.001
Of the 14 integron-positive isolates, >70% were resistant
AK, amikacin; ATM, aztreonam; CAZ, ceftazidime; CIP, cipro- to CIP, LEV, and TOB, and >50% were resistant to the other
floxacin; CR-PA, carbapenem-resistant P. aeruginosa; CSL, cefoper- drugs. In the integron-negative isolates, only resistance to
azone/sulbactam; CS-PA, carbapenem-sensitive P. aeruginosa; FEP,
cefepime; GEN, gentamicin; IPM, imipenem; LEV, levofloxacin; IPM and MEM was close to 20%, whereas resistance to the
MEM, meropenem; PRL, piperacillin; TOB, tobramycin; TZP, other drugs was <20% or close to 0. Comparison of the drug
piperacillin/tazobactam. sensitivity of the two groups revealed that the drug
 Table 3. Antimicrobial Resistance Phenotypes and Molecular Characterization
of Gene Cassettes in Class 1 Integrons
GenBank
Sample no. Resistance pattern Int Length Gene cassettes accession no.
1, 2, 4, 8, 9, 15, 17, 20, 22, 26, Sensitive to all drugs - - -
27, 29, 30, 31, 34, 38, 38, 44,
45, 47, 49, 50, 52, 53, 55, 56,
57, 60, 62, 63, 64, 65, 66, 67,
68, 69, 73, 74, 75, 76, 77, 78,
79, 80, 82, 84, 89, 93, 95, 96,
98, 102, 106, 107, 109, 110,
112, 114, 115, 116
CS-PA
3, 83 ATM - - -
117 PRL - - -
25, 51, 92, 94, 99, 105 CIP, LEV - - -
85 ATM, PRL - - -
13 LEV, PRL - - -
41 ATM, CIP, LEV - - -
100 ATM, CIP, LEV + - -
43 CAZ, PRL, TZP - - -
5, 88 CIP, LEV, IPM - - -
61 CIP, LEV, PRL - - -
104 CIP, LEV, GEN + - -
35 ATM, CSL, PRL + 1.1k AadA22 CP041394.1
99.48%
23 GEN, PRL, TOB, TZP + 2.1k aadB-aac(6¢)- DQ266447.1
1I-pse-1 97.6
32 ATM, CSL, PRL, TZP - - -
6, 11, 19 CIP, LEV, IPM, MEM - -
48 ATM, CIP, LEV, MEM - - -
16 CSL, LEV, IPM, MEM - - -
87 ATM, CIP, GEN, LEV, TOB - - -
108 ATM, CAZ, CSL, PRL, TOB - - -
18 CAZ, CIP, FEP, GEN, LEV, TOB + - -
111 AK, ATM, CIP, CSL, GEN, TOB + 3.2k dhfr2-aacA4-
aadA1-tna
97 ATM, CIP, CSL, GEN, LEV, PRL, - -
TOB
42 ATM, CAZ, CIP, CSL, GEN, LEV, - - -
PRL, TOB, TZP
CR-PA
21 IPM, MEM, LEV - - -
14 IPM, MEM, PRL - - -
7, 10, 12, 40, 59, 81, 113 IPM, MEM - - -
72 CAZ, IPM, MEM, PRL - - -
103 CIP, FEP, LEV, IPM, MEM - - -
28 ATM, CAZ, CSL, FEP, IPM, MEM, - - -
PRL
33 ATM, CAZ, CSL, IPM, MEM, PRL, - - -
TZP
54 CIP, CSL, FEP, GEN, IPM, LEV, + - -
MEN, PRL, TOB, TZP
71 AK, ATM, CAZ, CIP, CSL, FEP, + 2.1k aacA4-blaOXA101-
IPM, MEN, PRL, TOB, TZP aadA5
36, 46, 101 AK, ATM, CAZ, CIP, CSL, FEP, + 2.1k aacA4-blaOXA101-
IPM, LEV, MEN, PRL, TOB, TZP aadA5
39, 70 AK, CAZ, CIP, CSL, FEP, GEN, + 2.2k+2.8k qnrvc-gcu165- KU984332
IPM, LEV, MEN, PRL, TOB, TZP arr2-dfrA22e KU984333
aacA4-gcu35-
blaOXA-1-catB3
24 AK, ATM, CAZ, CIP, CSL, FEP, + 2.1k aacA4-blaOXA101- KM111259.1
GEN, IPM, LEV, MEN, PRL, aadA5 99.35%
TOB, TZP
+, presence of the PCR product; -, absence of the PCR product.
ATM, aztreonam (30 mg); IPM, imipenem (10 mg).

673
674 LIU ET AL.

FIG. 1. Genetic environment of class 1

integron variable regions. (A) Isolate 35.
(B) Isolate 23. (C) Isolates 24, 36, 46, 71,
and 101. (D1, D2) Isolates 39 and 70.
(E) Isolate 111.

resistance rates for the 13 antimicrobial agents in the Altogether, 113 P. aeruginosa isolates were collected,
integron-positive isolates were higher than those of the primarily from sputum (69.9%; 79/113), aseptic site speci-
integron-negative isolates, and the difference was significant mens (21.2%; 24/113), blood (5.3%; 6/113), and urine
(Table 4). (3.5%; 4/113).
The isolates from our study were CR-PA and CS-PA
types, comprising 30 and 83, respectively. Excluding IPM
Discussion and MEM, of the 11 other drugs, only GEN did not show a
In recent years, the emergence and spread of MDR bac- significant difference in resistance. Resistance in the CR-PA
teria have brought great challenges to the clinical treatment group was greater than that of the CS-PA group, and the
of bacterial infections. P. aeruginosa, a clinically important difference was significant, a finding also shown by Gu B21
Pseudomonas species, causes nosocomial infections world- and colleagues. This finding suggests that new drug-resistant
wide. During transmission of bacterial drug resistance, the genes are captured continuously by P. aeruginosa under the
movement of genes and other DNA sequences (e.g., drug selection pressure of an antibacterial agent, which enables
resistance plasmids, transposons, insertion sequences, and P. aeruginosa to survive if various medicines are adminis-
integrons, among others) plays an important role. Increased tered. In addition, based on the integron carrier, the col-
antibiotic resistance in P. aeruginosa isolates can be at- lected strains were divided into integron-positive and
tributed to their ability to obtain resistance by the movement integron-negative groups, from which drug resistance was
of genetic elements. Because of the role played by class 1 compared. The results showed more integron-positive
integrons in the rapid dissemination of multiple genes en- groups than integron-negative groups in all 13 commonly
coding antibiotic resistance,6 we analyzed the prevalence of used clinical drugs, and the difference was significant. This
class 1 integrons in P. aeruginosa. result is similar to that of other scholars.5,21–23
Class 1 integrons were detected in 14 (12.4%, 14/113)
isolates, a similar finding to other research from China.5,21–23
Table 4. Comparison Between Integron-Positive However, this result is quite different from those of studies
and Integron-Negative Isolates in which the determinants of drug resistance related to in-
tegrons were found in the isolates from several P. aeruginosa
int+ (%) int- (%) p outbreaks.6,24,25 Studies have shown that almost half of all
AK 50.00 0.00 0.000 drug-resistant P. aeruginosa strains carry integrons.6,26 It
ATM 57.14 12.12 0.000 has been suggested that the homozygous carriage rate for
CAZ 57.14 6.06 0.000 P. aeruginosa in China is lower than that in other coun-
CIP 78.57 18.18 0.000 tries, and the results of our study are in accordance with
CSL 64.29 7.07 0.000 data from China.5,21
FEP 64.29 2.02 0.000 We detected six gene clusters containing 17 gene cas-
GEN 50.00 3.03 0.000 settes in the variable regions of the isolates. These gene
IPM 57.14 20.20 0.003 cassettes contain not only aminoglycoside and trimethoprim
LEV 71.43 21.21 0.000 drug-resistant genes (the antibiotics for which were used
MEM 57.14 18.18 0.001 commonly in China in the early to mid-20th century) but
PIP 64.29 13.13 0.000
TOB 71.43 3.03 0.000 also genes encoding resistance to b-lactamases, fluor-
TZP 64.29 5.05 0.000 oquinolones, and even carbapenem (the antibiotics for
which are used widely at present). Previously, these genes
int+: integron-positive isolates; int-: integron negative isolates. were underdetected or detected mainly in other species,
CLASS 1 INTEGRONS IN PSEUDOMONAS AERUGINOSA 675

whereas in P. aeruginosa, they were relatively rare. Fur- Acknowledgments

thermore, a transposition enzyme, genome gene cassettes DNA sequencing and primer synthesis were carried out
(gcu35/165), and various other integrons were detected in by Sangon Biotechnology Co., Ltd. (Shanghai, China). We
our study, and this was relatively rare in the variable regions thank Sandra Cheesman, PhD, from Liwen Bianji, Edanz
of integrons in the past. The specific functions of the in- Group China, for editing the English text of a draft of this
tegrons in these gene cassettes are obscure and must be article. We have received and archived written patient
studied further. consent from all patients included in this study, and the
Novel genes conferring antibiotic resistance, such as approval by the hospital ethics committee for the use of
qnrVC6, have been reported in different species.6,27–29 samples for human patients.
blaOXA-01/101, which mainly mediates drug resistance in
Acinetobacter baumannii, also had a high detection rate in our
study. In addition, the diversity of gene cassettes carried by class Disclosure Statement
1 integrons is broadening,6,30 and aad cassettes (which confer No competing financial interests exist.
resistance to aminoglycosides) were detected herein with a
similarly high detection rate as that reported previously. How-
Funding Information
ever, gene cassettes encoding resistance to trimethoprim (dfrA)
were found less frequently in our study. Previously, it was con- The present study was supported by the fund from the
sidered that this gene is highly stable in Enterobacteriaceae- Health and Family Planning Commission of Weifang
integrated zygotes, with high detection rates in most strains. That (wfwsjs_2018_110) and research grants from the Health
the detection rate of dfrA in the present study was low may reflect Commission of Shandong Province (2018WS078).
that P. aeruginosa has a strong ability to respond quickly to the
selection pressure of antibiotics.31–33 References
Although the frequency of isolates resistant to b-lactamases
was high, the blaOXA-1 gene cassette was found in only one 1. Hall, R.M., and H.W. Stokes. 1993. Integrons: novel DNA
commensal isolate, suggesting that the genes encoding b- elements which capture genes by site-specific recombina-
lactamases are mostly located outside of integrons, which was tion. Genetica 90:115–132.
also observed by Mokracka et al.34,35 The extended-spectrum b- 2. Collis, C.M., and R.M. Hall. 1995. Expression of antibiotic
lactamase resistance genes—blaOXA-1 and blaOXA-101— resistance genes in the integrated cassettes of integrons.
were also found in the present study. These genes can confer Antimicrob. Agents Chemother. 39:155–162.
3. Hall, R.M., and C.M. Collis. 1998. Antibiotic resistance in
resistance to cefepime and IPM, the most commonly used anti-
Gram-negative bacteria: the role of gene cassettes and in-
biotics nowadays. However, these gene cassettes were found in
tegrons. Drug Resist. Updat. 1:109–119.
only two intI1-positive isolates. Possibly the selection pressure 4. Mazel, D. 2006. Integrons: agents of bacterial evolution.
of these antibiotics lacks strength or insufficient time has passed Nat. Rev. Microbiol. 4:608–620.
to select for a higher prevalence of these gene cassettes.5,6,21,31–35 5. Wei, Q., X. Jiang, M. Li, G. Li, Q. Hu, H. Lu, G. Chen, Y.
Zhou, and Y. Lu. 2013. Diversity of gene cassette promoter
Conclusions variants of class 1 integrons in uropathogenic Escherichia
Our data suggest that P. aeruginosa is found commonly in coli. Curr. Microbiol. 67:543–549.
clinical respiratory tract infections and aseptic site infections, 6. Novovic, K.D., M.J. Malesevic, B.V. Filipic, N.L. Mirko-
and drug resistance in it has been increasing considerably in vic, M.S. Miljkovic, M.O. Kojic, and B.U. Jovčić. 2019.
PsrA regulator connects cell physiology and class 1 in-
recent years. The integron carriage rate of P. aeruginosa and
tegron integrase gene expression through the regulation of
the characteristics of the gene cassettes it carries suggest that
lexA gene expression in Pseudomonas spp. Curr. Micro-
there are similarities and differences in the genes it carries biol. 76:320–328.
compared with other species. Stably acquired drug resistance 7. Magiorakos, A.P., A. Srinivasan, R.B. Carey, Y. Carmeli,
genes are being eliminated in P. aeruginosa. M.E. Falagas, C.G. Giske, S. Harbarth, J.F. Hindler, G.
Concurrently, genetic resistance elements against com- Kahlmeter, B. Olsson-Liljequist, D.L. Paterson, L.B. Rice,
monly used clinical drugs (e.g., b-lactamases, fluor- J. Stelling, M.J. Struelens, A. Vatopoulos, J.T. Weber, and
oquinolones, and even carbapenems), as well as some other D.L. Monnet. 2012. Multidrug-resistant, extensively drug-
gene elements, are newly integrated. The variable regions of resistant and pandrug-resistant bacteria: an international
the integrons showed that the gene clusters we identified expert proposal for interim standard definitions for acquired
were, in general, large, and there were many gene cassette resistance. Clin. Microbiol. Infect. 18:268–281.
types, both of which play a very important role in drug 8. Kung, V.L., E.A. Ozer, and A.R. Hauser. 2010. The ac-
resistance in P. aeruginosa. The continuous evolution of cessory genome of Pseudomonas aeruginosa. Microbiol.
drug resistance in P. aeruginosa brings great challenges to Mol. Biol. Rev. 74:621–641.
its clinical treatment. Therefore, curbing drug resistance and 9. Livermore, D.M. 2002. Multiple mechanisms of antimi-
the spread of P. aeruginosa infections are important goals. crobial resistance in Pseudomonas aeruginosa: our worst
nightmare? Clin. Infect. Dis. 34:634–640.
Authors’ Contributions 10. Stokes, H.W., and R.M. Hall. 1989. A novel family of
potentially mobile DNA elements encoding site-specific
W.L. designed the study. W.L., M.L., and J.M. conducted gene-integration functions: integrons. Mol. Microbiol. 3:
the study, collected the data, and prepared the article. W.J. 1669–1683.
provided advice and edited the article. All authors approved 11. Recchia, G.D., and R.M. Hall. 1995. Gene cassettes: a new
the final version of the article. class of mobile element. Microbiology 141:3015–3027.
676 LIU ET AL.

12. Partridge, S.R., G. Tsafnat, E. Coiera, and J. Iredell. 2009. blaIMP-1 gene cassette in Hiroshima. J. Antimicrob. Che-
Gene cassettes and cassette arrays in mobile resistance in- mother. 64:46–51.
tegrons. FEMS Microbiol. Rev. 33:757–784. 25. Tsakris, A., A. Poulou, I. Kristo, T. Pittaras, N. Spanakis, S.
13. Cambray, G., A. Guerout, and D. Mazel. 2010. Integron. Pournaras, and F. Markou. 2009. Large dissemination of
Annu. Rev. Genet. 44:141–166. VIM-2-metallob Pseudomonas aeruginosa strains causing
14. Deng, Y., J. Liu, B. Peters, D. Chen, G. Yu, Z. Xu, and M. health care-associated community-onset infections. J. Clin.
Shirtliff. 2015. Antimicrobial resistance investigation on Microbiol. 47:3524–3529.
Staphylococcus strains in a local hospital in Southern 26. Xu, Z., L. Li, M.E. Shirtliff, M.J. Alam, S. Yamasaki, and
China, 2001–2010. Microb. Drug Resist. 21:102–104. L. Shi. 2009. Occurrence and characteristics of class 1 and
15. Carmeli, Y., N. Troillet, A.W. Karchmer, and M.H. Sa- 2 integrons in Pseudomonas aeruginosa isolates from pa-
more. 1999. Health and economic outcomes of antibiotic tients in southern China. J. Clin. Microbiol. 47:230–234.
resistance in Pseudomonas aeruginosa. Arch. Intern. Med. 27. Liu, J., L. Yang, D. Chen, B.M. Peters, L. Li, B. Li, Z. Xu,
159:1127–1132. and M.E. Shirtliff. 2018. Complete sequence of pBM413, a
16. Jarvis, W.R. 2003. Epidemiology and control of Pseudo- novel multidrug resistance megaplasmid carrying qnrVC6
monas aeruginosa infections in the intensive care unit. In and blaIMP–45 from Pseudomonas aeruginosa. Int. J.
A.R. Hauser and J. Rello (ed.), Severe infections caused by Antimicrob. Agents 51:145–150.
Pseudomonas aeruginosa. Kluwer Academic Publishers, 28. Liu, J., L. Yang, L. Li, B. Li, D. Chen, and Z. Xu. 2018.
Boston, MA, pp. 153–168. Comparative genomic analyses of two novel qnrVC6 car-
17. Zhang, R., Z. Liu, J. Li, L. Lei, W. Yin, M. Li, C. Wu, T.R. rying multidrug-resistant Pseudomonas spp. strains. Mi-
Walsh, Y. Wang, S. Wang, and Y. Wu. 2017. Presence of crob. Pathog. 123:269–274.
VIM-positive Pseudomonas species in chickens and their 29. Liu, J., L. Li, B.M. Peters, B. Li, D. Chen, Z. Xu, and M.E.
surrounding environment. Antimicrob. Agents Chemother. Shirtliff. 2018. Complete genomic analysis of multidrug-
27;61:e00167-17. resistance Pseudomonas aeruginosa Guangzhou-Pae617, the
18. Wang, Y., R. Zhang, J. Li, Z. Wu, W. Yin, S. Schwarz, M.J. host of megaplasmid pBM413. Microb. Pathog. 117:265–269.
Tyrrell, Y. Zheng, S. Wang, Z. Shen, Z. Liu, J. Liu, L. Lei, 30. Yu, G., W. Wen, B. Peters, J. Liu, C. Ye, Y. Che, J. Liu, K.
M. Li, Q. Zhang, C. Wu, Q. Zhang, Y. Wu, T. Walsh, and J. Cao, Z. Xu, and M.E. Shirtliff. 2016. First report of novel
Shen. 2017. Comprehensive resistome analysis reveals the genetic array aacA4blaIMP–25-oxa30-catB3 and identifi-
prevalence of NDM and MCR-1 in Chinese poultry pro- cation of novel metallo-blactamase gene blaIMP25: a ret-
duction. Nat. Microbiol. 2:16260. rospective study of antibiotic resistance surveillance on
19. Nordmann, P., M. Gniadkowski, C.G. Giske, L. Poirel, N. Psuedomonas aeruginosa in Guangzhou of South China,
Woodford, V. Miriagou; and European Network on Car- 2003–2007. Microb. Pathog. 95:62–67.
bapenemases. 2012. Identification and screening of 31. Zeighami, H., F. Haghi, N. Masumian, F. Hemmati, A. Sa-
carbapenemase-producing Enterobacteriaceae. Clin. Mi- mei, and G. Naderi. 2015. Distribution of integrons and gene
crobiol. Infect. 18:432–438. cassettes among uropathogenic and diarrheagenic Escher-
20. Clinical and Laboratory Standards Institute. 2018. Perfor- ichia coli isolates in Iran. Microb. Drug Resist. 21:435–440.
mance Standards for Antimicrobial Susceptibility Testing. 32. Su, J., L. Shi, L. Yang, Z. Xiao, X. Li, and S. Yamasaki.
28th ed. CLSI, Wayne, PA. CLSI supplement M100. 2006. Analysis of integrons in clinical isolates of Escher-
21. Gu, B., M. Tong, W. Zhao, G. Liu, M. Ning, S. Pan, and W. ichia coli in China during the last six years. FEMS Mi-
Zhao. 2007. Prevalence and characterization of class I in- crobiol. Lett. 254:75–80.
tegrons among Pseudomonas aeruginosa and Acineto- 33. Yan, H., L. Li, M. Zong, M.J. Alam, and S. Shinoda. 2010.
bacter baumannii isolates from patients in Nanjing, China. Occurrence and characteristics of class I and II integrons in
J. Clin. Microbiol. 45:241–243. clinical bacterial isolates from patients in south China. J.
22. Lee, Y.L., M.C. Lu, P.L. Shao, P.L. Lu, Y.H. Chen, S.H. Health Sci. 56:442–450.
Cheng, W.C. Ko, C.Y. Lin, T.S. Wu, M.Y. Yen, L.S. 34. Oliveira-Pinto, C., C. Diamantino, P.L. Oliveira, M.P. Reis,
Wang, C.P. Liu, W.S. Lee, Z.Y. Shi, Y.S. Chen, F.D. P.S. Costa, M.C. Paiva, R.M.D. Nardi, P.P. Magalhães, E.
Wang, S.H. Tseng, C.N. Lin, Y.H. Chen, W.H. Sheng, Chartone-Souza, and A.M.A. Nascimento. 2017. Occur-
C.M. Lee, M.H. Liao, and P.R. Hsueh. 2019. Nationwide rence and characterization of class 1 integrons in Escher-
surveillance of antimicrobial resistance among clinically ichia coli from healthy individuals and those with urinary
important Gram-negative bacteria, with an emphasis on infection. J. Med. Microbiol. 66:577–583.
carbapenems and colistin: results from the Surveillance of 35. Mokracka, J., R. Koczura, and A. Kaznowski. 2012.
Multicenter Antimicrobial Resistance in Taiwan (SMART) Transferable integrons of Gram-negative bacteria isolated
in 2018. Int. J. Antimicrob. Agents. 54:318–328. from the gut of a wild boar in the buffer zone of a national
23. Ayoub Moubareck, C., D. Hammoudi Halat, C. Akkawi, A. park. Ann. Microbiol. 62:877–880.
Nabi, M.A. AlSharhan, Z.O. AlDeesi, C.C. Peters, H. Ce-
liloglu, and D. Karam Sarkis. 2019. Role of outer mem- Address correspondence to:
brane permeability, efflux mechanism, and carbapenemases Wanxiang Li, MD
in carbapenem-nonsusceptible Pseudomonas aeruginosa Department of Clinical Laboratory
from Dubai hospitals: results of the first cross-sectional Weifang People’s Hospital
survey. Int. J. Infect. Dis. 84:143–150. 151 Guangwen Street
24. Kouda, S., M. Ohara, M. Onodera, Y. Fujiue, M. Sasaki, T. Weifang 261041
Kohara, S. Kashiyama, S. Hayashida, T. Harino, T. Tsuji, Shandong
H. Itaha, N. Gotoh, A. Matsubara, T. Usui, and M. Sugai. China
2009. Increased prevalence and clonal dissemination of
multidrug-resistant Pseudomonas aeruginosa with the E-mail: [email protected]