Structural Analysis of Complex Networks 2011

Matthias Dehmer
Editor
Structural Analysis
of Complex Networks
Editor
Ao. Prof. Dr. habil. Matthias Dehmer
Institute for Bioinformatics and Translational Research
The Health and Life Sciences University
UMIT-Private Universität für Gesundheitswissenschaften
Eduard Wallnöfer-Zentrum 1
A-6060 Hall in Tirol, Austria
and
Institute of Discrete Mathematics and Geometry
Vienna University of Technology
Wiedner Hauptstrasse 8-10
A-1040 Vienna, Austria
ISBN 978-0-8176-4788-9 e-ISBN 978-0-8176-4789-6

DOI 10.1007/978-0-8176-4789-6
Springer Dordrecht Heidelberg London New York
Library of Congress Control Number: 2010938359
Mathematics Subject Classification: 05C05, 05C12, 05C75, 05C80, 05C85, 05D40, 68R10, 90B10,
92E10, 94C15
c Springer Science+Business Media, LLC 2011

All rights reserved. This work may not be translated or copied in whole or in part without the written
permission of the publisher (Springer ScienceCBusiness Media, LLC, 233 Spring Street, New York,
NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in
connection with any form of information storage and retrieval, electronic adaptation, computer software,
or by similar or dissimilar methodology now known or hereafter developed is forbidden.
The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are
not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject
to proprietary rights.
Printed on acid-free paper
www.birkhauser-science.com
Preface
Because of the increasing complexity and growth of real-world networks, their

analysis by using classical graph-theoretic methods is oftentimes a difficult pro-
cedure. Thus, there is a strong need to combine graph-theoretic methods with
mathematical techniques from other scientific disciplines, such as machine learning,
statistics, and information theory, for analyzing complex networks more adequately.
The book Structural Analysis of Complex Networks presents theoretical as well
as practice-oriented results for structurally exploring complex networks. Hence, the
book does not only focus on classical graph-theoretical methods, it also shows the
usefulness and potential of structural graph theory as a tool for solving interdis-
ciplinary problems. Special emphasis is given to methods and areas which can be
roughly summarized as follows:
Graph-theoretical applications in, e.g., structural biology, computational biology,
mathematical chemistry, and computational linguistics;
Graph classes;
General structural properties of networks;
Graph colorings;
Graph polynomials;
Information measures for graphs, e.g., graph entropies;
Metrical properties of graphs;
Partitions and decompositions;
Quantitative graph measures.
This book is intended for an interdisciplinary audience, covering topics from
artificial intelligence, computer science, computational and systems biology, cog-
nitive science, computational linguistics, discrete mathematics, machine learning,
mathematical chemistry, and statistics, and it contains nineteen chapters that have
been peer-reviewed according to the standards of international journals in applied
mathematics. The chapters and some of their interrelations can be briefly described
as follows.
Emmert-Streib starts the volume by surveying basic structural properties of com-
plex networks, important graph classes, and graph measures used when performing
network analysis quantitatively. The latter relates to determining the structural sim-
ilarity between graphs and their structural complexity using entropic measures.
v
vi Preface
Further concepts used to explore networks structurally are provided by the next
chapters authored by Borowiecki, Goddard et al., and Ananchuen et al. In partic-
ular, these chapters present techniques of graph partitioning, distances in graphs,
and domination in graphs, respectively. The chapter written by Fujii also discusses
entropy measures, but for infinite directed graphs. However, these measures are ob-
tained by using operator theory and, hence, are differently defined than the ones
presented in the chapter by Emmert-Streib; those are derived based on Shannon’s
entropy and can be interpreted as the structural information content of a graph. Then,
the chapters authored by Matsumoto, Kovář, and Brešar et al. investigate multi-
faceted problems, like exploring infinite labeled graphs to study presentations of
symbolic dynamical systems, special graph decompositions, and the examination
of geodetic sets in graphs, which represents an important problem using metrical
properties of graphs. Ellis-Monaghan et al. provide two chapters in this volume on
graph polynomials: The first one emphasizes the Tutte polynomial and some closely
related graph polynomials. The second chapter by Ellis-Monaghan et al. sheds light
on interpretations of concrete polynomials and on interrelations between other graph
polynomials and the Tutte polynomial. The problem of reconstructing graphs by
examining specific properties of polynomials, here, the zeros of Krawtchouk poly-
nomials, is tackled in the next chapter by Stoll. Quantitative methods to calculate the
structural similarity or distance between two graphs have already been mentioned
in Emmert-Streib’s chapter. In particular, classical measures based on determining
isomorphic subgraphs have already been mentioned there. The chapter written by
Lauri treats the graph similarity problem in a similar manner, namely based on the
number of common vertex-deleted subgraphs, and examines aspects of the com-
putational complexity for calculating the mentioned graph similarity measure. The
idea of defining structural distances between graphs is tackled in the next chapter,
written by Benadé. More precisely, a chromatic metric is defined, and, remarkably,
by applying this metric, the maximum distance between any two graphs is at most
three.
The last six chapters of this volume use graph-theoretic techniques to solve
challenging problems in, e.g., applied mathematics, computer science, quantum
chemistry, electrical engineering, computational linguistics, structural biology and
RNA structure analysis, computational biology, and mathematical chemistry. The
chapter authored by Cioabă gives a broad overview on results for relating important
structural properties of a graph to its eigenvalues. Also, Cioabă surveys impor-
tant applications of graph spectra in subfields of the just-mentioned disciplines. To
demonstrate the great potential of novel graph classes within computational lin-
guistics, Mehler introduces a graph class consisting of hierarchical graphs called
Minimum Spanning Markovian Trees and shows its usefulness by outlining con-
crete applications within semiotic network analysis. The chapter contributed by
Scripps et al. starts by reviewing techniques to mine general complex networks,
but mainly focuses on link-based classification, which often appears as an impor-
tant problem in Web mining. The next two chapters, authored by Washietl et al. and
Mason et al., explore graph-based problems in structural and computational biology,
respectively. In particular, Washietl et al. investigate RNA structures represented by
Preface vii
graphs and review graph-theoretical methods for describing and comparing such
structures. A problem that is currently of considerable interest in biological network
analysis is addressed by Mason et al. and deals with surveying methods for pre-
dicting protein function based on complex interaction networks. An area in which
graph-theoretical models and techniques have been intensely applied so far is math-
ematical chemistry. The volume concludes by presenting a chapter about a graph
class that is meaningful in mathematical chemistry: Vukičević presents techniques
for determining the existence and enumeration of what are called perfect match-
ings that correspond to Kekulé structures, which are well known in mathematical
chemistry.
Many colleagues, whether consciously or unconsciously, provided input,
help, and support before and during the formation of this book. In particular,
I would like to thank Hamid Arabnia, Alireza Ashrafi, Alexandru T. Balaban,
Subhash Basak, Igor Bass, Agnieszka Bergel, David Bialy, Danail Bonchev, Ste-
fan Borgert, Mieczysław Borowiecki, Monique Borusiak, Ulrike Brandt, Mathieu
Dutour, Michael Drmota, Abdol-Hossein Esfahanian, Maria Fonoberova, Bernhard
Gittenberger, Arno Homburg, Jürgen Kilian, Elena Konstantinova, Reinhard Kutzel-
nigg, Dmitrii Lozovanu, Alexander Mehler, Tomás Madaras, Abbe Mowshowitz,
Marina Popovscaia, Fred Sobik, Stefan Shetschew, Doru Stefanescu, Thomas Stoll,
Kurt Varmuza, Ilona Wesarg, Bohdan Zelinka, Dongxiao Zhu, and all authors and
co-authors of this book. I apologize to any who inadvertently have not been named.
I am deeply grateful to Armin Graber from UMIT for his strong support and for
providing such a stimulating working atmosphere. Many thanks to Isabella Fritz,
Bernd Haas, Gerd Lorünser, Brigitte Senn-Kircher, and Klaus Weinberger for their
help and fruitful discussions. Moreover, I thank Frank Emmert-Streib for the ex-
tremely fruitful collaboration and many stimulating discussions we had over several
years. Frank also provided the figures used to design the front cover of this book.
In addition, I would like to thank editors Tom Grasso, Rebecca Biega, and Regina
Gorenshteyn from Birkhäuser Publishing (Boston), who have always been available
and helpful. Last but not least, I would like to thank my wife Jana and my family
— Marion Dehmer-Sehn and Werner Dehmer — for their unfailing support and
encouragement.
Finally, I hope that this book will help to extend the enthusiasm and joy that
I feel for this field to others, and that it will inspire people to apply graph the-
ory to different scientific areas for the solution of challenging and interdisciplinary
problems.
Hall in Tirol, April 2010 Matthias Dehmer

Contents
Preface .. . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . v
Contributors . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . xi
1 A Brief Introduction to Complex Networks

and Their Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . 1
Frank Emmert-Streib
2 Partitions of Graphs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . 27
Mieczysław Borowiecki
3 Distance in Graphs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . 49
Wayne Goddard and Ortrud R. Oellermann
4 Domination in Graphs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . 73
Nawarat Ananchuen, Watcharaphong Ananchuen,
and Michael D. Plummer
5 Spectrum and Entropy for Infinite Directed Graphs . . . .. . . . . . . . . . . . . . . . .105

Jun Ichi Fujii
6 Application of Infinite Labeled Graphs to Symbolic

Dynamical Systems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .137
Kengo Matsumoto
7 Decompositions and Factorizations of Complete Graphs .. . . . . . . . . . . . . . .169

Petr Kovář
8 Geodetic Sets in Graphs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .197

Boštjan Brešar, Matjaž Kovše, and Aleksandra Tepeh
ix
x Contents
9 Graph Polynomials and Their Applications I:

The Tutte Polynomial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .219
Joanna A. Ellis-Monaghan and Criel Merino
10 Graph Polynomials and Their Applications II:

Interrelations and Interpretations .. . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .257
11 Reconstruction Problems for Graphs, Krawtchouk

Polynomials, and Diophantine Equations . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .293
Thomas Stoll
12 Subgraphs as a Measure of Similarity . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .319

Josef Lauri
13 A Chromatic Metric on Graphs .. . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .335

Gerhard Benadé
14 Some Applications of Eigenvalues of Graphs . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .357

Sebastian M. Cioabă
15 Minimum Spanning Markovian Trees: Introducing

Context-Sensitivity into the Generation of Spanning Trees .. . . . . . . . . . . . .381
Alexander Mehler
16 Link-Based Network Mining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .403

Jerry Scripps, Ronald Nussbaum, Pang-Ning Tan,
and Abdol-Hossein Esfahanian
17 Graph Representations and Algorithms in Computational

Biology of RNA Secondary Structure . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .421
Stefan Washietl and Tanja Gesell
18 Inference of Protein Function from the Structure

of Interaction Networks .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .439
Oliver Mason, Mark Verwoerd, and Peter Clifford
19 Applications of Perfect Matchings in Chemistry . . . . . . . . .. . . . . . . . . . . . . . . . .463

Damir Vukičević
Index . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .483
Contributors
Nawarat Ananchuen Department of Mathematics, Faculty of Science,

Silpakorn University, Nakorn Pathom 73000, Thailand, [email protected]
Watcharaphong Ananchuen School of Liberal Arts, Sukhothai Thammathirat
Open University, Nonthaburi 11120, Thailand, [email protected]
Gerhard Benadé School of Computer Science, Statistics and Mathematics,
North-West University, Potchefstroom, South Africa, [email protected]
Mieczysław Borowiecki Faculty of Mathematics, Computer Science
and Econometrics, University of Zielona Góra, Podgórna 50, 65-246 Zielona Góra,
Poland, [email protected]
Boštjan Brešar Faculty of Natural Sciences and Mathematics, University
of Maribor, Koroška 160, 2000 Maribor, Slovenia, [email protected]
Sebastian M. Cioabǎ Department of Mathematical Sciences, University of
Delaware, 501 Ewing Hall, Newark, DE 19716-2553, USA, [email protected]
Peter Clifford Hamilton Institute, NUI Maynooth, Maynooth, Ireland,
[email protected]
Joanna A. Ellis-Monaghan Department of Mathematics, Saint Michael’s College,
One Winooski Park, Colchester, VT 05439, USA
and
Department of Mathematics and Statistics, University of Vermont, 16 Colchester
Avenue, Burlington, VT 05405, USA, [email protected]
Frank Emmert-Streib Computational Biology and Machine Learning, Center
for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomed-
ical Sciences, Queen’s University Belfast, 97 Lisburn Road, Belfast BT9 7BL, UK,
[email protected]
Abdol-Hossein Esfahanian Computer Science and Engineering Department,
3115 Engineering Building, Michigan State University, East Lansing,
MI 48824-1226, USA, [email protected]
xi
xii Contributors
Jun Ichi Fujii Department of Arts and Sciences (Information Science),

Osaka Kyoiku University, Asahigaoka, Kashiwara, Osaka 582-8582, Japan,
[email protected]
Tanja Gesell Center for Integrative Bioinformatics Vienna, Max F. Perutz
Laboratories, Dr. Bohr-Gasse 9, 1030 Vienna, Austria
and
University of Vienna, Medical University of Vienna, and University of Veterinary
Medicine, Vienna, Austria, [email protected]
Wayne Goddard School of Computing and Department of Mathematical
Sciences, Clemson University, Clemson, SC 29634-1906, USA,
[email protected]
Petr Kovář Department of Applied Mathematics, Technical University Ostrava,
17. listopadu, 708 33 Ostrava–Poruba, Czech Republic, [email protected]
Matjaž Kovše Faculty of Natural Sciences and Mathematics, University
of Maribor, Koroška 160 2000 Maribor, Slovenia [email protected]
Josef Lauri Department of Mathematics, University of Malta, Tal-Qroqq, Malta,
[email protected]
Oliver Mason Hamilton Institute, NUI Maynooth, Maynooth, Ireland,
[email protected]
Kengo Matsumoto Department of Mathematics, Joetsu University of Education,
Joetsu 943-8512, Japan, [email protected]
Alexander Mehler Goethe-University Frankfurt am Main, Senckenberganlage
31, 60325 Frankfurt am Main, Germany, [email protected]
Criel Merino Instituto de Matemáticas, Universidad Nacional Autónoma
de México, Area de la Investigación Cientı́fica, Circuito Exterior,
C.U., Coyoacán, 04510 México D.F., México, [email protected]
Ronald Nussbaum Computer Science and Engineering Department,
3115 Engineering Building, Michigan State University, East Lansing, MI
48824-1226, USA, [email protected]
Ortrud R. Oellermann Department of Mathematics and Statistics,
University of Winnipeg, Winnipeg, MB R3B 2E9, Canada
[email protected]
Michael D. Plummer Department of Mathematics, Vanderbilt University,
Nashville, TN 37240, USA, [email protected]
Jerry Scripps School of Computing and Information Systems, 1 Campus
Drive, Grand Valley State University, Allendale, MI 49401, USA,
[email protected]
Thomas Stoll Faculty of Mathematics, School of Computer Science,
University of Waterloo, Waterloo, ON, Canada, [email protected]
Contributors xiii
Pang-Ning Tan Computer Science and Engineering Department,

3115 Engineering Building, Michigan State University, East Lansing, MI
48824-1226, USA, [email protected]
Aleksandra Tepeh University of Maribor, FEECS, Smetanova 17,
2000 Maribor, Slovenia, [email protected]
Mark Verwoerd Hamilton Institute, NUI Maynooth, Maynooth, Ireland,
[email protected]
Damir Vukičević Faculty of Mathematics and Natural Sciences, University
of Split, Nikole Tesle 12, HR-21000 Split, Croatia, [email protected]
Stefan Washietl EMBL-European Bioinformatics Institute, Wellcome Trust
Genome Campus, Hinxton, Cambridge CB10 1SD, UK
and
Institute for Theoretical Chemistry, University of Vienna, Währingerstraße 17,
A-1090 Vienna, Austria, [email protected]
Chapter 1
A Brief Introduction to Complex Networks
and Their Analysis
Frank Emmert-Streib
Abstract In this chapter we present a brief introduction to complex networks and

their analysis. We review important network classes and properties thereof as well
as general analysis methods. The focus of this chapter is on the structural analysis
of networks, however, information-theoretic methods are also discussed.
Keywords Complex networks Centrality measures Comparative network

analysis Module detection Information-theoretic measures
MSC2000: Primary 05C90; Secondary 65C60, 46N60, 94A17
1.1 Introduction
Discrete objects representing graphs have been studied for a long time. Among the
first who studied graphs are Euler [56] and Cayley [30]. Interestingly, the origin of
the term graph dates back to König in the 1930s [81], less than 100 years ago. The
interest in graphs and their analysis is manifold. From a theoretical point of view
the categorization and the analysis of properties of graphs [20, 44, 54, 70] as well
as the development of graph algorithms [37, 57] are important problems that have
been studied extensively. From an applied point of view it has been realized that
graphs can represent physical [70], biological [51, 78, 101], or sociological objects
[68, 104], e.g., a crystal or protein structure or the acquaintance network among a
group of people. Recently, networks have been also employed in data analysis and
machine learning [3, 51, 99]. In the following we use the terms graph and network
interchangeably although they do not mean precisely the same thing. Usually,
F. Emmert-Streib ()
Computational Biology and Machine Learning, Center for Cancer Research
and Cell Biology, School of Medicine, Dentistry and Biomedical Sciences,
Queen’s University Belfast, 97 Lisburn Road, Belfast BT9 7BL, UK
e-mail: [email protected]
M. Dehmer (ed.), Structural Analysis of Complex Networks, 1

DOI 10.1007/978-0-8176-4789-6 1, c Springer Science+Business Media, LLC 2011
2 F. Emmert-Streib
a graph refers first of all to a mathematical object regardless of its realization in,
e.g., nature, whereas a network represents a “real-world” object rather than a pure
mathematical one. Because we want to focus on applied aspects of graphs most of
the time we prefer the expression network.
In this chapter we provide a brief introduction to complex networks and their
analysis. In Sect. 1.2 we review some important network classes. In Sect. 1.3 we
present some methods for the structural analysis of networks that help, e.g., to
characterize them as a whole or allow us to identify specific nodes in the network
with certain properties. In Sect. 1.3.5 we present important methods to analyze net-
works comparatively. This means that means these measures always compare two
graphs with each other and provide, hence, similarity or dissimilarity measures
for this comparison. Such methods are especially useful for data analysis or ma-
chine learning because they allow a combination with, e.g., clustering methods to
extract regularities from the obtained, e.g., similarity values for corpora of networks.
Section 1.3.6 presents a method for the identification of community or module struc-
ture of networks as important, e.g., for the analysis of communication networks.
In Sect. 1.4 we discuss information-theoretic measures and this chapter finishes in
Sect. 1.5 with a short summary and conclusions.
1.2 Important Network Classes
We begin this chapter by reviewing well-known network classes. In the following

we mainly restrict ourselves to undirected unweighted networks, however, most of
the presented networks can be generalized easily.
1.2.1 Simple Networks
A simple network consists of regular connections among the nodes. One of the most
prominent examples therefore is the two-dimensional lattice as shown in Fig. 1.1.
Here each node is connected to its nearest neighbors. Despite its simplicity, such
networks have been used extensively, e.g., in physics to study phenomena like ferro-
magnetism with the Ising model [32]. Other examples of this class are linear chains
or nonrectangular lattices as used, e.g., in the context of protein structure prediction
to model protein folding [74].
1.2.2 Random Networks
Random networks have been extensively studied by Erdös and Rényi [54, 55].
A random graph with N nodes is obtained by connecting every pair of nodes with
1 A Brief Introduction to Complex Networks and Their Analysis 3
Fig. 1.1 Left: Regular two-dimensional lattice. Right: Linear, regular chain
probability p. The expected number of edges for a (undirected) network constructed

this way is
N.N 1/
E.N / D p : (1.1)
2
1.2.3 Degree Distribution
The degree distribution of a node i in a random network is binomial

!
N 1 k
P .ki D k/ D p .1 p/N 1k ; (1.2)
k
because the maximal degree of node i is N 1, the probability that the vertex has
k links is p k .1 p/N 1k and there are Nk1 possibilities to choose k links from
N 1 nodes. In the limit N ! 1 (1.2) becomes
zk exp.z/
P .ki D k/ D : (1.3)
kŠ
Here z D p.N 1/ is the expected number of links for a node. This means that
the degree distribution of a node in a random network can be approximated by the
Poisson distribution for large N . For this reason random networks are also called
Poisson random networks [96].
Furthermore one can show that the degree distribution of a random network
(instead of just a node) also approximately follows a Poisson distribution
zr exp.z/
P .Xk D r/ D ; (1.4)
rŠ
meaning that there are Xk D r nodes in the network having degree k [2].
4 F. Emmert-Streib
1.2.4 Clustering Coefficient
In general the clustering coefficient of a node i is defined as the fraction Ei of

existing connections among its ki nearest neighbors divided by the total number of
possible connections,
2Ei
Ci D : (1.5)
ki .ki 1/
This corresponds to the probability that two nearest neighbors of i are connected
with each other. However, the probability in a random graph that two nodes are
connected with each other is Ci D p. This can be approximated by
z
Ci ; (1.6)
N
because the mean degree of a node is z D p.N 1/ pN .
1.2.5 Small-World Networks
Small-world networks were introduced by Watts and Strogatz [115]. They can be
obtained via the following algorithm. First, arrange all nodes on a ring and connect
each node with its k=2 nearest neighbors. Second, start with an arbitrary node i and
rewire its connection to its nearest neighbor on, e.g., the left side with probability
prw to any other node j in the network. If node i and j are already connected reject
this selection and change nothing. Then choose the next node in the ring in a, e.g.,
clockwise direction and repeat this procedure. Third, after all next neighbor con-
nections have been checked repeat this procedure for the second and all higher next
neighbors successively. This algorithm guarantees that each connection occurring in
the network is chosen exactly once to test for a rewiring with probability prw . The
rewiring probability prw controls the disorder of the resulting topology. For prw D 0
the regular topology is conserved, whereas prw D 1:0 leads to a random network.
Intermediate values 0 < prw < 1 give a topological structure that is between regular
and random.
1.2.6 Scale-Free Networks
Neither random nor small-world networks have a property frequently observed in

real-world networks, namely a scale-free behavior of the degrees
P .k/ k : (1.7)
which means that there is no “top” or “bottom”

1: t D 0
2: Start with N0 unconnected nodes
3: repeat
4: Add one new node to the existing network consisting thus far of Nt
nodes.
5: Connect the new node to e ( N0 ) nodes from the existing network.
A node is chosen based on the degree distribution of the node,
ki
pi D P ;
j kj
6: t Dt C1
7: Nt D Nt1 C 1
8: until Nt D N
Algorithm 1.1: Generation of a scale-free network (preferential attachment)
To explain this feature Barabasi and Albert introduced a model [4] now known as
the Barabasi–Albert (BA) or preferential attachment model [96] that results in so-
called scale-free networks which have a degree distribution following a power law
[4]. The major difference between the preferential attachment model and the other
algorithms described above to generate random or small-world networks is that the
preferential attachment model does not assume a fixed number of nodes N and
then start to rewire them with fixed probability with other nodes but N grows and
is connected with a certain probability (is not constant) to other nodes depending
on their degree. In Algorithm 1.1 we provide a principle algorithm to generate a
scale-free network.
1.2.7 Trees
A graph G is a tree if it has no loops (cycles) in G. This means that a tree is an

acyclic graph. Alternatively, upon removal of an edge a connected tree becomes
unconnected. Trees were first studied by Cayley [30, 31] and are, in addition to
their importance for graph theory, an important data structure in computer science
which appears in many different algorithms. Figure 1.2 shows two trees. We want
to emphasize that a tree does not represent a hierarchy, in the graph of a tree.
This is in contrast to rooted trees. A rooted tree is obtained, e.g., from a tree by
the identification of a so-called root node which forms the start of a hierarchy. In
Fig. 1.3 we show two rooted trees obtained from the tree on the right-hand side
of Fig. 1.2. The important difference is that rooted trees are ordered; they have
a “top” corresponding to the root node and a “bottom” corresponding to the leaf
nodes having no children. It is interesting to note that there is no restriction to the
degree a node can have. Apparently, the minimal number is one because otherwise
6 F. Emmert-Streib
Fig. 1.2 Trees
Fig. 1.3 Rooted trees obtained from the tree on the right-hand side in Fig. 1.2. Left: Root node is
the third node from the top. Right: Root node is the leftmost node at the top
Fig. 1.4 Rooted binary trees
the tree would be unconnected, however, other than that it is arbitrary. This brings
us to the next subclass of trees, rooted binary trees.
A special case of a rooted tree is a rooted binary tree. A node in a binary tree
has at most two children. Figure 1.4 shows two examples of rooted binary trees,
frequently just called binary trees. In Fig. 1.4 one can see that a node has at most
two children (maximal degree of a node is three). Intermediate nodes can have only
one child. This holds also for the root nodes as the right figure shows. Finally, we
want to mention that a disjoint union of trees is called a forest.
1.2.8 Generalized Trees
The graph class of directed generalized trees was introduced in [39,90]. Generalized
trees are an important extension to trees maintaining their characteristic of having
a hierarchy but in addition allowing a richer connectivity among nodes. Before we
provide a formal definition we give a motivation for their introduction visualized by
Fig. 1.5. On the left side in Fig. 1.5, a (normal) tree is shown. The dotted horizontal
lines should remind the reader that a tree is a hierarchical graph and the dotted
lines explicitly represent the hierarchy levels. These lines are included for didactic
reasons only and are not actually part of the tree. On the right-hand side of Fig. 1.5
a generalized tree is shown obtained from the tree on the left side by including two
additional edges, labeled E2 and E3 . In general, edges that connect nodes on the
E3
E2
Fig. 1.5 Left: Tree. Right: Generalized tree
same hierarchical level are of type E2 and edges that connect nodes on different
hierarchical levels that are farther apart than one level are of type E3 (formally
defined below). From this, we note that every generalized tree will result in a tree
after deleting all edges of type E2 and E3 from the generalized tree. Vice versa,
starting from a tree and including edges of type E2 and/or type E3 results in a
generalized tree. A formal definition is given as follows [50].
Definition 1 (Generalized Tree). A generalized tree GTi is defined by a vertex set
V , an edge set E, a level set L, and a multilevel function Li . The vertex and edge
set define the connectivity and the level set and the multilevel function induce a
hierarchy between the nodes of GTi . The index i 2 V indicates the root.
The multilevel function is defined as follows.
Definition 2 (Multilevel Function). The function Li W V n fi g ! L is called a
multilevel function.
The multilevel function Li assigns to all nodes except i an element l 2 L that
corresponds to the level it will be assigned. From these definitions it is immediately
clear that a generalized tree is similar to a graph but additionally equipped with a
level set L and a multilevel function Li introducing a node grouping corresponding
to the introduction of a hierarchy between nodes and sets thereof.
Definition 3 (Edge Types). A generalized tree GTi has three edge types:
Edges with jLi .m/ Li .n/j D 1 are called kernel edges (E1 ).
Edges with jLi .m/ Li .n/j D 0 are called cross edges (E2 ).
Edges with jLi .m/ Li .n/j > 1 are called up edges (E3 ).
We want to remark that for directed generalized trees edge type E3 will be split into
two edge types: one for up and another for down links. Using Definition 1 a tree is
characterized by jLi .m/ Li .n/j D 1 for all node pairs .m; n/.
From the given definitions and the visualization in Fig. 1.5 it is apparent that a
generalized tree is between a tree and a graph. It is hierarchical like a tree, but can
contain cycles like a graph which is not hierarchical.
8 F. Emmert-Streib
1.3 Structural Network Analysis
In this section, we summarize measures to characterize structural properties of

networks.
1.3.1 Degree Distribution
Degree distributions [16, 88] can be calculated by
jık .v/j
P .k/ WD ; (1.8)
N
where jık .v/j denotes the number of vertices in the network G of degree k and
N denotes the size of G (number of nodes). Equation (1.8) is just the proportion
of vertices in G having degree k. The degree ki of node i is the number of links
connected with node i . From this, it follows that (1.8) also has the meaning that a
randomly chosen node in the network has, with probability P .k/, k links to other
nodes.
It was an interesting and important finding that many real world networks like
the World Wide Web (WWW), the Internet, social networks, citation networks, or
food webs [1, 16, 19, 22, 29, 42] are not Poisson distributed but follow a power law
P .k/ k ; > 1: (1.9)
1.3.2 Clustering Coefficient
The clustering coefficient Ci is a local measure defined for every node i . It is defined
as the fraction of connections (Ei ) between nearest neighbors of i among each other
divided by the maximum number of such connections
2Ei
Ci D : (1.10)
ki .ki 1/
The clustering coefficient can be interpreted as the probability that two nearest
neighbors of i are connected with each other.
1.3.3 Path-Based Measures
Graph-theoretical quantities or properties are often used to characterize special types

or classes of complex networks. For example, it turned out that average path lengths
and diameters of certain biological networks are rather small compared to the size
of a network [86, 88, 98]. Related to this is the so-called “small-world” property
[115] that has been observed in a number of network types, e.g., social, metabolic,
and protein interaction networks in molecular biology [86, 88, 98]. We give a brief
overview of path-based network measures [17, 21, 23, 67, 71, 107].
Distance Matrix
.d.vi ; vj //vi ;vj 2V . d.vi ; vj / denotes the shortest distance (path) between vi and vj
measured in the number of edges or nodes that are between start node vi and end
node vj .
Mean or Characteristic Distance
1 X
dN .G/ WD N d.vi ; vj /: (1.11)
2 vi ¤vj 2V
E is the total number of edges in the network.
j -Sphere
The set
Sj .vi ; G/ WD fv 2 V j d.vi ; v/ D j; j 1g; (1.12)
is called the j -sphere of vi regarding G. Starting from vi , the cardinality jSj .vi ; G/j
denotes the number of vertices that have a shortest distance equal to j .
Eccentricity, Diameter, and Radius
Let G D .V; E/ be a graph. Then,
.v/ D max d.u; v/; (1.13)

u2V
is called the eccentricity of v 2 V .
.G/ D max .v/; (1.14)

v2V
and
r.G/ D min .v/; (1.15)
v2V
are called the diameter and radius of G, respectively.

10 F. Emmert-Streib
Degree, Degree Statistics, and Edge Density

P
For undirected graphs G D .V; E/, kv D i Av;vi equals the number of edges which
are adjacent to v 2 V . kv is called the degree of node v. From this, one obtains
straightforwardly the following degree measures for the whole network:
X kv
k D k.G/ WD ; (1.16)
N
v2V
1 X
k .G/ WD .kv k/2 ; (1.17)
N 1
v2V
and
1 X
k .G/ WD jkv kj: (1.18)
N
v2V
Equation (1.16) is the mean degree of the network, (1.17) is the variance of the
degree, and (1.18) is the mean of absolute distances between kv and k. Finally, the
edge density of G is defined as
E
ˇ.G/ WD N : (1.19)
2
Further network statistics and advanced aspects can be found in, e.g., [21, 67,
71, 107].
1.3.4 Centrality Measures
Identifying important vertices in networks is an interesting problem that has gained

much attention especially in the context of communication networks. For example,
the communication among a group of humans forms a communication network.
Social scientists in the late 1940s developed graph-theoretical measures to detect
important vertices in networks. An important class of such measures is based on
the centrality concept [66, 69, 114] which intuitively tries to identify nodes that are
central to the communication within the network among all nodes. There are two
fundamentally different types of centrality measures [58, 59]. The first type of mea-
sures evaluates the centrality of each node in a network and is called point centrality
measures where the word “point” refers to a node or vertex. The second type is
called graph centrality measures because it assigns a centrality value to the whole
network.
Point Centrality
In the following we provide some examples of point centrality measures.
Degree Centrality
For an undirected graph G D .V; E/, the degree centrality of a vertex v 2 V is

simply defined as its degree; i.e.,
CD .v/ D kv : (1.20)
For a directed network, the degree centrality can be analogously defined by using
the definition of in-degree and out-degree.
Betweenness Centrality
The centrality index betweenness is based on shortest paths found in the network
[5, 6, 18, 58, 66, 83, 88, 103, 104, 114] and is defined by
X vi vj .vk /
CB .vk / D : (1.21)
vi vj
vi ;vj 2V;vi ¤vj
Here vi vj denotes the number of shortest paths from vi to vj and vi vj .vk / the
number of shortest paths from vi to vj that include node vk . That means
vi vj .vk /
; (1.22)
vi vj
is the probability that node vk lies on a shortest path connecting vi with vj . Hence,
CB .vk / evaluates the appearance of node vk on all shortest paths in a network.
Closeness Centrality
The centrality index closeness tries to measure how close a node is to other nodes
in the network. This is done in terms of communication distance as measured by the
number of edges between two nodes if connected via the shortest path.
1
CC .vk / D PN : (1.23)
i D1 d.vk ; vi /
Here d.vk ; vi / is the number of edges on a shortest path between node vk and vi .
In the case where there are multiple shortest paths connecting vk with vi , d.vk ; vi /
is unchanged.
12 F. Emmert-Streib
Graph Centrality
To evaluate the centrality of whole networks instead of single nodes in the network
graph centrality measures have been suggested which form extensions to the three
measures discussed above [59]. The basic idea is to use these individual measures
to obtain an average characteristic for the whole network. It has been suggested to
calculate
PN
i D1 Cx .v /
m
Cx .vi /
Cx D max
: (1.24)
Cx
Here x stands for any of the three point centrality measures,
Cx .vm / D maxfCx .vi /g; (1.25)

i
for the maximal value of Cx .vi / that can be found in the network and Cxmax for the
maximal value possible for a network with N nodes,
X
N
Cxmax D max Cx .vm / Cx .vi /: (1.26)
G2G.N /
i D1
Degree Centrality
For the degree centrality of a network one obtains

PN
i D1 Cd .v / Cd .vi /
m
Cd D : (1.27)
N 3N C 2
2
Intuitively, the denominator is obtained by remembering that the maximal degree of

a node is N 1, hence, Cx .vm / Cx .vi / D N 2 because the minimal degree is
one. This number multiplied by N 1 (one node needs to have degree one) gives
the denominator in (1.27).
Betweenness Centrality
For the betweenness centrality of a network [58] one obtains

PN
i D1 Cd .v / Cd .vi /
m
Cb D : (1.28)
N 4N C 5N 2
3 2
Closeness Centrality
For the closeness centrality of a network one obtains
2N 3 X N
Cc D Cd .vm / Cd .vi /: (1.29)
N 3 4N 2 C 5N 2
i D1
Extended Centrality Measures
In addition to the classical centrality measures described above there are many
extensions. Here we present some of these.
Eigenvector Centrality
The eigenvector centrality, a point centrality measure, was introduced by

Bonacich [15]. The key idea of eigenvector centrality is to express that an important
vertex is connected to important neighbors. To define the eigenvector centrality
measures one needs to find the eigenvector of the adjacency matrix A of graph G
with the largest eigenvalue. Then eigenvector centrality is given by
1
Ce D x m D Ax m : (1.30)
m
Here m is the largest eigenvalue and x m the corresponding eigenvector solving the
equation
m x m D Ax m : (1.31)
Hence Ce is the principle eigenvector of A.

We want to emphasize that eigenvector centrality is a point centrality measure
because each vertex in the network obtains a value corresponding to the component
of Ce . In [83], advanced properties and further possibilities to compute eigenvector
centrality measures are presented.
Joint Betweenness Centrality
The centrality measures discussed above, including betweenness, form a family of

measures [58] that have been introduced with the purpose of analyzing communica-
tion networks. It is interesting to note that all point centrality measures focus solely
on one vertex in the network. In the context of gene networks, which also form
communication networks, the identification of a function of genes is an outstand-
ing problem. It has been suggested to identify the unknown function of a gene by
associating it with the known function of another gene. Because all measures from
14 F. Emmert-Streib
the centrality family are point measures they cannot be used for such studies. For
this reason it has been suggested that an extension involving more than one node
be called joint betweenness (JB) [47]. JB is a natural extension of the betweenness
centrality evaluating the joint occurrence of two nodes on shortest communication
paths in the network. Formally, it is defined as
X vi ;vj .vm ; vn /

Cjb .vm ; vn / D : (1.32)
vi ;vj
vi ;vj 2V;vi ¤vj
Here vi ;vj is the number of shortest paths connecting node vi with node vj and
vi ;vj .vm ; vn / is the number of shortest paths connecting vi with vj that contain the
nodes vm and vn . Similar to other measures of the centrality family, it is sometimes
more useful to use a different normalization. In fact, for the analysis conducted in
[47] the following modification has been used,
X vi ;vj .vm ; vn /

Cjb .vm ; vn / D : (1.33)
max
vi ;vj 2V;vi ¤vj
Here max is defined as
max D maxfvi ;vj g: (1.34)

vi ;vj
1.3.5 Comparative Network Analysis
In this section measures structurally comparing whole networks are reviewed.
Measures Based on Isomorphic Relations
Classical graph similarity or distance methods deal with finding appropriate mea-
sures which are based on isomorphic and subgraph relations [75–77, 108, 109, 117].
A prominent example of such a measure is the Zelinka-distance [117], where this
graph distance is based on the principle that two graphs are more similar, the bigger
the common induced isomorphic subgraph is. First, Zelinka introduced this mea-
sure for unlabeled graphs with the same number of vertices. Later, Sobik [108, 109]
and Kaden [75–77] generalized this measure for arbitrary graphs allowing them
to have even different order. It is known that the subgraph isomorphism problem
is NP-complete [113]. This implies for large graphs that these methods can be
computationally demanding. A key result for exact graph matching was found by
Zelinka [117].
Theorem 1. Let G, GQ be unlabeled graphs without loops and multiple edges.

Further, let jV j D jVQ j D n: S UB m .G/ denotes the set of induced subgraphs of
order m. G ? denotes the isomorphism classes of such graphs in which G lies and let
SUBm .G/ WD fG ? j G 2 S UB m .G/g: (1.35)
SUBm .G/ is just the set of isomorphism classes in which the induced subgraphs of
G with order m lie. Then,
Q WD n SIM.G; G/;
dZ .G; G/ Q (1.36)
is a graph metric, where
SIM.G; G/ Q 6D ;g;
Q WD maxfmjSUBm .G/ \ SUBm .G/ (1.37)
holds.
Sobik [108,109] and Kaden [75–77] generalized this theorem by considering labeled
graphs with a different number of vertices.
Theorem 2. Let G WD .V; E; fV ; fE ; AV ; AE / be a finite, labeled, and di-

rected graph. AV ; AE denote finite, nonempty vertex and edge alphabets and
fV W V ! AV , fE W E ! AE the associated vertex and edge labeling functions.
Now, let G and GQ be finite labeled graphs of arbitrary orders. Then,
Q WD max fjGj; jGjg

dS .G; G/ Q SIM.G; G/;
Q (1.38)
is a graph metric.
Another classical graph distance measure based on the maximum common sub-
graph of two graphs has been found by Bunke et al. [25, 26, 28].
Theorem 3. Let G and GQ be graphs and let GMCS be their maximum common sub-
graph. Then, the distance measure
Q WD 1 jV jMCS
dMCS .G; G/ ; (1.39)
max.jV j; jVQ j/
is a graph metric.
Measures Based on Graph Transformations
In contrast to graph similarity measures from the exact graph matching paradigm,
i.e., those based on isomorphic relations, a well-known class of graph similarity
measures from inexact graph matching is based on graph transformations. The main
idea behind this concept is not to match graphs exactly because one often wants to
16 F. Emmert-Streib
take structural errors of the underlying graphs into account. Therefore, this concept
is often referred to as error-tolerant graph matching [25, 26, 28, 91]. For example,
the so-called graph edit distance (GED) [24, 27, 28, 91] is a prominent example
of such a graph similarity measure. The definition of GED is based on weighted
transformation steps, e.g., deletions, substitutions, and insertions of vertices and
edges, and, hence, the distance of two graphs is defined as the minimum cost of
graph transformations that transform (map) one graph into another graph. The key
result of error-tolerant graph matching, originally stated by Bunke [24], can be ex-
pressed as follows.
Theorem 4. Let d.G; G/ Q be the costs for determining the optimal inexact match
between G and GQ where an optimal inexact match is a sequence of graph transfor-
mations that transforms a graph G to GQ by producing minimal edit costs. Then, it
Q is a graph metric.
holds that d.G; G/
Regarding the computational complexity of GED, we want to remark that for un-
labeled graphs there is no algorithm to compute GED efficiently [28, 91, 118]. For
uniquely labeled graphs, it has been proven [43] that the computational complexity
to compute GED is O.jV j2 /.
Measures Based on Graph Grammars
Methods to determine the similarity or distance between graphs based on graph

grammars also belong to the paradigm of inexact graph matching. A classical con-
tribution in this field has been made by Gernert [63, 64]. We want to note that the
application of grammar-based measures is complex because the underlying graph
grammar is quite often difficult to obtain.
Methods Based on Machine Learning Techniques
Machine learning techniques can be divided into two major categories: supervised
and unsupervised learning methods [38,72]. A newly developed supervised learning
method, based on support vector machines [38], to measure the structural similar-
ity of graphs is based on using so-called graph kernels [62, 73]. A graph kernel is
a function K W G G ! IR, for G 2 G, that maps the data implicitly into a
high-dimensional feature space. For example, some graph kernels are based on the
principle to determine the frequency of certain subgraph patterns of the given graph
set and then to apply a proper kernel function to the obtained subgraphs. Following
this principle Horváth et al. [73] proposed a graph kernel that is based on map-
ping graphs into cyclic graph patterns. Besides cycle-based graph kernels, so-called
random-walk-based kernels [62,80] are also often used to define graph kernels [36].
Another method to detect the structural similarity of graphs is based on dynamic
programming [7]. In the following we just give an outline of the main construction
steps of this similarity measuring for directed generalized trees (the generalization
to networks can be found in [49]).
1. Transform the generalized trees in linear structures, called property strings
2. Derive similarity scores from the alignments of the property strings in order to
measure the structural similarity of generalized trees
This means that we transform a graph similarity problem into a string similarity
problem to develop an efficient graph similarity measure. More precisely, the main
idea of our similarity measure is based on the derivation of property strings for each
generalized tree and then to align the property strings by a dynamic programming
technique [7]. We call these strings property strings because their components rep-
resent structural properties of the generalized trees. From the resulting alignment we
obtain a value of the scoring function which is minimized during the alignment pro-
cess. The similarity of two generalized trees is then given as the cumulation of local
similarity functions which weight two alignment types: out-degree and in-degree
alignments on a generalized tree level. Let HO 1 and HO 2 be generalized trees. Then
the problem of determining the structural similarity between HO 1 and HO 2 is equiva-
lent to finding the optimal alignment of the property strings. The key result is given
in the following theorem by Dehmer [39].
Theorem 5. Let HO 1 ; HO 2 be generalized trees, 0 i ; WD max.h1 ; h2 /:
P
i fin .i /
d1 .HO 1 ; HO 2 / WD i D0
P ; (1.40)
i D0 i
P
fin .i /
d2 .HO 1 ; HO 2 / WD i D0
; (1.41)
C1
Q fin
i D0 .i /
d3 .HO l 1; HO 2 / WD ; (1.42)
d2 .HO 1 ; HO 2 /
is a family .di .HO 1 ; HO 2 //1i 3 of backward similarity measures, where f i n .i /

is the weighted sum of the in- and out-degree alignments. Further it holds that
.di .HO 1 ; HO 2 //1i 3 2 Œ0; 1.
Here di .HO 1 ; HO 2 / are different similarity measures that allow us to emphasize dif-
ferent structural aspects of the networks. We just note that this method can be
generalized to labeled generalized trees [39] and even networks [49].
1.3.6 Community or Module Detection
A community or a module of a network corresponds to a subgraph. Examples of

modules are social groups [65, 116], pathways in molecular biological processes
[46], or domains in proteins [53]. In the following we present results based on
18 F. Emmert-Streib
Newman and Girvan [97] who introduced not only a measure (Q) to quantify
modules in a network but also suggested an algorithm to find them.
Let A be the adjacency matrix of network G and
(
1 if i is directly connected to j
Aij D (1.43)
0 otherwise:
We suppose that the set of vertices is partitioned in S communities and that vertex
i belongs to community ck if ı.ck ; i / D 1, with ı.i; j / being the Kronecker delta
which is one if i D j and zero otherwise. The degree of a node is given by
X
ki D Aij : (1.44)
j
The modularity Q, introduced by Newman and Girvan [97], of a network is now

defined by

1 X ki kj
QD Aij ı.ci ; cj / : (1.45)
2E 2E
i;j
Q evaluates the difference between the fraction of edges found within communities
minus the fraction of edges found by random connections (see also (1.49)). The
modularity (1.45) can be written in an alternative form by introducing
1 X
eij D Amn ı.cm ; i /ı.cn ; j / (1.46)
2E mn
1 X
ai D km ı.cm ; i /: (1.47)
2E m
Equation (1.46) corresponds to the fraction of edges that connect community i with
community j . For an undirected network G, eij D eji holds. Equation (1.47) is the
fraction of edges that is connected to nodes in community i . Utilizing (1.46) and
(1.47) and
X
ı.cm ; cn / D ı.cm ; i /ı.cn ; i /; (1.48)
i
gives
X
QD eii ai2 : (1.49)
i
P
Because ai D j eij (eii counts the connections within community i ) [97] we can
also write
X X
QD eii emi ein D Tr e jje2 jj: (1.50)
i imn
Here the norm corresponds to the sum of the matrix elements.

For a given network G the task of finding communities or modules corresponds

to finding a partitioning of the set of vertices of the network that maximizes the
modularity Q. Exhaustive enumeration is prohibitive for most networks because
the number of partitions N nodes can be distributed among M nonempty commu-
M
nities is given by the Stirling number of the second kind SN [97]. For example, for
N D 100 and M D 3 there are already S1;000 D 8:5 10 possibilities to partition
20 46
the network.
Because testing all partitions exhaustively is not possible we need to find the
communities via an optimization algorithm. It is clear that there are various ways
to define optimization algorithms for this task. In this chapter we present just one
simple algorithm suggested by Newman and Girvan [97] that can be applied even
for large networks consisting of tens of thousands of nodes. This algorithm performs
a greedy optimization at each step and is shown in Algorithm 1.2. Starting from
a configuration where each node forms a community the algorithm proceeds by
merging at each step two communities that result in the largest change of Q.
Because Q can also be negative this results not only in an increase of Qt C1 . The
optimal partition is now obtained by finding the maximum of all Qt . This also gives
the level at which the dendrogram should be cut. This cut will then give the optimal
partitions of the vertices of the network. The advantage of the algorithm is that it is
not necessary to calculate Qt C1 anew at each step. It is possible to calculate Q
instead by
Q D 2.emn am an /: (1.51)
Equation (1.51) can be obtained by the identities
eii0 D emn C enn C emn C enm (1.52)
ai0 D am C an : (1.53)
1: t D0
2: Start with M D N communities fc1 ; : : : ; cN g (each node is a community)
3: Calculate Q
4: Qt D Q
5: repeat
6: Calculate Q.ci ; cj / for all communities
7: Merge community cm with cn if Q.cm ; cn / D maxi;j fQ.ci ; cj /g
8: QtC1 D Qt C Q
9: t Dt C1
10: M DN t
11: until M D 1
12: Q D maxt Qt
Algorithm 1.2: Agglomerative clustering of communities [97]
20 F. Emmert-Streib
We use the prime (0 ) as an abbreviation for the values of e at step t C 1 and i

symbolizes the newly formed community merging communities m and n. The
update of the new e0 matrix is completed by
eik0 D emk C enk (1.54)
eki0 D eik ; (1.55)
for k 6D i . We want to emphasize that Q can be calculated by just evaluating

(1.52) and (1.53). The new complete matrix e0 will only be calculated once after the
decision to merge community m with n has been made. The overall time complexity
of this algorithm is O.N 2 / [97] and, hence, applicable to large networks.
Finding communities or modules in complex networks has attracted much atten-
tion because of the importance of the problem for many scientific fields. For this
reason the algorithm presented above is just one approach to this problem. The
interested reader is referred to [33, 45, 97, 98] for more algorithms.
1.4 Information-Theoretic Methods
In many scientific areas, e.g., biology, chemistry, linguistics, and physics, it is

known that the underlying system can be described or represented as an interaction
network among its components [12, 89]. Such networks, e.g., protein–protein,
signaling, reaction, or metabolic networks, have been intensely investigated, espe-
cially in computer science, computational biology, and computational chemistry
[12, 35, 46, 61, 111]. Once a network is theoretically or experimentally inferred,
existing methods from quantitative network analysis are basically applicable for
investigating such networks structurally as described in the proceeding sections.
A different approach to analyzing complex networks can be obtained by com-
bining methods from information theory and statistics. Particularly, it turns out that
information-theoretic methods, e.g., entropy-based methods, are powerful tools to
investigate complex networks [9, 12, 34, 84, 85, 105, 110]. Here we give just a brief
summary of information-theoretic and statistical methods to analyze or compare
networks:
Classical information measures, e.g., entropy, conditional entropy, and mutual

information applied to complex networks [8, 9, 11–14, 60, 79, 105, 110]
Entropic measures for characterizing graph classes, e.g., perfect graphs [82, 106]
Compression-based module identification [102]
Information-theoretic measures to determine the structural information content
of a network [9, 40, 41, 92–95, 100, 112]
Complexity measures for networks based on Kolmogorov complexity [10,11,87]
Information-theoretic measures of robustness of complex (gene) networks
[48, 52]
If we assume that N denotes the number of vertices of a graph G, n denotes the

number of different (obtained) sets of vertices, jNi j is the number of elements in
the i th set of vertices, and we set Pi D NNi , then Shannon’s entropy formula can be
stated as [11]
Xn
It .G/ D N log.N / Ni log.Ni /; (1.56)
i D1
or
X
n
Im .G/ D Pi log.Pi /: (1.57)
i D1
Equation (1.56) represents the total information and (1.57) the mean information
content of G. From (1.56) and (1.57) we see that there are no free parameters be-
cause the quantities Pi are completely determined by the chosen partitioning [41].
This can be a problem if such an entropy measure should be used to analyze net-
works obtained, e.g., from an experiment for which expert knowledge is available
regarding possible outcomes. For this reason, Dehmer [40, 41] introduces a para-
metric entropy measure
!
X
N
f V .vi / f V .vi /
If V .G/ WD PN log PN ; (1.58)
i D1 j D1 f V .vj / j D1 f V .vj /
where
f V .vi / WD ˛ c1 jS1 .vi ;G/jCc2 jS2 .vi ;G/jCCc.G/jS.G/ .vi ;G/j ;

ck > 0; 1 k .G/; ˛ > 0: (1.59)
Here, jSj .vi ; G/j denotes the cardinality of a j -sphere (see Sect. 1.3.3) of vi
regarding an undirected and connected graph G. f V .vi / represents a so-called
information functional that is based on metrical graph properties (see [107] for
details). Equation (1.58) represents a family of parametric entropy measures. We
generalized the classical entropy measure [41], i.e., (1.56) and (1.57), because the
new measure allows us to weight structural characteristics of a graph by adapting
the free parameters ˛ and ck correspondingly. As a corollary we note that it is now
possible to analyze the spread of information within a network.
1.5 Conclusions
We finish this chapter by pointing out that there are many more approaches for the
analysis of complex networks. Depending on the point of view, especially in the
context of machine learning problems, only some methods give meaningful results
with respect to certain applications. For this reason it is of the utmost importance to
22 F. Emmert-Streib
demonstrate that a chosen approach is appropriate to solve a task by application to a

test dataset for which the performance can be evaluated objectively. That means, it is
important to bear in mind that the characteristics of the investigated networks have
a profound impact on the obtained results. Due to the fact that it is often difficult
or even impossible to imagine all possibilities of network characteristics to properly
take them into account when deriving a method, such an application is not of mere
practical interest but also provides valuable feedback for the design of methods be-
cause the analysis of the data relentlessly reveals shortcomings of the method itself.
Hence, the design and application of such methods are connected imperatively. For
this reason it is no surprise that fields like computational biology, web mining, com-
putational linguistics, quantitative finance, or sociology have triggered a wealth of
novel methods for the analysis of complex networks, some of them presented in this
chapter, that possibly would otherwise not have been invented. We are excited to
see the developments over the next years and expect an ever-increasing interest in
complex networks and their analysis due to their omnipresence in the real world.
Acknowledgments I would like to thank Matthias Dehmer for fruitful discussions.
References
1. Adamic L, Huberman B (2000) Power-law distribution of the world wide web. Science
287:2115
2. Albert R, Barabasi AL (2002) Statistical mechanics of complex networks. Rev Mod Phys
74:47
3. Bakir GH, Hofmann T, Schölkopf B, Smola AJ, Taskar B, Vishwanathan SVN (eds) (2007)
Predicting structured data. MIT Press, Cambridge, MA
4. Barabasi AL, Albert R (1999) Emergence of scaling in random networks. Science 206:
509–512
5. Bavelas A (1948) A mathematical model for group structure. Hum Organ 7:16–30
6. Bavelas A (1950) Communication patterns in task-oriented groups. J Acoust Soc Am 22:
725–730
7. Bellman R (1957) Dynamic programming. International Series. Princeton University Press,
Princeton, NJ
8. Bonchev D (1979) Information indices for atoms and molecules. Match 7:65–113
9. Bonchev D (1983) Information theoretic indices for characterization of chemical structures.
Research Studies Press, Chichester
10. Bonchev D (1995) Kolmogorov’s information, shannon’s entropy, and topological complexity
of molecules. Bulg Chem Commun 28:567–582
11. Bonchev D (2003) Complexity in chemistry. Introduction and fundamentals. Taylor &
Francis, London (Philadelphia, PA)
12. Bonchev D, Rouvray DH (2005) Complexity in chemistry, biology, and ecology. Mathemat-
ical and computational chemistry. Springer, Berlin
13. Bonchev D, Trinajstić N (1977) Information theory, distance matrix and molecular branching.
J Chem Phys 67:4517–4533
14. Bonchev D, Balaban AT, Mekenyan OG (1980) Generalization of the graph center concept,
and derived topological centric indexes. J Chem Inf Comput Sci 20(2):106–113
15. Bonacich P (1972) Factoring and weighting approaches to status scores and clique
identification. J Math Sociol 2:113–120
16. Bornholdt S, Schuster HG (2003) Handbook of graphs and networks: from the genome to the
internet. Wiley, New York, NY
17. Bornholdt S, Schuster HG (eds) (2003) Handbook of graphs and networks: from the genome
to the internet. Wiley, New York, NY
18. Brandes U (2001) A faster algorithm for betweenness centrality. J Math Sociol 25(2):163–177
19. Brandes U, Erlebach T (2005) Network analysis. Lecture notes in computer science. Springer,
Berlin
20. Brandstädt A, Le VB, Sprinrand JP (1999) Graph classes. A survey. SIAM Monographs on
Discrete Mathematics and Applications
21. Brinkmeier M, Schank T (2005) Network statistics. In Brandes U, Erlebach T (eds) Network
analysis. Lecture notes in computer science. Springer, Berlin, pp 293–317
22. Broder A, Kumar R, Maghoul F, Raghavan P, Rajagopalan S, Stata R, Tomkins A, Wiener J
(2000) Graph structure in the web: experiments and models. In: Proceedings of the 9th WWW
conference, Amsterdam
23. Buckley F, Harary F (1990) Distance in graphs. Addison-Wesley, Reading, MA
24. Bunke H (1983) What is the distance between graphs? Bull EATCS 20:35–39
25. Bunke H (1997) On a relation between graph edit distance and maximum common subgraph.
Pattern Recognit Lett 18(9):689–694
26. Bunke H (1998) A graph distance metric based on the maximum common subgraph. Pattern
Recognit Lett 19(3):255–259
27. Bunke H, Allermann G (1983) A metric on graphs for structural pattern recognition. In:
Schussler HW (ed) Proceedings of 2nd European signal processing conference EUSIPCO,
pp 257–260
28. Bunke H, Neuhaus M (2007) Graph matching. Exact and error-tolerant methods and the
automatic learning of edit costs. In: Cook D, Holder LB (eds) Mining graph data. Wiley,
New York, NY, pp 17–32
29. Carrière SJ, Kazman R (1997) Webquery: searching and visualizing the web through connec-
tivity. Computer Networks and ISDN Systems 29(8–13):1257–1267
30. Cayley A (1857) On the theory of analytic forms called trees. Philos Mag 13:19–30
31. Cayley A (1875) On the analytical forms called trees, with application to the theory of
chemical combinatorics. Report of the British Association for the Advancement of Science,
pp 257–305
32. Chowdhury D, Stauffer D (2000) Principles of equilibrium statistical mechanics. Wiley-VCH,
Weinheim
33. Clauset A, Newman MEJ, Moore C (2004) Finding community structure in very large net-
works. Phys Rev E 70:066111
34. Claussen JC (2007) Characterization of networks by the offdiagonal complexity. Physica A
365–373:321–354
35. Claussen JC (2007) Offdiagonal complexity: a computationally quick network complexity
measure – application to protein networks and cell division. In: Deutsch A, Bravo de la Parra
R et al (eds) Mathematical modeling of biological systems, vol II. Birkhäuser, Boston, MA,
pp 303–311
36. Cook D, Holder LB (2007) Mining graph data. Wiley, New York, NY
37. Cormen T, Leiserson CE, Rivest RL, Leiserson C, Rivest R (2001) Introduction to algorithms.
MIT Press, Cambridge, MA
38. Cristianini N, Shawe-Taylor J (2000) An introduction to support vector machines. Cambridge
University Press, Cambridge
39. Dehmer M (2006) Strukturelle Analyse web-basierter Dokumente. Multimedia und Teleko-
operation. Deutscher Universitäts Verlag, Wiesbaden
40. Dehmer M (2008) A novel method for measuring the structural information content of net-
works. Cybern Syst 39:825–842
41. Dehmer M, Emmert-Streib F (2008) Structural information content of chemical networks.
Zeitschrift für Naturforschung, Part A 63a:155–159
42. Deo N, Gupta P (2001) World wide web: a graph-theoretic perspective. Technical report,
Department of Computer Science, University of Central Florida
24 F. Emmert-Streib
43. Dickinson PJ, Bunke H, Dadej A, Kraetzl M (2004) Matching graphs with unique node labels.
Pattern Anal Appl 7:243–266
44. Diestel R (2000) Graph theory. Springer, Berlin
45. Duch J, Arenas A (2005) Community detection in complex networks using extremal opti-
mization. Phys Rev E, 72:027104
46. Emmert-Streib F (2007) The chronic fatigue syndrome: a comparative pathway analysis.
J Comput Biol 14(7):961–972
47. Emmert-Streib F, Chen L, Storey J (2007) Functional annotation of genes in Saccharomyces
cerevisiae based on joint betweenness. arXiv:0709.3291
48. Emmert-Streib F, Dehmer M (2007) Global information processing in gene networks: fault
tolerance. In: Proceedings of the bio-inspired models of network, information, and computing
systems, Bionetics 2007, art. no. 4610138, pp 326–329
49. Emmert-Streib F, Dehmer M, Kilian J (2005) Classification of large graphs by a local tree
decomposition. In: Arabnia HR, Scime A (eds) Proceedings of DMIN’05, international con-
ference on data mining, Las Vegas, June 20–23, pp 200–207
50. Emmert-Streib F, Dehmer M (2007) Topolocial mappings between graphs, trees and general-
ized trees. Appl Math Comput 186(2):1326–1333
51. Emmert-Streib F, Dehmer M (eds) (2008) Analysis of microarray data: a network based
approach. Wiley-VCH, Weinheim
52. Emmert-Streib F, Dehmer M (2005) Robustness in scale-free networks: comparing directed
and undirected networks. Int J Mod Phys C 19(5):717–726
53. Emmert-Streib F, Mushegian A (2007) A topological algorithm for identification of structural
domains of proteins. BMC Bioinformatics 8:237
54. Erdös P, Rényi A (1959) On random graphs. Publicationes Mathematicae 6:290–297
55. Erdös P, Rényi A (1960) On the evolution of random graphs. Publications of Mathematical
Institute of the Hungarian Academy of Sciences 5:17–61
56. Euler L (1736) Solutio problematis ad geometriam situs pertinentis. Comentarii Academiae
Scientiarum Imperialis Petropolitanae 8:128–140
57. Even S (1979) Algorithms. Computer Science Press, Potomac, MD
58. Freeman LC (1977) A set of measures of centrality based on betweenness. Sociometry 40:
35–41
59. Freeman LC (1979) Centrality in social networks: conceptual clarification. Soc Networks
1:215–239
60. Fujii JI, Yuki S (1997) Entropy and coding for graphs. Int J Math Stat Sci 6(1):63–77
61. Gagneur J, Krause R, Bouwmeester T, Casari G (2004) Modular decomposition of protein–
protein interaction networks. Genome Biol 5:R57
62. Gärtner T, Flach PA, Wrobel S (2003) On graph kernels: hardness results and efficient alter-
natives. In: COLT, pp 129–143
63. Gernert D (1979) Measuring the similarity of complex structures by means of graph gram-
mars. Bull EATCS 7:3–9
64. Gernert D (1981) Graph grammars which generate graphs with specified properties. Bull
EATCS 13:13–20
65. Gleiser PM, Danon L (2003) Community structure in jazz. Advances in complex systems
6(4):565–574
66. Hage P, Harary F (1995) Eccentricity and centrality in networks. Soc Networks 17:57–63
67. Halin R (1989) Graphentheorie. Akademie Verlag, Berlin
68. Harary F (1959) Status and contrastatus. Sociometry 22:23–43
69. Harary F (1965) Structural models. An introduction to the theory of directed graphs.
Wiley, NY
70. Harary F (1967) Graph theory and theoretical physics. Academic, New York, NY
71. Harary F (1969) Graph theory. Addison-Wesley, Reading, MA
72. Hastie T, Tibshirani R, Friedman JH (2001) The elements of statistical learning. Springer,
Berlin
73. Horváth T, Gärtner T, Wrobel S (2004) Cyclic pattern kernels for predictive graph mining.
In: Proceedings of the 2004 ACM SIGKDD international conference on knowledge discovery
and data mining, pp 158–167
74. Hsu H-P, Mehra V, Grassberger P (2003) Structure optimization in an off-lattice protein
model. Phys Rev E 68(3):037703
75. Kaden F (1982) Graphmetriken und Distanzgraphen. ZKI-Informationen, Akademie der
Wissenschaften DDR 2(82):1–63
76. Kaden F (1983) Halbgeordnete Graphmengen und Graphmetriken. In: Proceedings of the
conference graphs, hypergraphs, and applications DDR, pp 92–95
77. Kaden F (1986) Graphmetriken und Isometrieprobleme zugehöriger Distanzgraphen.
ZKI-Informationen, Akademie der Wissenschaften DDR, pp 1–100
78. Kauffman SA (1969) Metabolic stability and epigenesis in randomly constructed genetic nets.
J Theor Biol 22:437–467
79. Kieffer J, Yang E (1997) Ergodic behavior of graph entropy. Electronic Research Announce-
ments of the American Mathematical Society 3:11–16
80. Kondor RI, Lafferty J (2002) Diffusion kernels on graphs and other discrete input spaces. In:
Machine learning: Proceedings of the 19th international conference, Morgan Kaufmann, San
Mateo, CA
81. König D (1936) Theorie der endlichen und unendlichen Graphen. Chelsea, New York, NY
82. Körner J (1973) Coding of an information source having ambiguous alphabet and the entropy
of graphs. Transactions of the 6th Prague conference on information theory, pp 411–425
83. Koschützki D, Lehmann KA, Peters L, Richter S, Tenfelde-Podehl D, Zlotkowski O (2005)
Clustering. In: Brandes U, Erlebach T (eds) Centrality indices. Lecture notes in computer
science. Springer, Berlin, pp 16–61
84. Kullback S (1959) Information theory and statistics. Wiley, New York, NY
85. Kullback S, Leibler RA (1951) On information and sufficiency. Ann Math Stat 22(1):79–86
86. Laubenbacher RC (2007) Modeling and simulation of biological networks. In: Proceedings
of symposia in applied mathematics. American Mathematical Society, Providence, RI
87. Li M, Vitányi P (1997) An introduction to Kolmogorov complexity and its applications.
Springer, Berlin
88. Mason O, Verwoerd M (2007) Graph theory and networks in biology. IET Syst Biol 1(2):
89–119
89. Mehler A (2006) In search of a bridge between network analysis in computational linguistics
and computational biology – a conceptual note. In: Proceedings of the 2006 international
conference on bioinformatics & computational biology (BIOCOMP’06), 2006, Las Vegas,
Nevada, USA, pp 496–500
90. Mehler A, Dehmer M, Gleim R (2005) Towards logical hypertext structure. a graph-theoretic
perspective. In: Proceedings of I2CS’04. Lecture notes. Springer, Berlin, pp 136–150
91. Messmer BT, Bunke H (1998) A new algorithm for error-tolerant subgraph isomorphism
detection. IEEE Trans Pattern Anal Mach Intell 20(5):493–504
92. Mowshowitz A (1968) Entropy and the complexity of the graphs I: an index of the relative
complexity of a graph. Bull Math Biophys 30:175–204
93. Mowshowitz A (1968) Entropy and the complexity of graphs II: the information content of
digraphs and infinite graphs. Bull Math Biophys 30:225–240
94. Mowshowitz A (1968) Entropy and the complexity of graphs III: graphs with prescribed
information content. Bull Math Biophys 30:387–414
95. Mowshowitz A (1968) Entropy and the complexity of graphs IV: entropy measures and
graphical structure. Bull Math Biophys 30:533–546
96. Newman MEJ (2003) The structure and function of complex networks. SIAM Rev 45:
167–256
97. Newman MEJ, Girvan M (2004) Finding and evaluating community structures in networks.
Phys Rev E 69:026113
98. Newman MEJ (2006) Modularity and community structure in networks. Proc Natl Acad Sci
USA 103:8577–8582
26 F. Emmert-Streib
99. Pearl J (1998) Probabilistic reasoning in intelligent systems. Morgan Kaufmann,

Los Altos, CA
100. Rashewsky N (1955) Life, information theory, and topology. Bull Math Biophys 17:229–235
101. Roberts F (1989) Applications of combinatorics and graph theory to the biological and social
sciences series. IMA volumes in mathematics and its applications. Springer, Berlin
102. Rosvall M, Bergstrom CT (2007) An information-theoretic framework for resolving commu-
nity structure in complex networks. In: Proc Natl Acad Sci USA 104(18):7327–31
103. Sabidussi G (1966) The centrality index of a graph. Psychometrika 31:581–603
104. Scott F (2001) Social network analysis. Sage, Beverly Hills, CA
105. Shannon CE, Weaver W (1997) The mathematical theory of communication. University of
Illinois Press, Champaign, IL
106. Simonyi G (2001) Perfect graphs and graph entropy. An updated survey. In: Ramirez-Alfonsin
J, Reed B (eds) Perfect graphs. Wiley, New York, NY, pp 293–328
107. Skorobogatov VA, Dobrynin AA (1988) Metrical analysis of graphs. MATCH 23:105–155
108. Sobik F (1982) Graphmetriken und Klassifikation strukturierter Objekte. ZKI-Informationen,
Akademie der Wissenschaften DDR 2(82):63–122
109. Sobik F (1986) Modellierung von Vergleichsprozessen auf der Grundlage von
Ähnlichkeitsmaßen für Graphen. ZKI-Informationen, Akademie der Wissenschaften
DDR 4:104–144
110. Solé RV, Valverde S (2004) Information theory of complex networks: on evolution and archi-
tectural constraints. In: Lecture notes in physics, vol 650, pp 189–207
111. Temkin O, Zeigarnik AV, Bonchev D (1996) Chemical reaction networks. A graph-theoretical
approach. CRC Press, West Palm Beach, FL
112. Trucco E (1956) A note on the information content of graphs. Bull Math Biol 18(2):129–135
113. Ullmann JR (1976) An algorithm for subgraph isomorphism. J ACM 23(1):31–42
114. Wasserman S, Faust K (1994) Social network analysis: methods and applications. Structural
analysis in the social sciences. Cambridge University Press, Cambridge
115. Watts DJ, Strogatz SH (1998) Collective dynamics of ‘small-world’ networks. Nature 393:
440–442
116. Zachary W (1977) An information flow model for conflict and fission in small groups.
J Anthropol Res 33:452–473
117. Zelinka B (1975) On a certain distance between isomorphism classes of graphs. Časopis pro
p̆est. Mathematiky 100:371–373
118. Zhang K, Statman R, Shasha D (1992) On the editing distance between unordered labeled
trees. Inform Process Lett 42(3):133–139
Chapter 2
Partitions of Graphs
Mieczysław Borowiecki
Abstract Many difficult optimization problems on graphs become tractable when

restricted to some classes of graphs, usually to hereditary classes. A large part of
these problems can be expressed in the vertex partitioning formalism, i.e., by par-
titioning of the vertex set of a given graph into subsets V1 ; : : : ;Vk called colour
classes, satisfying certain constraints either internally or externally, or both in-
ternally and externally. These requirements may be conveniently captured by the
symmetric k-by-k matrix M . Concepts which are modeled by M -partitions fall
naturally into the three types; each is represented in this work by some problem.
Any minimal reducible bound for a hereditary property is in some sense the best
possible partition. A number of such partitions are given.
Clustering is a central optimization problem (among many others) with applica-
tions in various disciplines, e.g., computational biology, communications networks,
image processing, pattern analysis [41, 53, 57, 60], and numerous other fields. Some
new results on k-clustering of graphs are proved.
Another type of M -partition is a matching cutset. The main known results on
this subject are collected.
The last part of this work is devoted to acyclic partitions of graphs where we
consider important classes of graphs and their acyclic reducible bounds.
For each partition type the complexity of considered problems is given. Also a
number of open problems are presented.
Keywords Colourings Partitions Hereditary properties k-clustering

Domination Cut matching Complexity
MSC2000: Primary 05C15, 05C70; Secondary 05C12, 05C69, 05C85, 05C90
M. Borowiecki ()
Faculty of Mathematics, Computer Science and Econometrics,
University of Zielona Góra, Podgórna 50, 65-246 Zielona Góra, Poland

28 M. Borowiecki
2.1 Introduction and Notation
We present some of the basic definitions, notation, and terminology used in this
chapter. Other terminology will be introduced as it naturally occurs in the text and
those concepts not defined can be found in [4, 30, 59].
We consider finite undirected graphs without loops or multiple edges. The vertex
set and the edge set of graph G are denoted by V .G/ and E.G/, respectively, and I
is used to denote the class of these graphs.
Many difficult (NP-hard) optimization problems on graphs become tractable
when restricted to some classes of graphs, usually to hereditary classes. A large
part of these problems can be expressed in the vertex partitioning formalism, i.e.,
by partitioning of the vertices of a given graph into subsets V1 ; : : : ; Vk called colour
classes, satisfying certain constraints either internally or externally, or both inter-
nally and externally. These requirements may be conveniently captured by the sym-
metric k-by-k matrix M in which the diagonal entries mii D P i encode the internal
restrictions on the sets Vi and the off-diagonal entries mij D P ij .i ¤ j / encode the
restriction on the edges between Vi and Vj . Formally, it can be defined as follows.
Definition 2.1.1. Let M be a fixed symmetric k k matrix with entries mii D P i
and mij D P ij B for i ¤ j , where B is the class of all bipartite graphs.
An M -colouring (partition) of a graph G is a partition of vertices of G into k
subsets V1 ; : : : ; Vk corresponding to the rows (and columns) of the matrix M such
that the subgraph of G induced by Vi has the property P i for i D 1; : : : ; k. Vertices
of the set Vi are said to be i -coloured. For every two distinct colours i and j , the
subgraph induced by all the edges linking an i -coloured vertex and a j -coloured
vertex has the property P ij , 1 i; j k.
Notice that properties P ij always form some classes of bipartite graphs. A graph
G is bipartite if it admits a vertex partition V .G/ D V1 [ V2 such that every edge
of G joins two different Vi ’s.
Graph-theoretical concepts which are modeled by M -partitions fall naturally into
three types:
(T1) mii D P i ; mij D P ij D B .i ¤ j /; i; j D 1; : : : ; kI i.e., no restrictions
between colour classes.
(T2) mii D I; mij D P ij B .i ¤ j /; i; j D 1; : : : ; kI i.e., no internal
restrictions.
(T3) mii D P i ; mij D P ij B .i ¤ j /; i; j D 1; : : : ; k.
2.1.1 Examples of M -Partitions
A .P 1 ; : : : ; P k /-partition of G is defined as an M -partition of type (T1).

In the case when all P i D O, where O is the class of edgeless graphs, we have
a k-colouring of G. Thus a k-colouring of G is an M -partition of G, where the
matrix M has O on the main diagonal and B everywhere else.
2 Partitions of Graphs 29
The smallest k for which there is a k-colouring of G is called the chromatic

number of G and is denoted by .G/.
Karp [40] has shown that the k-colouring problem (k 3) is NP-complete for
graphs and up to this time no polynomial-time algorithm is known for this problem.
However, the k-colouring problem becomes much easier when we restrict the inputs
to special classes of graphs.
An M -partition of type (T1) of G is called k-clustering, if
mii D P D fG 2 I W diam.G/ kg:
Let .V1 ; V2 / be an M -partition of G. Denote by M the property of graphs for

which the edges between the set V1 and V2 induce a matching, i.e., any two of them
have no common endvertex.
An M -partition of G such that mii D I; m12 D m21 D M B is called a
matching cutset of G.
A path in G is an alternating sequence of distinct vertices and edges beginning
and ending with vertices in which each edge joins the vertex before it to the one
following it. The first and the least vertex of this sequence is called the endvertex
of the path. The path with n vertices is denoted by Pn . A cycle in G is a path with
at least three vertices together with an edge joining its endvertices. A cycle with n
vertices is denoted by Cn . The length of a path (cycle) is the number of edges in it.
A graph G is called acyclic if G does not contain a cycle. Let us denote by D1 the
class of all acyclic graphs.
An M -partition of a graph G such that mii D O and mij D D1 for i ¤ j ,
1 i; j k is called an acyclic colouring of G.
The minimum k such that G has an acyclic k-colouring is the acyclic chromatic
number of G, denoted by a .G/.
Similarly, for a class P of graphs, the acyclic chromatic number of P, denoted
by a .P/, is defined as the maximum a .G/ over all graphs G 2 P, assuming that
a .G/ is finite for all G 2 P.
2.1.2 Hereditary Properties
Two graphs G and H are isomorphic if there is a bijection f W V .G/ ! V .H / such

that uv 2 E.G/ if and only if f .u/f .v/ 2 E.H /.
A property of graphs is any nonempty class of graphs from I which is closed
under isomorphisms. We use the terms class of graphs and property of graphs inter-
changeably.
Graph H is a subgraph of graph G if V .H / V .G/ and E.H / E.G/ and is
denoted by H G. A subgraph H of G is induced if every pair of vertices in H
which are adjacent in G are also adjacent in H . This fact is denoted by H G.
30 M. Borowiecki
Definition 2.1.2. A property P of graphs is said to be induced hereditary (heredi-

tary, also called monotone) if whenever G 2 P and H G (H G), then also
H 2 P and additive if it is closed under disjoint union, i.e., if every component of
G has property P, then G 2 P.
Obviously any hereditary property is induced hereditary, too.

Following [11] we list some examples and notations of hereditary properties of
graphs.
O D fG 2 I W E.G/ D ;g;
Ok D fG 2 I W .G/ kg;
Sk D fG 2 I W the maximum degree .G/ kg;
Ok D fG 2 I W each component of G has order at most k C 1g;
Dk D fG 2 I W G is k-degenerate;
i.e., the minimum degree ı.H / k for each H Gg;
Tk D fG 2 I W G contains no subgraph homeomorphic to KkC2 or
Kb kC3 c;d kC3 e g;
2 2
Ik D fG 2 I W G does not contain KkC2 g:
Observe that:
O is the class of edgeless graphs,

Ok is the class of k-colourable graphs,
S k is the class of graphs with degree bounded by k,
D1 is the class of acyclic graphs,
T2 is the class of outerplanar graphs,
T3 is the class of planar graphs.
Additionally, let us denote by LF D D 1 \ S 2 , the class of linear forests.
A hereditary property P can be uniquely determined by the set of minimal for-

bidden subgraphs which can be defined as follows.
Definition 2.1.3. F .P/ D fG 2 I W G … P, but each proper subgraph H of G

belongs to Pg.
Let F be a family of graphs, Forb .F / is defined to be the property of all graphs

having no subgraph isomorphic to any graph from F . Thus P D Forb .F .P//:
In such a manner is defined, for example, the property I k D Forb .fKkC2 g/, also
called the class of KkC2 -free graphs.
Similarly, the set of minimal forbidden subgraphs F .P/ for an induced

hereditary property P is defined.
Let us denote by L the set of all hereditary and by L induced hereditary
properties of graphs, and let the corresponding sets of additive properties be denoted
by La and La , respectively. The sets L, La , L and La partially ordered by the set
inclusion, form complete distributive lattices with the set intersection as the meet
operation [17]. Obviously .L; / is a proper sublattice of .L ; /.
We now consider some examples of partitions of outerplanar and planar graphs.
In [21] it has been proved that each outerplanar graph has an .LF ; LF /-partition.
An algorithmic proof of that fact is given in [18]. Each outerplanar graph also has an
.O; D 1 /-partition. A natural question arises: does a property P LF exist such that
each outerplanar graph has a .P; LF /-partition? In other words: is the .LF ; LF /-
partition the best possible for the class of outerplanar graphs? An answer is given
later on.
It is well known [26] that every planar graph has vertex arboricity at most 3; i.e.,
it has a .D1 ; D 1 ; D1 /-partition.
Stein [55] (see also [8, 37]) strengthened this result by proving that every planar
graph can be vertex partitioned into two forests and one edgeless graph; i.e., an
planar graph has an .O; D1 ; D 1 /-partition.
Another strengthening was obtained by Poh [51] and independently by Goddard
[36]. They proved that every planar graph has an .LF ; LF ; LF /-partition.
2.1.3 Reducibility
To more precisely analyse different partitions and compare them, we need some new
notation.
A property R D P 1 ı P 2 ı ı P k is defined as the set of all graphs having
a .P 1 ; P 2 ; : : : ; P k /-partition. If P 1 D D P k D P, then we write P 1 ı
ı Pk D Pk.
It is easy to see that P1 ı ı Pk is (induced) hereditary and additive whenever
P 1 ; P 2 ; : : : ; P k are (induced) hereditary and additive, respectively.
An (induced) hereditary property R is said to be reducible if there exist two
(induced) hereditary properties P1 and P2 such that R D P1 ı P2 and irreducible,
otherwise.
Definition 2.1.4. (Mihók and Toft, see [39]) For a given irreducible property P 2 L,
a reducible property R 2 L is called a minimal reducible bound for P if P R and
for each reducible property R0 R; P 6 R0 .
We consider reducibility and minimal reducible bounds only in the lattice La . The
family of all minimal reducible bounds for P in this lattice is denoted by B.P/.
Example 1. The class O 2 of bipartite graphs is the smallest reducible property in

the lattice La .
32 M. Borowiecki
Obviously it is the unique minimal reducible bound for P if and only if P O 2 .

In general, finding the set of minimal reducible bounds for a given irreducible prop-
erty is a difficult problem. The existence of the set B.P/ for any property P is
proved in [5].
2.1.4 Examples of Some Reducible Bounds
From the previously mentioned results for outerplanar and planar graphs we can
write:
1. T 2 O ıD 1 ,
2. T 2 LF 2 ,
3. Four Colour Theorem implies: T 3 .O 2 \ T 3 /2 ,
4. [55]: T 3 O ıD 21 was improved by Thomassen [56]: T 3 D 1 ı.D2 \ T 3 /,
5. [36, 51]: T 3 LF 3 .
2.1.5 Minimal Reducible Bounds for Outerplanar

and Planar Graphs
Theorem 2.1.5 ([47]). B.T 2 / D fOıD1 ; LF ıLF g:

From this theorem it follows that for each reducible property R D P ıQ such that
T 2 R LF 2 there is an outerplanar graph G which is not .P; Q/-partitionable.
The same holds for O ı D 1 . In this sense, the bounds given above are best possible.
For a class of planar graphs the problem of minimal reducible bounds is much
harder. Until now any minimal reducible bound for T 3 is not known. In [12] a
few minimal reducible bounds for some interesting subclasses of planar graphs are
given.
Theorem 2.1.6 ([12]).
1. B.T 3 \ D2 / D fOıD1 g,
2. B.T 3 \ D3 / 3 D1 ıD 1 ,
3. B.T 3 \ O3 / 3 Oı.O2 \ T 3 /.
We are not able to find other minimal reducible bounds for 3-colourable planar
graphs. We can only show:
Theorem 2.1.7 ([12]). Barnette’s Conjecture, if true, gives a minimal reducible
bound D 21 for T 3 \ O3 .
Theorem 2.1.7 gives an unexpected relation to a well-known conjecture of
Barnette which says that whenever G is a 3-connected bipartite 3-regular planar
graph, then G has a Hamiltonian cycle. This conjecture is true if and only if each
3-colourable planar graph has a vertex partition into two subsets such that each of
them induces a forest.
2.1.6 Minimal Reducible Bounds for Some Other Classes

of Graphs
In [15] a subclass of planar graphs (slightly wider than the class of outerplanar
graphs) called 1-nonouterplanar was considered. For this class of graphs, in contrast
with the class of outerplanar graphs (see Theorem 2.1.5), there is an infinite number
of minimal reducible bounds.
Let us define a few properties:
UCi D fG 2 I W each component of G contains at most one cycle of length i and
no cycle of any other lengthg,
UCik D fG 2 UCi W if G contains a cycle (of length i), then the minimum degree
in G of the vertices of this cycle is at most k C 2g. S
rk D fG 2 I W each component of G belongs to UC3k [ i kC2 UC2i C1 g:
For convenience, let r1 D UC3 .
For a plane graph G let Int(G) denote the set of vertices not belonging to the
external face. If G is a connected planar graph, we define int(G) to be the minimum
value of jInt(G)j over all plane embeddings of G.
If G is a planar graph with r components H1 ; : : : ; Hr then we define
int.G/ D maxfint.Hi / W 1 i rg:
If int(G) k then G is said to be k-nonouterplanar and we denote this property

by N OPk , i.e., N OPk D fG 2 T3 : int(G) kg.
It easy to see that N OP0 D T2 and N OP1 D T3 .
Theorem 2.1.8 ([15]).
B.N OP1 / D fLF ı LF ; O1 ı D1 g [ fO ı rk W k D 0; 1; : : : ; 1g:
The minimal reducible bound for the class of triangle free graphs is trivial and it
follows from the theorem given by Nešetřil and Rődl.
Theorem 2.1.9 ([50]). Let F .P/ be a finite set of 2-connected graphs. Then for
every graph G of property P there is a graph H of property P such that for any
partition .V1 ; V2 / of V .H / there is an i; i D 1 or i D 2, for which the subgraph
H ŒVi contains G.
From this theorem we immediately have the following.
Corollary 2.1.10 ([48]). Let F .P/ be a finite set of 2-connected graphs. Then the
property P has exactly one minimal reducible bound. O ıP.
Corollary 2.1.10 implies that the class I k of KkC2 -free graphs has only one
trivial minimal reducible bound O ıI k .
For the class of graphs with a bounded order of components and the class of
k-degenerate graphs we have the following sets of minimal reducible bounds.
34 M. Borowiecki
Theorem 2.1.11 ([48]). For any positive integer k,
B.Ok / D fOp ıOq W p C q C 1 D kg;

B.Dk / D fDp ıDq W p C q C 1 D kg:
A k-tree is a graph defined inductively as follows. A clique of order k is a k-tree.

If G is a k-tree of order n, n k, and K is a clique of G of order k, then the graph
obtained from G by adding a new vertex and joining it by new edges to all vertices
of K is a k-tree of order n C 1. Any subgraph of a k-tree is a partial k-tree. Let us
denote the class of all partial k-trees by PTk . Obviously this class is hereditary.
Similar relations as above hold for the class of partial k-trees.
Theorem 2.1.12 ([52]). For any positive integer k,
B.PTk / D fPTp ıPTq W p C q C 1 D kg:
Partitions and minimal reducible bounds for minor hereditary properties were
considered in [19].
2.1.7 Complexity of Some Selected Graph Partition Problems
We begin with complexity of partition problems for the class of planar graphs.
Theorem 2.1.13. The following partition problems are NP-complete:

1. [38]: .O; D1 /-partition for planar graphs G with .G/ 4,
2. [38]: .D1 ; D 1 /-partition even for maximal planar graphs,
3. [35]: .O; O; O/-partition for planar graphs G with .G/ 4,
4. [38]: .O; O; D 1 /-partition for planar graphs in which each face has size 3 or 4.
Conjecture 2.1.14 ([38]). .O; O; D1 /-partition is NP-complete for maximal pla-

nar graphs.
Below are presented partition problems for some interesting classes of graphs.
General discussions on partitions with respect to hereditary or induced hereditary
properties can be found in [2, 33].
Theorem 2.1.15. The following partition problems for graphs (in general) are NP-
complete:
1. [35]: .O; O2 /-partition,

2. [35]: .O; D1 /-partition,
3. [46]: .O; S 1 /-partition,
4. [20]: .O; F orb .fC4 ; 2K2 ; C5 g//-partition,
5. [20]: .O; F orb .fP4 g//-partition,

6. [20]: .O; F orb .fP4 ; C4 g//-partition,
7. [20]: .O; I 1 /-partition.
2.2 k-Clustering
Another type of (T1) partition of graphs with properties P i ; i D 1; : : : ; k, which are

not hereditary is k-clustering. Clustering is a central optimization problem (among
many others) with applications in various disciplines, e.g., computational biology,
communications networks, image processing, pattern analysis [41, 53, 57, 60], and
numerous other fields.
From a general point of view the goal of clustering is to find the groups (clus-
ters) that are both homogeneous and well separated; i.e., elements within the same
cluster should be similar and elements in different clusters dissimilar. The process
of generating the clusters is called clustering. In the graph-theoretic approach to
clustering, one builds from the data a similarity graph in which vertices correspond
to objects and edges connect two vertices with similarity values above some prede-
fined threshold. Typical objectives include: minimizing the maximum diameter of a
cluster (k-clustering), minimizing the average distance between pairs of clustered
points (k-clustered sum), and many others.
2.2.1 Minimum k-Clustering
Problem 2.2.1. k-CLUSTERING

Given a graph G D .V; E/ and a positive integer l, determine whether there
is a partition of V into at most l subsets such that each of these subsets induces a
subgraph of G with diameter at most k.
Problem 2.2.2. MINIMUM k-CLUSTERING
Given a graph G D .V; E/, find the smallest integer l such that there is a partition
of V into l subsets each inducing a subgraph of G with diameter at most k.
The number of clusters in a minimum k-clustering of a graph G is denoted by
clk .G/:
Theorem 2.2.3 ([23]). Problem k-CLUSTERING is NP-complete for l 3.
Linear time algorithms for k-clustering on trees and some classes of perfect
graphs were given in [1, 32].
The 1-CLUSTERING problem is equivalent to the problem PARTITION
INTO CLIQUES which is NP-complete for any fixed l 3. A graph G has
1-CLUSTERING into at most l clusters if and only if the complement of G
has an l-colouring.
36 M. Borowiecki
The graph 2-CLUSTERING problem is related to the NP-complete problem

DOMINATING SET. A subset D V is said to be a dominating set of the graph
G D .V; E/ if for every vertex u 2 V D there exists a vertex v 2 D such that
uv 2 E. The minimum cardinality of a dominating set of G is denoted by .G/:
Problem 2.2.4. DOMINATING SET

Given a graph G D .V; E/ and a positive integer k, decide whether G has a
dominating set S with jS j k.
Theorem 2.2.5 ([29]). For any graph G
cl2 .G/ .G/:
Proof. Let D D fw1 ; : : : ; wl g be a dominating set of G. 2-clustering fQ1 ; : : : ; Ql g

of G with wi 2 Qi for all i D 1; : : : ; l can be generated by assigning remaining ver-
tices v to Qi for which vwi 2 E. Thus a dominating set of cardinality .G/ induces
a clustering of G into the smallest number of subsets for which each subgraph in-
duced by Qi has a dominating vertex. t
u
2.2.2 Strongly Chordal Graphs
A class of chordal graphs, denoted by C, is defined by the set of minimal forbidden

induced subgraphs as follows:
F .C/ D fCn W n 4g:
A graph G D .V; E/ is said to be strongly chordal if every induced subgraph

contains a simple vertex, where a vertex v of a graph G is simple if the set fN Œu W
u 2 N Œvg can be linearly ordered by inclusion; i.e., the closed neighbourhoods form
a chain under inclusion; see Fig. 2.1. A class of strongly chordal graphs is denoted
by SC.
A Sun Sr is a chordal graph on 2r vertices, for some r 3, whose vertex set can
be partitioned into two sets: U D fu1 ; : : : ; ur g and W D fw1 ; : : : ; wr g such that:
(a) Sr ŒU is a complete graph (r-clique) and W is an independent set in Sr
(b) for each i and j , wi is adjacent to uj if and only if i D j or i j C 1 .mod r/.
Theorem 2.2.6 ([31]). A graph is strongly chordal if and only if it does not contain
as an induced subgraph a cycle of length greater than three or Sun Sr , r 3.
Theorem 2.2.7 ([29]). Let G be a strongly chordal graph. Then
cl2 .G/ D .G/:

3 5
1 6
2 4
Fig. 2.1 A strongly chordal graph with a strong ordering (1, 2, 3, 4, 5, 6). The vertex 1 is simple:
N Œ1 D f1; 2; 3g N Œ2 D f1; 2; 3; 4g N Œ3 D f1; 2; 3; 4; 5g
Consequently, there is a linear time algorithm to compute an optimal 2-clustering

of a strongly chordal graph that is given with a strong elimination ordering. This
algorithm applies a linear time algorithm to compute a minimum dominating set for
strongly chordal graphs [31].
2.2.3 Hereditary Clique-Helly Graphs
A set family F has the Helly property if every collection of pairwise-intersecting

sets from F has a common element.
In other words, if fS1 ; : : : ; Sm g F , then
!
\
m
.8i; j Si \ Sj ¤ ;/ ) Sk ¤ ; :
kD1
A clique of a graph G is a maximal complete subgraph of G. We also use “clique”

to mean “vertex set of a clique”.
A graph G is clique-Helly if the cliques of G have the Helly property, and G
is hereditary clique-Helly if every induced subgraph of G is clique-Helly. Let us
denote the class of hereditary clique-Helly graphs by HCH: The set of minimal
forbidden subgraphs of HCH is given by F .HCH/ D fH0 D S3 ; H1 ; H2 ; H3 g,
where H1 is obtained from Sr by adding the edge w1 w2 , H2 from H1 by adding the
edge w2 w3 , and H3 from H2 by adding the edge w1 w3 .
Let us denote the class of hereditary clique-Helly chordal graphs by HCHC;
i.e., let
HCHC D HCH \ C:
38 M. Borowiecki
w1
u1 u2
w3 w2
u3
Fig. 2.2 Hajós graph: S3 and Sun: S5
Since each graph Hi , i D 1; 2; 3, from F .HCH/ contains C4 as an induced

subgraph, then the minimal forbidden subgraphs of HCHC are the Hajós graph S3
and cycles of length greater than 3.
Consequently, it follows that
SC HCHC C:
Since S5 2 HCHC SC and S3 2 C HCHC, the above inclusions are proper.

Theorem 2.2.8. There is a polynomial-time recognition algorithm for HCHC
graphs.
2.2.4 Minimum k-Clustering in HCHC
Theorem 2.2.9. Let G 2 HCHC. Then
cl2 .G/ D .G/:
Proof. By Theorem 2.2.5 we have cl2 .G/ .G/: We prove that for G 2 HCHC,
cl2 .G/ .G/:
Let G 2 HCHC and fQ1 ; : : : ; Ql g be 2-clusters of G with l D cl2 .G/. By
heredity, Qi 2 HCHC and diam .Qi / 2 for i D 1; : : : ; l: Now, it is enough to
prove that each Qi has a universal vertex. Consider two cases.
Case 1. Qi does not contain the Sun Sr , r 4, i D 1; : : : ; l:
Hence each cluster Qi is strongly chordal and Qi has a universal vertex xi , i D
1; : : : ; l. Thus the set fx1 ; : : : ; xl g is dominating in G; i.e., .G/ l D cl2 .G/:
Case 2. For some i , 1 i l, Qi contains a Sun Sr , r 4.
Let us denote Qi and Sr briefly by Q and S , respectively, and let V .S / D
fu1 ; : : : ; ur ; w1 ; : : : ; wr g with GŒfu1 ; : : : ; ur g D Kr . Consider three vertices in
W with consecutive labels: wt ; wt C1 ; wt C2 . It is easy to see that dS .wt ; wt C2 / D 3
and therefore in S there is an induced path wt ut C1 ut C2 wt C2 of length three. Since

dQ .wt ; wt C2 / D 2, then there is x 2 V .Q/ V .S /, a common neighbour of both
wt and wt C2 . Since Q is chordal, the vertex x has to be adjacent to ut C1 and ut C2 . If
wt C1 x … E, then the set fwt ; ut C1 ; wt C1 ; ut C2 ; wt C2 ; xg induces the Hajós graph, a
contradiction. Thus wt C1 x 2 E. It holds for any vertices with consecutive labels in
the independent set W , thus x is adjacent to all vertices of S . Hence for each pair of
vertices wi and wi C2 there is a common neighbour y 2 V .Q/ V .S / with the same
properties as above, possible x D y.
Let X D fx1 ; : : : ; xt g be a set of vertices of V .Q/ V .S / each of which dom-
inates V .S /. If xi xj … E, then any two vertices of W with consecutive labels, say
w1 ; w2 together with xi ; xj , induce in Q a cycle C4 , which contradicts the chordal-
ity. It follows that the subgraph induced in Q by the set fx1 ; : : : ; xt g is a clique.
Let Y D V .Q/ .V .S / [ X /. If jY j 1, then any vertex of X is a universal ver-
tex of Q. Assume that jY j 2: Let y1 ; y2 2 Y and suppose that y1 ; y2 do not have
a common neighbour in Y . Then either d.y1 ; y2 / 3 or y1 y2 2 E. In the first case,
we have a contradiction; in the second, there is in Q an induced cycle C4 , which
contradicts chordality of Q. Hence any two vertices of Y have a common neighbour
in X . Since QŒX [ Y 2 HCHC, the Helly property implies that there is a vertex
x 2 X such that xy 2 E for all y 2 Y . Thus the vertex x is a universal vertex of Q,
which completes the proof. t
u
Problem 2.2.10. VERTEX COVER

Given a graph G D .V; E/ and an integer k, 1 k jV j: Is there a vertex cover
of cardinality k for G, i.e., a subset V 0 of V with jV 0 j k such that V 0 contains
at least one vertex from every edge in E?
Theorem 2.2.11. Problem DOMINATING SET is NP-complete for HCHC graphs.
Proof. We transform the VERTEX COVER problem which remains NP-complete

even when restricted to planar triangle free graphs [35] to DOMINATION SET in
HCHC, in the following way: Let G D .V; E/ be a planar triangle-free graph. Con-
struct the graph H D .U; F / with the vertex set U D V [ E and the edge set
F D fvv0 W v; v0 2 V; v ¤ v0 g [ fve W v 2 V; e 2 E and v 2 eg:
Claim 1. H 2 HCHC.
Proof. It is easy to see that H is chordal. Now it is enough to prove that H does
not contain the Sun S3 as an induced subgraph. On the contrary, suppose that
S3 H . It implies that w1 ; w2 ; w3 and u1 ; u2 ; u3 of S3 correspond to some vertices,
say e1 ; e2 ; e3 and v1 ; v2 ; v3 , respectively, in H . By the above and the construction
of H it follows that the graph G contains a triangle induced by the set fv1 ; v2 ; v3 g,
a contradiction. t
u
Claim 2. G has a vertex cover of cardinality d if and only if H has a dominating set
of cardinality d .
40 M. Borowiecki
Fig. 2.3 Graph classes and

domination set complexity
HCH Perfect
Chordal
Balanced
HCHC NP-c
? BC
P SC
Interval
Proof. Let C be a vertex cover of G with jC j D d . Since H ŒV is a clique, every

vertex of V is dominated by each vertex of C . Every e 2 E is covered by some v
in C , thus e is dominated by v in H . Therefore C is a dominating set of cardinality
d in H .
Suppose now that H has a dominating set D of cardinality d . If D V , then D
is also a vertex cover of G. (Each vertex e 2 E in H is dominated by some element
of D, thus each e 2 E.G/ has at least one vertex in D.) If D \ E ¤ ;, i.e., say
e D vv0 2 E is in D we may replace e by v or v0 and get a new dominating set D 0
of the same cardinality. Applying this procedure to all e 2 D \ E we will finally
get a dominating set D V with jD j D d . t
u
Hence the NP-completeness of the DOMINATING SET problem in HCHC
follows from the VERTEX COVER problem for planar triangle-free graphs. t
u
2.2.5 Balanced Graphs
A hypergraph H is said to be balanced if every odd cycle has an edge containing

three vertices of the cycle; see [4]. In other words, H is balanced if and only if its
incidence matrix contains no square submatrix of an odd cycle.
A graph G is called balanced if its clique hypergraph is balanced.
Theorem 2.2.12 ([28]). There is a polynomial-time recognition algorithm for

balanced graphs.
Let us denote the class of balanced chordal graphs by BC.
Theorem 2.2.13 ([45]). A graph G 2 BC if and only if it is odd Sun-free chordal.
From Theorem 2.2.9 we have

Corollary 2.2.14. Let G 2 BC. Then
cl2 .G/ D .G/:
Open Problem 2.2.15. Problem DOMINATING SET remains open for the
class BC.
2.3 Matching Cutset
A set M of independent edges in a graph G is called a matching. A set F E.G/

is a cutset in G if G F has more components than G. If a cutset is a matching of G
then it is called a matching cutset. The problem of recognizing graphs with a match-
ing cutset is well studied in the literature. For a survey of what is known to date, see
[20, 27, 44, 58]. Historically, the first theorem for matching cutset complexity was
given by Chvatál [25].
We list some important results concerning this problem. Some of them deal with
well-known classes of graphs.
Theorem 2.3.1 ([25]). It is NP-complete to recognize graphs with a matching cut-

set even if the input is restricted to graphs with D 4.
The next two results yield conditions on vertex degrees of bipartite graphs suffi-
cient to guarantee NP-completeness of matching cutsets.
Theorem 2.3.2 ([49]). MATCHING CUTSET is NP-complete, even if the input is

restricted to bipartite graphs of minimum degree 2.
Theorem 2.3.3 ([44]). MATCHING CUTSET is NP-complete, even if the input is
restricted to bipartite graphs with one colour class consisting only of vertices of
degree 3 and the other colour class consisting only of vertices of degree 4.
Below are presented a few graph classes for which the MATCHING CUTSET
problem is polynomial. The line graph of G, denoted by L.G/, is the graph the
vertex set of which is the edge set of G and two vertices of L.G/ are adjacent if and
only if, as edges in G, they are adjacent. A graph H is called a line graph if there is
a graph G such that H is isomorphic to L.G/.
42 M. Borowiecki
Theorem 2.3.4 ([49]). Let G D .V; E/ be a line graph. Then we can determine in
O.jEj/ time whether G has a matching cutset.
Theorem 2.3.5 ([49]). Let G D .V; E/ be a graph without induced cycles of length
4. Then we can determine in O.jV j3 jEj/ time whether G has a matching cutset.
Theorem 2.3.6 ([16]). Let G be a graph with diam.G/ D 2. Then the MATCHING
CUTSET problem for G can be solved in polynomial time.
Open Problem 2.3.7. Find k which is a boundary that separates NP-complete

instances of diameter k of the MATCHING CUTSET problem from polynomially
solvable ones.
2.4 Acyclic Colourings
Acyclic colourings have been studied extensively over the past 30 years. Several
authors have been able to determine a .P/ for some classes P of graphs such as
graphs of maximum degree 3, considered by Grűnbaum in [37] and of maximum
degree 4, studied by Burstein in [24]. The acyclic chromatic number of planar graphs
was determined by Borodin in 1979; see [8] for details. Planar graphs with “large”
girth, outerplanar, and 1-planar graphs were also considered; see, for instance,
[9, 10].
2.4.1 Selected Results
Theorem 2.4.1 ([42]). It is an NP-complete problem to decide for a given graph G

and k 3 if the acyclic chromatic number of G is at most k.
In 2004 Skulrattanakulchai [54] proved that there is a linear time algorithm that
acyclically colours any graph of maximum degree 3 in four colours.
Theorem 2.4.2 ([34]). For any graph G of maximum degree 5, a .G/ 9 and
there exists a linear time algorithm to acyclically colour G in at most nine colours.
Authors suspect that the upper bound of nine colours in the case .G/ D 5 is
not tight.
Theorem 2.4.3 ([37]).

a .S 3 / 4:
Theorem 2.4.4 ([8]).

a .T 3 / 5:
The bound a .S 3 / 4 proved by Grűnbaum in Theorem 2.4.3 is the best

possible. Moreover, Kostochka and Mel’nikov [43] proved that there are bipartite
2-degenerate planar graphs which are not acyclically 4-colourable. Acyclic colour-
ings turned out to be useful for obtaining results about other types of colourings,
see [39].
2.4.2 Brooks-Type Results
The well-known theorem of Brooks [22] relates the chromatic number of a graph to
its maximum degree.
Theorem 2.4.5. For any connected graph G,
.G/ .G/ C 1
with equality if and only if either .G/ D 2 and G is an odd cycle or .G/ ¤ 2
and G is a complete graph.
There are many generalisations of the Brooks theorem. These theorems are called
Brooks-type results. For the acyclic chromatic number finding a sharp upper bound
as a function of maximum degree seems to be an extremely hard problem.
Theorem 2.4.6 ([3]).

a .S / C4=3 :
Theorem 2.4.7 ([34]). For a graph G of maximum degree 5 we have
. 1/
a .G/ :
2
Open Problem 2.4.8. Find a sharp upper bound for a .G/ as a function of .G/:
2.4.3 Improper Acyclic Colouring
Studies have begun in [7] of acyclic colourings of graphs with respect to hereditary
properties of graphs. Namely, they have considered outerplanar, planar graphs, and
graphs with bounded degree; see [6, 7]. They call such acyclic colouring improper.
Formally, an improper acyclic colouring of graphs is an M -partition with
mii D P i and mij D D1 for i ¤ j , 1 i; j k. We denote it briefly by
..P 1 ; : : : ; P k /; D1 /.
The class of graphs having ..P 1 ; : : : ; P k /; D1 /-partition is denoted by
P1 ˇ ˇ Pk.
44 M. Borowiecki
An additive hereditary property R is said to be acyclic reducible in La if there

are nontrivial additive hereditary properties P 1 ; P 2 such that R D P 1 ˇ P 2 and
acyclic irreducible in La , otherwise.
It is easy to see that the smallest acyclic reducible property in La is the property
O ˇ O D D1 . Obviously, D 1 is the unique minimal acyclic reducible bound for P
if and only if P D 1 .
A maximal outerplanar graph G with at least three vertices is called a
2-path of order n D 2p, if G consists of two paths P1 D .x1 ; x2 ; : : : ; xp /,
P2 D .y1 ; y2 ; : : : ; yp / and additional edges: xi yi , i D 1; : : : ; p and xj yj C1
for j D 1; : : : ; p 1. For an odd n D 2p 1 a 2-path H is defined as H D G xp ,
where G is a 2-path of even order. A 2-path of order n is denoted by Pn2 .
A maximal outerplanar graph G with at least three vertices is called a fan of
order n, if G is obtained from a star K1;n1 by joining all vertices of degree one by
a path. A fan of order n is denoted by Fn .
Additionally we assume that the graph K1 and K2 is a trivial 2-path and a trivial
fan. For each n 5 there is exactly one (up to isomorphism) maximal outerplanar
graph which is a 2-path and a fan.
Some acyclic reducible bounds for the class of outerplanar graphs can be found
in [13].
Theorem 2.4.9 ([13]).

T2 O ˇ Forb.S3 ; P62 /;
T2 O ˇ Forb.S3 ; F6 /:
We have an interesting proposition which characterises fans and 2-paths in the
class of maximal outerplanar graphs. It was used in the proof of the next corollary
and theorem and gives some light on an open problem formulated at the end of this
section.
Proposition 2.4.10 ([13]). Let G be a maximal outerplanar graph of order n 3.

Then
(a) G is a fan if and only if neither S3 G nor P62 G.
(b) G is a 2-path if and only if neither S3 G nor F6 G.
Let us recall that a block of a given graph G is defined to be a maximal connected

subgraph of G without a cutvertex.
A fan .2-path/ tree is a connected graph G every block of which is a fan (2-path).
Let us define the property F T (PT ) as the class of all fan (2-path) trees and their
subgraphs. Both classes are hereditary and form a proper subclass of all outerplanar
graphs.
From the definition of F T it follows that S3 and P62 do not belong to F T .
Similarly, S3 and F6 do not belong to PT . It implies the following corollary.
Corollary 2.4.11.
F T Forb.S3 ; P62 /;
PT Forb.S3 ; F6 /:
Because of the above corollary, the next theorem gives two acyclic reducible
bounds for outerplanar graphs which are better than those in Theorem 2.4.9.
Theorem 2.4.12.
T 2 O ˇ FT ;
T 2 O ˇ PT :
Open Problem 2.4.13. Find at least one minimal acyclic reducible bound for the
class of outerplanar graphs.
Theorem 2.4.14 ([7]).
S 3 S 1 ˇ S 1 ˇ S 1:
Conjecture 2.4.15 ([7]).
S 3 S 2 ˇ S 2:
Theorem 2.4.16 ([14]).
1. Boiron, Sopena, and Vignal’s conjecture is true; i.e., S 3 S 2 ˇ S 2 holds.

2. There is a polynomial time algorithm to acyclically .S 2 ; S 2 /-colour each graph
G 2 S 2.
3. It is NP-complete to determine whether a graph G 2 S 4 has an acyclic .S 2 ; S 2 /-
colouring.
The first statement of Theorem 2.4.16 cannot be generalized for k D 4. It was

observed by Hałuszczak [Hałuszczak M, 2007, private communication]. But this
observation can be extended for all k 4.
Theorem 2.4.17. S k 6 S k1 ˇ S k1 , for k 4:
Proof. Let G D Ck C Dk2 , where by Dn the edgeless graph of order n is denoted;
i.e., the graph G is obtained by joining each vertex of cycle of order k with each
vertex of edgeless graph of order k 2. Obviously, the graph G 2 S k but G …
S k1 ˇ S k1 . We left an easy proof of that fact to a reader. t
u
Some other type results on acyclic colouring of graphs are presented in [6].
References
1. Abbas N (1995) Graph clustering: complexity, sequential and parallel algorithms. Ph.D. thesis,
University of Alberta, Edmonton, Canada
2. Alekseev VE, Farrugia A, Lozin VV (2004) New results on generalized graph coloring.
Discrete Math Theor Comput Sci 6:215–222
46 M. Borowiecki
3. Alon N, McDiarmid C, Reed B (1991) Acyclic coloring of graphs. Random Struct Algorithm
2:277–288
4. Berge C (1987) Hypergraphs. Gauthier-Villars, Paris
5. Berger A (2001) Minimal forbidden subgraphs of reducible graph properties. Discuss Math
Graph Theory 21:111–117
6. Boiron P, Sopena E, Vignal L (1999) Acyclic improper colorings of graphs. J Graph Theory
32:97–107
7. Boiron P, Sopena E, Vignal L (1999) Acyclic improper colourings of graphs with bounded
degree. DIMACS Series Discrete Math Theor Comput Sci 49:1–9
8. Borodin OV (1979) On acyclic colorings of planar graphs. Discrete Math 25:211–236
9. Borodin OV, Kostochka AV, Raspaud A, Sopena E (2001) Acyclic colourings of 1-planar
graphs. Discrete Appl Math 114:29–41
10. Borodin OV, Kostochka AV, Woodall DR (1999) Acyclic colorings of planar graphs with large
girth. J Lond Math Soc 60:344–352
11. Borowiecki M, Broere I, Frick M, Mihók P, Semanišin G (1997) A survey of hereditary prop-
erties of graphs. Discuss Math Graph Theory 17:5–50
12. Borowiecki M, Broere I, Mihók P (2000) Minimal reducible bounds for planar graphs. Discrete
Math 212:19–27
13. Borowiecki M, Fiedorowicz A (2006) On partitions of hereditary properties of graphs. Discuss
Math Graph Theor 26:377–387
14. Borowiecki M, Fiedorowicz A, Jesse-Józefczyk K, Sidorowicz E (2010) Acyclic colourings of
graphs with bounded degree. Discrete Math Theor Comput Sci 12:59–74
15. Borowiecki M, Hałuszczak M, Skowrońska M (2000) Minimal reducible bounds for
1-nonouterplanar graphs. Discrete Math 219:9–15
16. Borowiecki M, Jesse-Józefczyk K (2008) Matching cutsets in graphs of diameter 2. Theor
Comput Sci 407:574–582
17. Borowiecki M, Mihók P (1991) Hereditary properties of graphs. In: Kulli VR (ed) Advances
in graph theory. Vishwa International Publication, Gulbarga, pp 41–68
18. Borowiecki P (1993) P -bipartitions of graphs. Vishwa Int J Graph Theory 2:109–116
19. Borowiecki P, Ivančo J (1997) P -bipartitions of minor hereditary properties. Discuss Math
20. Brandsta̋dt A, Le VB, Szymczak T (1998) The complexity of some problems related to
GRAPH 3-COLORABILITY. Discrete Appl Math 89:59–73
21. Broere I, Mynhardt CM (1984) Generalized colorings of outerplanar and planar graphs.
In: Proceedings of the fifth international conference on the theory and applications of graphs
with special emphasis on algorithms and computer science. Wiley-Interscience, New York,
pp 151–161
22. Brooks RL (1941) On colouring the nodes of a network. Proc Camb Philos Soc 37:194–197
23. Brucker P (1978) On the complexity of clustering problems. In: Henn R, Korte B, Oettli W
(eds) Optimization and operations research. Lecture notes in economics and mathematical sys-
tems, vol 157. Springer, New York, pp 45–54
24. Burstein MI (1979) Every 4-valent graph has an acyclic 5-coloring. Soobšč. Akad Gruzin SSR
93:21–24 (in Russian)
25. Chvátal V (1984) Recognizing decomposable graphs. J Graph Theory 8:51–53
26. Chartrand G, Kronk HV (1969) The point arboricity of planar graphs. J Lond Math Soc
44:612–616
27. Coreli DG, Fonlupt J (1993) Stable set bonding in perfect graphs and parity graphs. J Combin
Theory B 59:1–14
28. Dahlhaus E, Manuel P, Miller M (1998) Maximum h-colourable subgraph problem in balanced
graphs. Inform Process Lett 65:301–303
29. Deogun JS, Kratsch D, Steiner G (1997) An approximation algorithm for clustering graphs
with dominating diametral path. Inform Process Lett 61:121–127
31. Faber M (1983) Characterizations of strongly chordal graphs. Discrete Math 43:173–189
32. Farley A, Hedetniemi S, Proskurowski A (1981) Partitioning trees: matching, domination and
maximum diameter. Int J Comput Inform Sci 10:55–61
33. Farrugia A (2004) Vertex-partitioning into fixed additive induced-hereditary properties is NP-
hard. Electron J Combinator 11, #R46
34. Fertin G, Raspaud A (2008) Acyclic coloring of graphs of maximum degree five: nine colors
are enough. Inform Process Lett 105:65–72
35. Garey MR, Johnson DS, Stockmeyer L (1976) Some simplified NP-complete graph problems.
Theor Comput Sci 1:237–267
36. Goddard W (1991) Acyclic colorings of planar graphs. Discrete Math 91:91–94
37. Grűnbaum B (1973) Acyclic coloring of planar graphs. Israel J Math 14:390–412
38. Hakimi SL, Schmeichel E, Weinstein J (1990) Partitioning planar graphs into independent sets
and forests. Congr Numer 78:109–118
39. Jensen TR, Toft B (1995) Graph coloring problems. Wiley-Interscience, New York
40. Karp RM (1972) Reducibility among combinatorial problems. In: Miller RE, Thatcher JW
(eds) Complexity of computer computations. Plenum, New York, pp 85–104
41. Kershenbaum A (1993) Telecommunications network design algorithms. McGraw-Hill,
New York
42. Kostochka AV (1978) Ph.D. thesis, Novosibirsk
43. Kostochka AV, Mel’nikov LS (1976) Note to the paper of Grűnbaum on acyclic colorings.
Discrete Math 14:403–406
44. Lee VB, Randerath B (2003) On stable cutsets in line graphs. Theor Comput Sci 301:463–475
45. Lehel J, Tuza Zs (1986) Neighborhood perfect graphs. Discrete Math 61:93–101
46. Mahadev NVR, Peled VN (1995) Threshold graphs and related topics. Ann Discrete Math
56:170
47. Mihók P (1996) On the minimal reducible bound for outerplanar and planar graphs. Discrete
Math 150:431–435
48. Mihók P (2001) Minimal reducible bounds for the class of k-degenerate graphs. Discrete Math
236:273–279
49. Moshi AM (1989) Matching cutsets in graphs. J Graph Theory 13:527–536
50. Nešetřil J, Rődl V (1976) Partitions of vertices. Comment Math Univ Carolinae 17:85–95
51. Poh KS (1990) On the linear vertex-arboricity of a planar graph. J Graph Theory 14:73–75
52. Semanišin G (2004) Minimal reducible bounds for induced-hereditary properties. Discrete
Math 286:163–170
53. Sharan R, Maron-Katz A, Shamir R (2003) CLICK and EXPANDER: a system for clustering
and visualizing gene expression data. Bioinformatics 19:1787–1799
54. Skulrattanakulchai S (2004) Acyclic colorings of subcubic graphs. Inform Process Lett
92:161–167
55. Stein SK (1971) B-sets and planar graphs. Pac J Math 37:217–224
56. Thomassen C (1995) Decomposing a planar graph into degenerate graphs. J Combin Theory B
65:305–314
57. Tou JT, Gonzalez RC (1974) Pattern recognition principles. Addison Wesley, Reading, MA
58. Tucker A (1983) Coloring graphs with stable cutsets. J Combin Theory B 34:258–267
59. West DB (2001) Introduction to graph theory, 2nd edn. Prentice Hall, Upper Saddle River
60. Wu Z, Leahy R (1993) An optimal graph theoretic approach to data clustering: theory and its
application to image segmentation. IEEE Trans Pattern Anal Mach Intell 15:1101–1113
Chapter 3
Distance in Graphs
Wayne Goddard and Ortrud R. Oellermann
Abstract The distance between two vertices is the basis of the definition of several
graph parameters including diameter, radius, average distance and metric dimen-
sion. These invariants are examined, especially how they relate to one another and
to other graph invariants and their behaviour in certain graph classes. We also dis-
cuss characterizations of graph classes described in terms of distance or shortest
paths. Finally, generalizations are considered.
Keywords Graph Distance Diameter Radius Steiner distance
MSC2000: Primary 05C12; Secondary 05C20, 05C38
3.1 Overview of Chapter
The distance between two vertices in a graph is a simple but surprisingly useful
notion. It has led to the definition of several graph parameters such as the diameter,
the radius, the average distance and the metric dimension. In this chapter we exam-
ine these invariants; how they relate to one another and other graph invariants and
their behaviour in certain graph classes. We also discuss characterizations of graph
classes that have properties that are described in terms of distance or shortest paths.
We later consider generalizations of shortest paths connecting pairs of vertices to
shortest trees, called Steiner trees, that connect three or more vertices.
W. Goddard ()
School of Computing and Department of Mathematical Sciences,
Clemson University, Clemson, SC 29634-1906, USA

50 W. Goddard and O.R. Oellermann
3.2 Distance, Diameter and Radius
A path in a graph is a sequence of distinct vertices, such that adjacent vertices in the
sequence are adjacent in the graph. For an unweighted graph, the length of a path is
the number of edges on the path. For an (edge) weighted graph, the length of a path
is the sum of the weights of the edges on the path. We assume that all weights are
nonnegative and that all graphs are connected. We start with undirected graphs.
The distance between two vertices u and v, denoted d.u; v/, is the length of a
shortest u v path, also called a u v geodesic. The distance function is a metric
on the vertex set of a (weighted) graph G. In particular, it satisfies the triangle
inequality:
d.a; b/ d.a; c/ C d.c; b/
for all vertices a; b; c of G. This follows from the fact that, if you want to get from
a to b, then one possibility is to go via vertex c.
3.2.1 Diameter and Radius
Two of the most commonly observed parameters of a graph are its radius and di-
ameter. The diameter of a connected graph G, denoted diam.G/, is the maximum
distance between two vertices. The eccentricity of a vertex is the maximum distance
from it to any other vertex. The radius, denoted rad.G/, is the minimum eccentricity
among all vertices of G. Of course the diameter is the maximum eccentricity among
all vertices.
For a (weighted) undirected graph G:
rad.G/ diam.G/ 2 rad.G/:
The upper bound follows from the triangle inequality, where c is a vertex of mini-
mum eccentricity.
The radius and diameter are easily computed for simple graphs.
Fact 1 1. Complete graphs: diam.Kn / D rad.Kn / D 1 (for n 2).

2. Complete bipartite graphs: diam.Km;n / D rad.Km;n / D 2 (if n or m is at
least 2).
3. Path on n vertices: diam.Pn / D n 1; rad.Pn / D d.n 1/=2e.
4. Cycle on n vertices: diam.Cn / D rad.Cn / D bn=2c.
Note that cycles and complete graphs are vertex-transitive, so the radius and di-
ameter are automatically the same (every vertex has the same eccentricity).
The centre C.G/ is the subgraph induced by the set of vertices of minimum
eccentricity. Graphs G where rad.G/ D diam.G/ are called self-centred.
3 Distance in Graphs 51
A famous result, due originally to Jordan [44], is that:
Fact 2 For trees T , the diameter equals either 2 rad.T / or 2 rad.T / 1. In the first
case the center is a single vertex, and in the second the centre is a pair of adjacent
vertices.
The derivative T 0 of a tree T is the tree obtained by deleting the leaves of T .

Suppose the kth derivative T .k/ of T has been defined for some k 1. Then the
.k C 1/st derivative of T is defined by T .kC1/ D .T .k/ /0 . It can be shown that the
centre of a tree is T .bdiam.T /=2c/ .
For general graphs, Harary and Norman [40] showed the following.
Fact 3 The centre of a graph forms a connected subgraph, and is contained inside
a block of the graph.
In general, there are no structural restrictions on the centre of a graph. Indeed,
Hedetniemi (see [9]) showed that every graph is the centre of some graph.
3.2.2 Bounds for the Radius and Diameter
We look next at upper bounds involving the minimum degree ı or maximum

degree .
Theorem 1. For a graph G of order n:
1. diam.G/ n .G/ C 1.
2. [71] rad.G/ .n .G//=2 C 1.
3. If ı.G/ n=2, then diam.G/ 2.
And these bounds are sharp.
One can also consider the problem of maximizing or minimizing these

parameters given the number of vertices and edges. Both the radius and diam-
eter are minimized by the star (and any supergraph thereof), so that case is not
interesting.
For a given number n of vertices and m n 1 of edges, the diameter and
radius are maximized by the “path-complete” and the “cycle-complete” graphs,
respectively. These are defined as follows. A cycle-complete graph is obtained by
taking disjoint copies of a cycle of even length and a complete graph, and joining
three consecutive vertices of the cycle to all vertices in the complete graph. The
radius is half the length of the cycle. This graph was introduced by Vizing [71]. An
example is given in Fig. 3.1.
A path-complete graph is obtained by taking disjoint copies of a path and com-
plete graph, and joining an end-vertex of the path to one or more vertices of the
complete graph. It is not hard to show that there is a unique path-complete graph
Fig. 3.1 A cycle-complete graph
Fig. 3.2 The path-complete graph PK 8;11
with n vertices and m edges; this is denoted as PK n;m . This graph was introduced
by Harary [38]. An example is given in Fig. 3.2.
Theorem 2. 1. [71] For a given number n of vertices and m n 1 of edges, the

radius is maximized by the cycle-complete graphs.
2. [38] For a given number n of vertices and m n 1 of edges, the diameter is
maximized by the path-complete graph PK n;m .
It is not hard to show that if a graph G has large diameter, then its complement
GN has small diameter:
N 2.
Fact 4 1. If diam.G/ > 3, then diam.G/
N
2. If diam.G/ D 3, then diam.G/ 3.
3.2.3 Changes in Diameter and Radius with Edge

and Vertex Removal
Removing an edge can never decrease the radius or the diameter of a graph. Indeed,
removing a bridge disconnects the graph. So we consider cyclic edges.
Fact 5 If e is a cyclic edge of graph G, then rad.G/ rad.G e/ 2 rad.G/ and
diam.G/ diam.G e/ 2 diam.G/.
Both upper bounds are attainable. Removing a cyclic edge can easily double the
diameter; for example, it does so in the odd cycles. Plesnı́k [61] showed that if every
Fig. 3.3 Large increase in

the diameter/radius of G v
edge’s removal doubles the diameter, then the graph is a Moore graph, i.e., a graph
of diameter d and girth 2d C 1 for some d 1. For example, Moore graphs include
the complete graphs, the odd cycles, the Petersen graph and the Hoffman–Singleton
graph (see [7]). Removing a cyclic edge can also double the radius. Such a graph can
be constructed by taking two equal-sized cycles, and sticking them together along
one edge e.
There is a natural spanning tree with the same radius as the original graph, some-
times called a breadth-first search tree. This tree has diameter at most double its
radius, and hence at most double the original radius. Buckley and Lewinter [8]
determined which graphs have a diameter-preserving spanning tree.
Removing a vertex can both increase and decrease these parameters. Removing a
cut-vertex from a disconnected graph results in a disconnected graph, so we do not
consider such vertices.
Fact 6 If v is a non-cut-vertex of graph G, then rad.G v/ rad.G/ 1 and

diam.G v/ diam.G/ 1.
The above bound is attained, for example, by an even-order path where v is an
end-vertex of the path. There is no upper bound on rad.G v/ or diam.G v/ if G
is 2-connected. To see this, let G be obtained from m cycles Ci W vi1 vi2 : : : vi2d C1 vi1
for 1 i m by identifying the vertices vi1 for 1 i m into a vertex v and then
adding the edges vi2d C1 v.i C1/2 for i D 1; 2; : : : ; m 1. Then diam.G/ D 2d and
diam.G v/ D 2d m1. Since m can be made as large as we wish, there is no upper
bound on diam.G v/ in terms of diam.G/. Figure 3.3 shows this construction with
d D 2 and m D 4.
3.2.4 Matrices and Walks
A walk is a sequence of not necessarily distinct vertices such that each vertex in the
sequence except the first one is adjacent to the previous one. Suppose the vertices
of a graph G are labeled v1 ; : : : ; vn . Then the adjacency matrix A of G is defined
as the n n matrix whose .i; j /-th entry is 1 if there is an edge joining vertices vi
and vj , and 0 otherwise. The Laplacian matrix is defined as A D where D is the
diagonal matrix whose .i; i /-entry is the degree of the vertex vi . The eigenvalues of
A are referred to as the eigenvalues of G, and the eigenvalues of L as the Laplacian
eigenvalues of G. The following fact is well-known:
Fact 7 The .i; j /-th entry of the power Ak gives the number of walks of length k
from vi to vj .
Bounds on the diameter of a graph in terms of the number of eigenvalues of these

matrices follow from Fact 7 (see, for example, [17]):
Theorem 3. Let G be a connected graph and b the number of distinct eigenvalues

of G. Then
diam.G/ b 1:
The same result holds if b is the number of distinct Laplacian eigenvalues of G.
3.3 Other Measures of Centrality
Apart from the centre of a graph, there are several other centrality measures. These
have many applications. The centre is for emergency facility location: the response
time must be minimized in the worst case. For biological graphs, the centre vertices
might be the most important (see, for example, [42]).
Another measure of centrality is the “median” of a graph. The status .v/ of a
vertex v is the sum of the distances from v to all other vertices. The vertices having
minimum status .v/ form the median of the graph, which is denoted by M.G/.
For example, the median might be a good place to locate a mall: the average driving
distance is minimized.
There is no intrinsic connection between the centre and the median. Indeed, they
can be arbitrarily far apart. Slater [67] considered whether there are other measures
of centrality that “connect” the centre and the median of a graph. He defined for a
graph G, integer k 2 and vertex u of G,
nX o
rk .u/ D max d.u; s/ j S V .G/; jS j D k :
s2S
Thus, rk .u/ is the sum of the k largest vertex distances to u. In particular, r1 .u/ is
its eccentricity, and rn1 .u/ is its status.
The k-centrum, C.GI k/, of G is the subgraph induced by those vertices u for
which rk .u/ is a minimum. Thus, C.GI 2/ D C.G/ and C.GI n 1/ D M.G/. It is
shown in [67] that the k-centrum of every tree consists of a single vertex or a pair
of adjacent vertices. Further, every vertex on the shortest path from the centre to the
median of a tree belongs to the k-centrum for some k between 1 and n.
In the case of trees, another centrality measure is well known. Suppose T is a tree
and v a vertex of T . Then a branch at v is a maximal subtree containing v as a leaf.
The weight at a vertex v of T is the maximum number of edges in any branch at v. A

vertex of T is a centroid vertex of T if it has minimum weight among all vertices of
T and the subgraph induced by the centroid vertices is called the centroid of T . That
is, a centroid vertex is one whose removal leaves the smallest maximum component
order. However, Zelinka [77] observed that the centroid and the median coincide.
Another centrality idea is a “central path”. This concept can be defined in one of
two ways that parallel the centre and median, respectively. If H is a subgraph of a
graph G and v is any vertex of G, then the distance from v to H is the minimum
distance from v to a vertex of H . The eccentricity of H is the distance of a vertex v
farthest from H , and the status of H is the sum of the distances of every vertex of G
to H . A path P is a path centre of G if P has minimum eccentricity among all paths
of G and has minimum length among all such paths. Similarly the path median of
G is a path of minimum status in G. The path median of a network may indicate a
good choice for a subway line, for example; in that case many individuals will use
this line, so it is desirable that the average distance from the users’ homes to the line
is minimized. On the other hand the problem of finding the path centre of a network
has application to the problem of building a highway between two major cities in
such a way that the furthest distance from the highway to any town in a collection
of other “important” towns is minimized. The problem of finding the path centre of
a tree was solved independently in [16, 68]. Further types of centres are discussed
in the book [7]. See [32] for more of the early history of centrality.
3.4 Special Graph Classes
3.4.1 Chordal Graphs
A chordal graph is one where every cycle of length greater than 3 has a chord. For
example, trees and maximal outerplanar graphs are chordal. A simplicial vertex is
one whose neighbourhood is complete. It was first shown by Dirac [21] and later
by Lekkerkerker and Boland [49] that every chordal graph has a simplicial vertex
(indeed at least two such vertices). Since induced subgraphs of chordal graphs are
still chordal, chordal graphs have a simplicial elimination ordering; that is, an or-
dering v1 ; v2 ; : : : ; vn of the vertices such that the neighbourhood of vi is complete
in the induced graph hfvi ; vi C1 ; : : : ; vn gi. Using induction one can show that every
graph that has a simplicial elimination ordering is chordal.
The centre of chordal graphs was investigated by Laskar and Shier [48]. For
example, they showed that the centre of a chordal graph is connected, and provided
the following generalization of Fact 2.
Theorem 4. For a chordal graph G, diam.G/ 2 rad.G/ 1.

3.4.2 Cartesian Products
Distance behaves nicely in Cartesian products of graphs. The Cartesian product of

two graphs F D .V1 ; E1 / and H D .V2 ; E2 /, written F H , has vertex set V1 V2 ,
and two vertices .u1 ; v1 / and .u2 ; v2 / are adjacent if either u1 D u2 and v1 v2 2 E2
or v1 D v2 and u1 u2 2 E1 . For example, the product K4 K2 is shown in Fig. 3.5.
If G D F H , then the distance between two vertices .u1 ; v1 / and .u2 ; v2 / in G is
the sum of the distances dF .u1 ; u2 / C dH .v1 ; v2 /.
The n-cube Qn (n 1) is defined using Cartesian products of graphs as fol-
lows. Q1 Š K2 ; and for k 1, QkC1 Š Qk K2 , i.e., QkC1 is the Cartesian
product of Qk and K2 . Mulder [56] showed that the n-cube possesses interest-
ing structural properties that can be described using distance notions. To this end,
let u; v be vertices in a graph G. Then the geodesic interval between u and v, de-
noted by Ig Œu; v, is the collection of all vertices that belong to some u v-geodesic
(shortest path). A graph G is a median graph if for any three vertices u; v; w of G,
jIg Œu; v \ Ig Œu; w \ Ig Œv; wj D 1. For example, the 3-cube, shown in Fig. 3.4, is a
median graph.
The next result was established in [56].
Theorem 5. A graph G is isomorphic to Qn if and only if G is a median graph with

maximum degree n such that G contains two vertices at distance d i am.G/ apart at
least one of which has degree n.
Hamming graphs are Cartesian products of complete graphs. Suppose fa1 ;

a2 ; : : : ; an g are positive integers and that Ai D f0; 1; : : : ; ai 1 g. Then the Hamming
graph Ha1 ;:::;an is the graph with vertex set the Cartesian product A1 A2 An
in which two vertices are joined by an edge if and only if the corresponding vectors
differ in exactly one coordinate. So Ha1 ;a2 :::;an D Ka1 Ka2 Kan and the
n-cube is the Hamming graph with a1 D a2 D D an D 2. The Hamming graph
H4;2 is shown in Fig. 3.5. The distance between two vertices is equal to the Ham-
ming distance between these vertices, namely, the number of coordinates in which
the corresponding vectors differ. Hamming graphs are used in coding theory and
have applications to other distance invariants as discussed in Sect. 3.8. Mulder [55]
extended Theorem 5 to characterize Hamming graphs in terms of intervals and for-
bidden subgraphs.
Fig. 3.4 The 3-cube:

a median graph
Fig. 3.5 The Hamming 11 21

graph H4;2
20
10
31
10
00 30
3.4.3 Distance Hereditary Graphs
Howorka [41] defined a graph G to be distance hereditary if for each connected

induced subgraph H of G and every pair u; v of vertices in H , dH .u; v/ D dG .u; v/.
Howorka [41] provided several conditions that characterize distance hereditary
graphs.
Theorem 6. For a graph G the following are equivalent:

1. G is distance hereditary.
2. Every induced path of G is a geodesic.
3. Every subpath of a cycle C of more than half C ’s length is induced.
4. Every cycle C of length at least 5 has a pair of chords e1 ; e2 of C such that
C C fe1 ; e2 g is homeomorphic with K4 .
Distance hereditary graphs form a subclass of the perfect graphs (graphs where
every induced subgraph has equal clique and chromatic numbers), and several
NP-hard problems have efficient solutions for distance hereditary graphs. One such
problem is discussed in Sect. 3.10. Another characterization of distance hereditary
graphs that lends itself well to algorithmic applications was given independently
by Bandelt and Mulder [2] and Hammer and Maffray [37]. A graph H is said to
be obtained from a graph G by (1) adding a leaf v to some vertex v0 of G, if v is
added to G and joined to v0 by an edge; and (2) by adding a twin v to some vertex
v0 of G, if v is added to G and if v is joined to the vertices in the open or closed
neighbourhood of v0 in G, i.e., v is joined to the vertices in NG .v0 / or NG .v0 / [ fv0 g,
respectively.
Theorem 7. A graph G is distance hereditary if and only if there is a sequence of

graphs G1 ; G2 ; : : : ; Gn1 such that G1 Š K2 , G Š Gn1 and for 2 i n 1,
Gi is obtained from Gi 1 by adding a vertex as a leaf or a twin to some vertex
of Gi 1 .
Another polynomial recognition algorithm for distance hereditary graphs that

is useful for solving the “Steiner problem” (see Sect. 3.10) for these graphs is
described in [20]. Bandelt and Mulder [2] gave a characterization of these graphs in
terms of forbidden subgraphs.
3.4.4 Random Graphs
The random graph Gpn is obtained by starting with n vertices, and then for every
pair of distinct vertices, making them adjacent with probability p (each decision
independent).
Fact 8 For any fixed p, Gpn has diameter 2 with high probability (meaning the limit
as n ! 1 is 1).
There is another version of random graphs, called power-law or scale-free graphs,

which models the Web better (see, for example, Bonato [6]).
3.5 Average Distance
The average distance of a graph G D .V; E/ of order n, denoted by .G/, is the

expected distance between a randomly chosen pair of distinct vertices; that is,
1 X
.G/ D n d.u; v/:
2 u;vV
The study of the average distance began with the chemist Wiener [72], who noticed
that the melting point of certain hydrocarbons is proportional to the sum of all dis-
tances between unordered pairs of vertices of the corresponding graph. This sum is
now called the Wiener number
or Wiener index of the graph and is denoted by .G/.
(Note that .G/ D n2 .G/.) The average distance of a graph has been used for
comparing the compactness of architectural plans [52]. Doyle and Graver [22] were
the first to define .G/ as a graph parameter.
Here are the values for some simple graphs.
Fact 9 1. Complete graphs: .Kn / D 1 (for n 2).

2. Complete bipartite graph: .Ka;b / D .ab C 2a2 C 2b 2 /=..a C b/.a C b 1//.
3. Path on n vertices: .Pn / D .n C 1/=3.
4. Cycle on n vertices: .Cn / D .n C 1/=4 if n is odd, and n2 =.4.n 1// if n
is even.
The result on the path is a discrete version of the fact that a pair of randomly
chosen points on a line of length 1 have expected distance 1=3.
One might expect some relationship between the radius or diameter of the graph
and its average distance. However, Plesnı́k [62] showed that, apart from the trivial
inequality .G/ diam.G/, no such relationship exists.
3.5.1 Bounds on the Average Distance
The following upper bound was established independently in [22, 24, 51].
Theorem 8. If G is a connected graph of order n, then
nC1
1 .G/ :
3
Equality holds if and only if G is a complete graph or a path.
Plesnı́k [62] improved this bound for two-edge-connected graphs to approxi-

mately n=4. Mahéo and Thuillier (see [30]) showed that .n/ n=.2/ C o.n/
if G is -connected.
A straightforward lower bound in terms of the order n and number of edges m
follows from the fact that there are exactly m pairs of vertices distance 1 apart and
the remaining pairs are distance at least 2 apart; see [24].
Fact 10 If G is a connected graph of n vertices and m edges, then
2m
.G/ 2 :
n.n 1/
Equality holds if and only if diam.G/ D 2.
Finding the upper bound for .G/ in terms of n and m is much more difficult.
S̆oltés [69] found a sharp upper bound:
Theorem 9. The maximum average distance of a connected graph of order n and

m edges, is achieved by the path-complete graph.
There are a few other graphs achieving the maximum average distance; the ex-
tremal graphs were characterized in [35].
Plesnı́k [62] found a sharp lower bound for the average distance of a graph in
terms of the order and diameter. However, the problem of finding the exact max-
imum average distance among all graphs of a given order and diameter remains
unsolved.
In Sect. 3.2.2 a bound on the diameter in terms of the distinct eigenvalues of
the adjacency matrix and of the Laplacian was given. Rodriguez and Yebra [64]
obtained a similar result for the average distance of G.
Theorem 10. Let G be a connected graph of n vertices and m edges, and let b be
the number of distinct eigenvalues of G. Then
2.b 1/m
.G/ b :
n.n 1/
The same result holds if b is the number of distinct Laplacian eigenvalues of G.
The spectrum (set of eigenvalues) does not necessarily determine a graph, not
even if the graph is a tree. McKay (see [54]) and Merris [53] showed, however, that
the average distance of a tree is determined by its spectrum.
Theorem 11. Let T be a tree of order n and let 0 D 1 2 n be the

Laplacian eigenvalues of T . Then
n
2 X 1
.T / D :
n1 i
i D2
Mohar [54] determined both upper and lower bounds on the average distance of
a graph in terms of some of its Laplacian eigenvalues.
3.5.2 The Average Distance and Other Graph Invariants
Considerable interest in average distance was generated by conjectures made by

the computer program GRAFFITI, developed by Fajtlowicz [27, 28]. One of these
was that .G/ is at most the independence number ˇ.G/ of the graph. Chung [14]
proved this conjecture.
Theorem 12. For any connected graph G, .G/ ˇ.G/.
This bound is attained if and only if G is a complete graph.

The computer program GRAFFITI also conjectured in [28] that every ı-regular
connected graph of order n has average distance at most n=ı. GRAFFITI later re-
stated this conjecture for graphs with minimum degree ı. It took 10 years before
Kouider and Winkler [46] proved the following.
Theorem 13. Let G be a connected graph of order n and minimum degree ı. Then
n
.G/ C 2:
ıC1
While this result is stronger than the GRAFFITI conjecture when n is much larger
than ı, it does not imply it. The conjecture was finally proven by Beezer, Riegsecker
and Smith [3].
3.5.3 Edge Removal and the Average Distance
In this section we look at the effect of edge removal on the average distance of a
graph. Since the removal of a bridge disconnects the graph, we consider only cyclic
edges e. We can measure the effect of e’s removal from G by considering either the
difference .G e/ .G/ or the ratio .G e/=.G/. In both cases the best
edge is one whose removal minimizes the quantity in question, and the worst edge
is one that maximizes the quantity. These questions are of importance in network
design: how badly would an edge failure affect the network, or how much would the
network suffer if we omitted a particular link to save costs.
If an edge e D ab is removed, the distance between a and b increases and no
decrease. Thus, the difference .G e/ .G/ for the best edge is
other distances
at least 1= n2 . Finding attainable upper bounds is more difficult. Favaron et al. [30]
found the maximum value for the difference.
Theorem 14. Let G be a graph of order n and e a cyclic edge of G. Then
1 p
.G e/ .G/ 2 1 n C O.1/:
3
We now consider the ratio .G e/=.G/. If G is a cycle, then the removal
of an edge increases the average distance by a factor of about 4=3. Winkler [73,
74] conjectured that for two-edge-connected graphs this is the maximum possible
ratio for the best edge. This became known as the “four-thirds conjecture”, and was
eventually proven by Bienstock and Györi [5]. Soon thereafter, Györi [36] extended
it and proved:
Theorem 15. The four-thirds conjecture holds for all connected graphs that are
not trees.
The ratio .G e/=.G/ can be arbitrarily large if a worst edge e is re-
moved (see [17]). To see this, consider the graph G obtained from a cycle Cr W
v0 v1 v2 : : : vr1 v0 , where r 6 is a fixed integer, by replacing vertices v0 and v3 by
complete graphs of order b.nr/=2c and d.nr/=2e whose vertices are adjacent to
vr1 ; v1 and v2 ; v4 , respectively. If n is large, then two randomly chosen vertices are
almost certainly in the union of the two complete graphs and the probability that they
are in the same (different) complete graph(s) and thus have distance 1 (3) tends to
1 1 1
2 . Hence .G/ D 2 3 C 2 1 C o.1/. By a similar argument p .G e/ D .r 3/=2 C
o.1/,
p where e is the edge v v
1 2 . Choosing r D b2 nc gives .G e/=.G/ D
O. n/. Favaron et al. [30] showed that this achieves the order of magnitude of the
maximum possible value.
Theorem 16. Let G be a connected graph of order n and e a cyclic edge of G. Then
p
.G e/ n
p C O.1/:
.G/ 2 3
The minimum average distance spanning tree (or MAD tree) of a connected
graph is a spanning tree having minimum average distance. Such a tree is also
referred to as a minimum routing cost tree. It is surprising that the removal of a
single best edge can increase the average distance by a factor of 4=3, but the removal
of m n C 1 best edges (where m is the number of edges in the graph) increases
the average distance by a factor less than 2. This fact was established by Entringer
et al. in [25] (and a related result is discussed in [76]).
Theorem 17. Let G be a connected graph of order n. Then there exists a vertex v
and spanning tree Tv that is distance preserving from v, such that
n1
.Tv / 2 .G/:
n
Johnson et al. [43] showed that the problem of finding a MAD tree in a graph is
NP-hard.
3.5.4 Vertex Removal and Average Distance
We now turn our attention to the effect of vertex removal on the average distance.
Unlike edge removal, vertex removal can both decrease or increase the average dis-
tance. For convenience, we express our results in terms of the Wiener index of the
graph. Swart [70] showed that the maximum possible decrease occurs when an end-
vertex is removed from a path.
Theorem 18. Let G be a graph of order n 2 and let v be a non-cut vertex of G.
Then
n.n 1/
.G/ .G v/ ;
2
with equality if and only if G is a path and v is an end-vertex of G.
S̆oltés [69] showed that the path-complete graphs are extremal for the ratio:
Theorem 19. Let G be a graph of order n and m n 1 edges, and let v be a
non-cut-vertex of G. Then
.G v/ .PKn1;m1 /
:
.G/ .PKn;m /
S̆oltés [69] also gave sharp upper bounds for .G v/ .G/ in terms of the
order and number of edges of G.
In some instances the removal of any vertex increases the average distance. For
example, the cycle Cn leaves Pn1 after the removal of any vertex. Thus the average
distance increases by a factor of nearly 4=3. Winkler [73, 74] conjectured that this
is the worst increase. This vertex version of the “four-thirds conjecture” was proven
asymptotically by Bienstock and Györi [5].
Theorem 20. Every connected graph has a vertex whose removal increases the av-
erage distance by a factor of at most 43 C O.n5 /.
Althöfer [1] proved the four-thirds conjecture for four-connected graphs, and
improved on it for graphs of higher connectivity.
3.6 Directed Graphs
Directed graphs behave somewhat differently to undirected graphs. In general we

assume that the digraph D is strongly connected; that is, there is a directed path
from each vertex to each other vertex. Note, however, that the radius of D might
well exist even though the digraph is not strongly connected and the diameter does
not exist. Further, it is possible that diam.D/ 2 rad.D/.
An oriented graph is one obtained by assigning directions to each edge of an
undirected graph. That is, it is a digraph without two-cycles. Füredi et al. [33] pro-
vided a lower bound on the number of arcs in an oriented graph of diameter 2.
Theorem 21. If an oriented graph has diameter 2, then m .1 o.1// n log n,

where n is the order and m the number of arcs.
Chvátal and Thomassen [15] studied the problem of taking an undirected graph
and finding an orientation of minimum diameter. Earlier, Robbins [63] had shown
that an undirected graph has a strong orientation if and only if it is bridgeless.
Chvátal and Thomassen showed that a bridgeless graph of diameter d has an orien-
tation of diameter at most 2d 2 C d . They also showed that determining whether a
graph has an orientation of diameter 2 is NP-complete.
3.6.1 The Average Distance of Digraphs
The average distance of digraphs has not received as much attention as the average
distance of graphs. Ng and Teh [57] gave a lower bound for the average distance
of a strong digraph D in terms of its order n and number of arcs m similar to the
one given for undirected graphs; they showed that .D/ 2 m=.n.n 1//
with equality if and only if diam.D/ D 2. For n 3 this bound is sharp if m
2n 2, the smallest number of arcs for which there exists a digraph of order n and
diameter 2.
Plesnı́k [62] proved the following upper bound on the average distance of a strong
digraph.
Theorem 22. Let D be a strong digraph of order n. Then .D/ n=2. Equality
holds if and only if D is a directed cycle.
It is natural to ask whether there are upper bounds on the average distance of a
digraph in terms of the order and minimum degree that are analogous to the ones
for graphs, but it turns out that in general these bounds do not carry over for general
digraphs.
In [19] the problem of finding an orientation of a two-edge-connected graph that
minimizes the average distance is studied.
3.6.2 Tournaments
A tournament is an oriented complete graph. Landau [47] showed that every tour-
nament has radius at most 2. It is easy to construct a tournament on n vertices with
diameter n 1. For n ¤ 4, it is also easy to construct a tournament with diameter 2.
Plesnı́k [62] gave bounds for average distance in strongly connected tournaments.
Theorem 23. Let Tn be a strongly connected tournament of order n 3. Then
3 nC4
.Tn / :
2 6
Equality holds if and only if Tn has diameter 2 (this is possible only if n ¤ 4) or if

Tn is the unique tournament of diameter n 1, respectively.
3.7 Convexity
Interval notions in graphs have led to the study of abstract convexity in graphs and
structural characterizations of several interesting graph classes.
Suppose V is a collection of points and M a collection of subsets of V . Then M
is a convexity if it contains both ; and V and it is closed under intersections. The
elements of M are called convex sets. If T 2 M, then a point v of T is an extreme
point of T if T n fvg 2 M. If S V , then the smallest convex set containing S
is called the convex hull of S . A convex geometry is a convexity with the additional
property that every convex set is the convex hull of its extreme points.
The most well-known graph convexity is defined in terms of geodesic intervals,
which were introduced in Sect. 3.4.2. Suppose G D .V; E/ is a connected graph.
Then a set S V is g-convex if Ig Œu; v S for all pairs u; v 2 S . Let Mg .G/ be
the collection of all g-convex sets of G. Then Mg .G/ is a convexity.
It is not difficult to see that a vertex v of a g-convex set S is an extreme vertex
of S if and only if v is simplicial in hS i, i.e., the neighbourhood of v in S induces a
complete graph. Farber and Jamison [29] characterized the class of graph for which
the g-convex sets form a convex geometry.
Fig. 3.6 The 3-fan y
u v w x
...
House Hole Domino A-graph
Fig. 3.7 Forbidden graphs
Theorem 24. Let G be a connected graph. Then Mg .G/ is a convex geometry if

and only if G is chordal without an induced 3-fan (see Fig. 3.6).
Every shortest path is necessarily induced, but not conversely. This leads to an-
other type of graph interval. The monophonic interval between a pair u; v of vertices
in a graph G, denoted by Im Œu; v, is the collection of all vertices that lie on an in-
duced u v path in G. A set S of vertices in a graph is m-convex if Im Œu; v S for
all pairs u; v 2 S . It is not difficult to see that the collection Mm .G/ of all m-convex
sets is a convexity, and that the extreme points of an m-convex set S are precisely
the simplicial vertices of hS i. Farber and Jamison [29] characterized those graphs
for which the m-convex sets form a convex geometry.
Theorem 25. Let G be a connected graph. Then Mm .G/ is a convex geometry if

and only if G is chordal.
Dragan et al. [23] defined another type of graph interval. If u; v is a pair of vertices
in a connected graph G, then the m3 -interval, denoted by Im3 Œu; v, between u and
v is the collection of all vertices that lie on some induced u v path of length at
least 3. A set S of vertices in G is m3 -convex if Im3 Œu; v S for all pairs u; v of
vertices in S . For a graph G, let Mm3 .G/ be the collection of all m3 -convex sets.
This collection of sets is certainly a convexity. Further, it can be shown that a vertex
v is an extreme point of an m3 -convex set S if and only if v is semisimplicial, i.e.,
not the centre of an induced P4 . The class of graphs for which the m3 -convex sets
form a convex geometry was characterized in [23].
Theorem 26. Let G be a connected graph. Then Mm3 .G/ is a convex geometry if
and only if G is (house, hole, domino, A)-free (see Fig. 3.7).
3.8 Metric Dimension
Distances in graphs have interesting applications. One such application is to

uniquely locate the position of a vertex in a network using distances. A vertex v
resolves a pair u; w of vertices in a connected graph G if d.u; v/ ¤ d.w; v/. A set of
vertices S is a resolving set of G, if every pair of vertices in G is resolved by some
vertex of S . A resolving set of minimum cardinality is called a metric basis of G
and its cardinality the metric dimension, d i m.G/, of G.
The metric dimension of a graph was introduced by Slater [66] and indepen-
dently by Harary and Melter [39]. Slater referred to the metric dimension as the
location number, and motivated its study by its application to the placement of a
minimum number of sonar/loran detecting devices in a network so that the position
of every vertex in the network could be uniquely described in terms of its distances
to the detecting devices. A problem in pharmaceutical chemistry once again led to
an independent discovery of the notion of a resolving set of a graph [12]. In [34] it
was noted that the metric dimension of a graph is NP-hard.
The formula for the metric dimension of trees has been discovered independently
by several authors (see [12, 39, 66]). The metric dimension of a nontrivial path is 1
since a leaf resolves the path. Suppose now that T is a tree that contains vertices of
degree at least 3. A vertex v of degree at least 3 is an exterior vertex if there is some
leaf u in T such that the v u path of T contains no vertices of degree exceeding
2 except for v. Let ex.T / denote the number of exterior vertices of T and `.T /
the number of leaves of T . It turns out that a metric basis for a tree can be found
by selecting, for each exterior vertex, all but one of its exterior leaves. That is, the
metric dimension of T is given in the following.
Theorem 27. For a tree T , dim.T / D `.T / ex.T /.
Apart from trees, very few exact results for the metric dimension of graphs are
known unless the graphs are highly structured (usually vertex transitive). It was
claimed in [45] that the metric dimension of the Cartesian product of k paths is k;
but indeed it was only verified that k is an upper bound in this case. In [65] a connec-
tion between the metric dimension of the n-cube and the solution to a coin weighing
problem was noted. This observation and results by Lindström [50] and Erdös and
Rényi [26] show that limn!1 dim.Qn / log n=n D 2, thereby disproving the claim
about n-cubes made in [45].
Motivated by the connection between coin weighing problems/strategies for
the Mastermind game and resolving sets in Cartesian products of certain classes
of graphs, the metric dimension of Cartesian products of graphs was investigated
in [10]. This paper introduces “doubly resolving sets” as a useful tool for obtaining
upper bounds on the metric dimension of graphs, particularly in Cartesian products
of graphs.
3.9 Algorithms and Complexity
3.9.1 Shortest Paths
To compute the distance between two vertices in an unweighted graph, one can use
a breadth-first search. To compute the distance between two vertices in a weighted
graph, one can use Dijkstra’s algorithm (which is in some sense a generalization of
breadth-first search). Note that the algorithm actually finds the distance from a given
start vertex to all other vertices.
ShortestPath (G:graph, a:vertex)
for all vertices v do currDis(v) WD infinity
currDis(a) WD 0
remainder WD [all vertices]
while remainder nonempty do f
let w be vertex in remainder with minimum value of currDis
remainder –D [w]
for all vertices v in remainder do
currDis (v) WD min (currDis(v), currDis(w)+length(w,v))
g
The running time of the above implementation of Dijkstra’s algorithm is O.n2 /.
By using suitable data structures this can be brought down for sparse graphs to
O.m C n log n/, where m is the number of edges.
3.9.2 All Pairs Shortest Paths
Suppose we wanted instead to calculate the shortest path between every pair of
vertices, for example, in order to compute the average distance. One idea would be to
run Dijkstra with every vertex as a start vertex. This takes O.n3 / time. There are two
dynamic programming algorithms with similar running times. One is due to Bellman
and Ford and the other to Floyd and Warshall. A variant of the former is used in
routing protocols in networks. We describe here the Floyd–Warshall algorithm [31].
Suppose the vertices are ordered 1 up to n. Then define

dm .u; v/ as the length of the shortest path between u and v that uses only the vertices
numbered 1 up to m as intermediates.
The desired value is dn .u; v/ for all u and v.
There is a formula for dm in terms of dm1 . For, the shortest u to v path that uses
only vertices labeled up to m, either uses vertex m or it doesn’t. Thus:

dm1 .u; v/
dm .u; v/ D min
dm1 .u; m/ C dm1 .m; v/
The resultant program iterates m from m D 0 to m D n 1.

3.10 Steiner Distances
Up to this point we have considered distance invariants that hinge on shortest paths
between pairs of vertices. In this section we give a brief overview of related invari-
ants that arise by considering the “cheapest” subgraph that connects a given set of
vertices.
3.10.1 Extending Distance Measures
Suppose G is a (weighted) graph and S a set of vertices in G. Then the Steiner dis-
tance for S , denoted by dG .S /, is the smallest weight of a connected subgraph of G
containing S . Such a subgraph is necessarily a tree, called a Steiner tree for S . The
problem of finding a Steiner tree for a given set S of vertices is called the Steiner
problem. In its two extremes, namely if jS j D 2 or jS j D n, the Steiner problem is
solved efficiently by well-known algorithms, for example, Dijkstra’s algorithm and
Kruskal’s minimum spanning tree algorithm, respectively. In general, however, this
problem is NP-hard (see [34]), even for unweighted bipartite graphs. Winter’s sur-
vey [75] provides a good overview of different heuristics that have been developed
for the problem as well as exact solutions for various graph classes.
The radius, diameter and average distance have a natural extension. For a given
vertex v in a connected (weighted) graph G and integer k (2 k n), the
k-eccentricity of v, denoted by ek .v/, is the maximum Steiner distance among all
k-sets of vertices in G that contain v. The k-radius, radk .G/, of G is the mini-
mum k-eccentricity of the vertices of G, and the k-diameter, diamk .G/, of G is
the maximum k-eccentricity. The average Steiner k-distance, k .G/ of G, is the
average Steiner distance among all k-sets of vertices of G. The k-distance of a
vertex v, denoted by ek .v/, is the sum of the Steiner distances of k-sets of vertices
containing v. The subgraph induced by vertices of minimum k-eccentricity is called
the k-centre of G and is denoted by Ck .G/; the subgraph induced by the vertices
of minimum k-distance is called the k-median and is denoted by Mk .G/.
The k-diameter is clearly an upper bound for the k-radius. No upper bound for
the k-diameter as a function of k and the k-radius of an (unweighted) graph is
known. For trees, the following generalization of Fact 2 was established in [13].
n
Theorem 28. For a tree T of order n and integer k n, diamk .T / n1 rad k .T /.
It was shown in [60], that the k-centre of a tree T can be found by successively
pruning leaves. If T has at most k 1 leaves, then T is its own k-centre. If T has
at least k leaves, then the k-centre is the i th derivative of T where i is the smallest
integer such that T .i / has at most k 1 leaves. This also shows that the k-centre of
a tree is contained in the .k C 1/-centre of a tree. (This containment does not hold
in general graphs). Moreover, it follows that k-centres of trees are connected.
The k-median of trees was shown in [4] to be connected. In the same paper it
was shown that a tree H of order p is the k-median of a tree if and only if p D 1; 2
or k or if H has at most k p C 1 leaves. An algorithm for finding the k-median

of a tree T was also described. If a tree has order at least 2k 1, then its k-median
consists of a single vertex or a pair of adjacent vertices. The k-centre and k-median
of a tree may be arbitrarily far apart (see [59]). Centrality structures that connect the
k-centre and k-median of a tree are introduced and studied in [59].
The average Steiner k-distance of a graph was first defined in [18]. In the same
paper it was shown that k .G/ l .G/ C kC1l .G/ for 2 l k 1, and that
the range of average Steiner k-distance of a graph is given by:
Theorem 29. If G is a connected graph of order n and 2 k n, then
k1
k 1 k .G/ .n C 1/;
kC1
with equality on the left if and only if G is .n C 1 k/-connected or k D n, and

equality on the right if and only if G is a path or n D k.
An efficient procedure that finds the average Steiner k-distance of a tree is de-
scribed in [18]. This algorithm counts the number of k-sets such that a given edge
belongs to a Steiner tree for the k-set. Moreover, it is shown that for a tree T ,
k .T / kl .T /= l for 2 l k 1 with equality if and only if T is a star,
and the lower bound given in Theorem 29 is improved to k.1 1=n/ for trees.
3.10.2 Steiner Intervals and Graph Convexity
The Steiner interval of a set X of vertices in a connected graph G, denoted by I.X /,

is the collection of all vertices that belong to some Steiner tree for X . A set S of
vertices is k-Steiner convex, denoted by gk -convex, if I.X / S for all subsets
X of S with jX j D k. Thus a g2 -convex set is a g-convex set. We call the extreme
vertices of a gk -convex set a k-Steiner simplicial vertex and abbreviate this by kS S .
The 3S S vertices are characterized in [11] as the vertices that are not the centre of
an induced claw, paw or P4 ; see Fig. 3.8.
Thus the 3S S vertices are semisimplicial. Several graph convexities related to
the g3 -convexity are introduced in [58] and those graphs for which these graph
Claw Paw P4
Fig. 3.8 Characterizing 3SS vertices

Fig. 3.9 The replicated x

twin C4 ’s
w
y
v
u z
convexities form convex geometries are characterized in the same paper. We state
here a characterization of those graphs for which the g3 -convex sets form a convex
geometry. A replicated-twin C4 is any one of the four graphs shown in Fig. 3.9 where
any subset of the dotted edges belongs to the graph. The collection of replicated-twin
C4 ’s is denoted by RC4 .
Theorem 30. Let G be a connected graph and Mg3 .G/ the collection of all
g3 -convex sets of G. Then Mg3 .G/ is a convex geometry if and only if d i am.G/
2 and if G is (house, hole, 3-fan, RC4 )-free.
Acknowledgments We would like to thank Peter Dankelmann for sharing his thoughts on average
distance with us.
References
1. Althöfer I (1990) Average distances in undirected graphs and the removal of vertices. J Combin
Theory B 48(1):140–142
2. Bandelt H-J, Mulder HM (1986) Distance–hereditary graphs. J Combin Theory B 41:182–208
3. Beezer RA, Riegsecker JE, Smith BA (2001) Using minimum degree to bound average dis-
tance. Discrete Math 226:365–371
4. Beineke LW, Oellermann OR, Pippert RE (1996) On the Steiner median of a tree. Discrete
Appl Math 68:249–258
5. Bienstock D, Györi E (1988) Average distance in graphs with removed elements. J Graph
Theory 12(3):375–390
6. Bonato A (2005) A survey of models of the web graph. In: Combinatorial and algorith-
mic aspects of networking, vol 3405, Lecture notes in computer science. Springer, Berlin,
pp 159–172
7. Buckley F, Harary F (1990) Distance in graphs. Addison-Wesley Publishing Company
Advanced Book Program, Redwood City, CA
8. Buckley F, Lewinter M (1988) A note on graphs with diameter-preserving spanning trees.
J Graph Theory 12(4):525–528
9. Buckley F, Miller Z, Slater PJ (1981) On graphs containing a given graph as center. J Graph
Theory 5:427–432
10. Cáceres J, Hernando C, Mora M, Pelayo IM, Puertas ML, Seara C, Wood DR (2007) On the
metric dimension of the cartesian product of graphs. SIAM J Discrete Math 21(2):423–441
11. Cáceres J, Oellermann OR (2009) On 3-Steiner simplicial orderings. Discrete Math 309:
5828–5833
12. Chartrand G, Eroh L, Johnson MA, Oellermann OR (2000) Resolvability in graphs and the
metric dimension of a graph. Discrete Appl Math 105:99–113
13. Chartrand G, Oellermann OR, Tian S, Zou HB (1989) Steiner distance in graphs. Časopis Pro
Pěstovánı́ Matematiky 114(4):399–410
14. Chung FRK (1988) The average distance and the independence number of a graph. J Graph
Theory 12:229–235
15. Chvátal V, Thomassen C (1978) Distances in orientations of graphs. J Combin Theory B
24:61–75
16. Cockayne EJ, Hedetniemi SM, Hedetniemi ST (1981) Linear algorithms for finding the Jordan
center and path center of a tree. Transport Sci 15:98–114
17. Dankelmann P Average distance in graphs – a survey, (submitted)
18. Dankelmann P, Oellermann OR, Swart HC (1996) The average Steiner distance of a graph.
J Graph Theory 22(1):15–22
19. Dankelmann P, Oellermann OR, Wu J-L (2004) Minimum average distance of strong orienta-
tions of graphs. Discrete Appl Math 143:204–212
20. D’Atri A, Moscarini M (1988) Steiner trees and connected domination. SIAM J Discrete Math
17:521–538
21. Dirac GA (1961) On rigid circuit graphs. Abh Math Sem Univ Hamburg 25:71–76
22. Doyle JK, Graver JE (1977) Mean distance in a graph. Discrete Math 7(2):147–154
23. Dragan FF, Nicolai F, Brandstädt A (1999) Convexity and HHD-free graphs. SIAM J Discrete
Math 12:119–135
24. Entringer RC, Jackson DE, Snyder DA (1976) Distance in graphs. Czech Math J 26:283–296
25. Entringer RC, Kleitman DJ, Székely LA (1996) A note on spanning trees with minimum
average distance. Bull Inst Combinator Appl 17:71–78
26. Erdös P, Rényi A (1963) On two problems of information theory. Magyar Tud Akad Mat
Kutató Int Közl 8:229–243
27. Fajtlowicz S (1986) On two conjectures of GRAFFITI. Congr Numer 55:51–56
28. Fajtlowicz S (1987) On conjectures of GRAFFITI II. Congr Numer 60:187–197
29. Farber M, Jamison RE (1986) Convexity in graphs and hypergraphs. SIAM J Algebra Discrete
Methods 7:433–444
30. Favaron O, Kouider M, Mahéo M (1989) Edge-vulnerability and mean distance. Networks
19(5):493–504
31. Floyd RW (1962) Algorithm 97: shortest path. Commun ACM 5:345
32. Freeman LC (1978/1979) Centrality in social networks: conceptual clarification. Soc Networks
1:215–239
33. Füredi Z, Horak P, Pareek CM, Zhu X (1998) Minimal oriented graphs of diameter 2. Graph
Combinator 14:345–350
34. Garey MR, Johnson DS (1979) Computers and intractibility: a guide to the theory of
NP-completeness. W.H. Freeman and Company, New York
35. Goddard W, Swart CS, Swart HC (2005) On the graphs with maximum distance or k-diameter.
Math Slovaca 55(2):131–139
36. Györi E (1988) On Winkler’s four thirds conjecture on mean distance in graphs. Congr Numer
61:259–262
37. Hammer PL, Maffray F (1990) Completely separable graphs. J Discrete Appl Math 27:85–99
38. Harary F (1962) The maximum connectivity of a graph. Proc Natl Acad Sci USA 48:
1142–1146
39. Harary F, Melter RA (1976) On the metric dimension of a graph. Ars Combinatoria 2:191–195
40. Harary F, Norman RZ (1953) The dissimilarity characteristic of Husimi trees. Ann Math (2)
58:134–141
41. Howorka E (1977) A characterization of distance-hereditary graphs. Quart J Math Oxford
28:417–420
42. Jeong H, Mason SP, Barabási A-L, Oltvai ZN (2001) Lethality and centrality in protein net-
works. Nature 411:41–42
43. Johnson DS, Lenstra JK, Rinnooy-Kan AHG (1978) The complexity of the network design
problem. Networks 8:279–285
44. Jordan C (1869) Sur les assembalges des lignes. J Reine Angew Math 70:185–190
45. Khuller S, Raghavachari B, Rosenfeld A (1996) Landmarks in graphs. Discrete Appl Math
70(3):217–229
46. Kouider M, Winkler P (1997) Mean distance and minimum degree. J Graph Theory 25:95–99
47. Landau HG (1953) On dominance relations and the structure of animal societies. III. The
condition for a score structure. Bull Math Biophys 15:143–148
48. Laskar R, Shier D (1983) On powers and centers of chordal graphs. Discrete Appl Math
6(2):139–147
49. Lekkerkerker CG, Boland J (1962) Representation of a finite graph by a set of intervals on the
real line. Fund Math 51:45–64
50. Lindström B (1964) On a combinatory detection problem. I. Magyar Tud Akad Mat Kutató
Int Közl 9:195–207
51. Lovász L (1979) Combinatorial problems and exercises. Akadémiai Kiadó, Budapset
52. March L, Steadman P (1974) The geometry of environment: an introduction to spatial organi-
zation in design. MIT Press, Cambridge, MA
53. Merris R (1989) An edge version of the matrix-tree theorem and the Wiener index. Linear
Multilinear Algebra 25(4):291–296
54. Mohar B (1991) Eigenvalues, diameter, and mean distance in graphs. Graph Combinator
7(1):53–64
55. Mulder HM (1980) The interval function of a graph. Mathematical Centre Tracts, Amsterdam
56. Mulder HM (1980) n-cubes and median graphs. J Graph Theory 4:107–110
57. Ng CP, Teh HH (1966/1967) On finite graphs of diameter 2. Nanta Math 1:72–75
58. Nielsen M, Oellermann OR (2009) Steiner trees and convex geometries. SIAM J Discrete
Math 23:680–693
59. Oellermann OR (1995) From Steiner centers to Steiner medians. J Graph Theory 20(2):
113–122
60. Oellermann OR, Tian S (1990) Steiner centers in graphs. J Graph Theory 14(5):585–597
61. Plesnı́k J (1975) Note on diametrically critical graphs. In: Recent advances in graph the-
ory (Proceedings of the 2nd Czechoslovak symposium, Prague, 1974). Academia, Prague,
pp 455–465
62. Plesnı́k J (1984) On the sum of all distance in a graph or digraph. J Graph Theory 8:1–24
63. Robbins HE (1939) Questions, discussions, and notes: a theorem on graphs, with an application
to a problem of traffic control. Am Math Mon 46(5):281–283
64. Rodriguez JA, Yebra JLA (1999) Bounding the diameter and the mean distance of a graph from
its eigenvalues: Laplacian versus adjacency matrix methods. Discrete Math 196(1–3):267–275
65. Sebö A, Tannier E (2004) On metric generators of graphs. Math Oper Res 29(2):383–393
66. Slater PJ (1975) Leaves of trees. Congr Numer 14:549–559
67. Slater PJ (1978) Centers to centroids in graphs. J Graph Theory 2:209–222
68. Slater PJ (1981) Centrality of paths and vertices in a graph: cores and pits. In: The theory and
applications of graphs. Wiley, New York, pp 529–542
69. S̆oltés L (1991) Transmission in graphs: a bound and vertex removing. Math Slovaca 41(1):
11–16
70. Swart CS (1996) Distance measures in graphs and subgraphs. Master’s thesis, University of
Natal, Durban
71. Vizing VG (1967) On the number of edges in a graph with a given radius. Dokl Akad Nauk
SSSR 173:1245–1246
72. Wiener H (1947) Structural determination of paraffin boiling points. J Am Chem Soc 69(1):
17–20
73. Winkler P (1986) Mean distance and the four thirds conjecture. Congr Numer 54:53–61
74. Winkler P (1989) Graph theory in memory of G.A. Dirac. In: Proceedings of meeting in
Sandbjerg, Denmark, 1985, Ann Discrete Math, North-Holland, Amsterdam
75. Winter P (1987) Steiner problem in networks: a survey. Networks 17:129–167
76. Wong R (1980) Worst-case analysis of network design problem heuristics. SIAM J Algebra
Discrete Methods 1:51–63
77. Zelinka B (1968) Medians and peripherians of trees. Arch Math (Brno) 4:87–95
Chapter 4
Domination in Graphs
Nawarat Ananchuen, Watcharaphong Ananchuen,

and Michael D. Plummer
Abstract A set of vertices S in a graph G dominates G if every vertex in G is

either in S or adjacent to a vertex in S . The size of any smallest dominating set is
called the domination number of G. Two variants on this concept that have attracted
recent interest are total domination and connected domination. A set of vertices S
is a total dominating set if every vertex in the graph is adjacent to a vertex of S
and S is a connected dominating set if it is dominating and, in addition, induces a
connected subgraph. The size of any smallest total dominating set in G is called the
total domination number of G and the size of a smallest connected dominating set
is the connected domination number of G. These simple, yet wide-ranging, graph-
theoretic concepts have a multitude of real-world applications. There are already in
print several surveys of results on domination; therefore, in this chapter we adopt
a slightly different approach. We begin by surveying results on bounding the three
domination numbers. We then focus on criticality concepts for domination. The two
types of criticality most widely studied to date are graphs for which the domination
number decreases upon the addition of any missing edge and the graphs for which
the domination number decreases upon the deletion of any vertex. Recently, there
has been increased activity in the study of these critical concepts and we survey
these new results, focusing especially upon matching in critical graphs.
Keywords Domination Total domination Connected domination Edge critical

Vertex critical Matching
N. Ananchuen ()
Department of Mathematics, Faculty of Science, Silpakorn University,
Nakorn Pathom 73000, Thailand

74 N. Ananchuen et al.
4.1 Introduction
The study of domination and related topics is one of the fast-developing areas in
graph theory. To date, at least 2000 published research papers on domination have
appeared in various journals. Excellent comprehensive collections of results to-
gether with open problems in this area were published in 1998 in two books [71,72].
The aim of this chapter is to provide a fundamental understanding of three types
of domination and to present some recent results, most of which concern graphs
edge- (or vertex-) critical with respect to each. We cannot, however, include all
such results due to space limitations, but instead provide a guide to the relevant
references.
For the most part, our terminology follows that of Bondy and Murty [22]. Thus
G is a graph with the vertex set V .G/, edge set E.G/; .G/ vertices, ".G/ edges,
(vertex) connectivity .G/, and independence number ˛.G/. We denote the comple-
ment of a graph G by G. A graph G is said to be even (odd) if .G/ is even (odd).
For S V .G/; GŒS denotes the subgraph induced by S . For v 2 V .G/; NG .v/
denotes the set of all vertices adjacent to vertex v and is called the neighborhood
of v. The closed neighborhood of S v; NG Œv is defined by NG Œv D NG S.v/ [ fvg. If
S V .G/, then NG .S / denotes x2S NG .x/ and NG ŒS denotes x2S NG Œx.
The degree of v 2 V .G/ denoted by dG .v/ is defined to be jNG .v/j. Let ı.G/
and .G/ denote the minimum degree and maximum degree of G, respectively. As
usual, Kn ; Cn , and Pn denote a complete graph, a cycle, and a path of order n, re-
spectively, and Km;n denotes a complete bipartite graph with bipartite sets of size
m and n. We denote the number of components (odd components) of a graph G by
!.G/ (!o .G/).
A vertex v 2 V .G/ is called an endvertex (or leaf or pendant vertex) if dG .v/ D 1.
If fug D NG .v/, then u is a support vertex of v and the edge uv is called a pen-
dant edge. For vertices u and v of G; d.u; v/ denotes the distance from u to v.
The eccentricity of a vertex v denoted by e.v/ is maxfd.u; v/ju 2 V .G/g. The
radius of G denoted by rad.G/ and the diameter of G denoted by diam.G/ are
minfe.v/jv 2 V .G/g and maxfe.v/jv 2 V .G/g, respectively.
If S and T are subsets of V .G/, we say that S dominates T if T NG ŒS . In
particular, if S dominates V .G/ then S is said to be a dominating set for G; that is,
S V .G/ is a dominating set for G if every vertex of G not in S is adjacent to
one in S . The cardinality of any smallest dominating set in G is denoted by .G/.
We call a dominating set with cardinality .G/, a .G/-set. It is easy to see that for
n 1; .Kn / D .K1;n/˙D1 and if m; n 2, then .Km;n / D 2. Further, for
n 3; .Pn / D .Cn / D n3 .
The concept of domination, in both the theoretical and applied sense, has received
the attention of many researchers. It has been used to study the optimal location
of facilities such as radar stations (see [17]), hardware or software resources (see
[61, 62]), and communication networks (see [97]). Typical problems are concerned
with the minimum cardinality of a subset of a set of facilities, such as radar sta-
tions and communication centers, which collectively monitor all the facilities or
perhaps can transmit messages to every facility in the network. In graph-theoretic
4 Domination in Graphs 75
terms, the minimum cardinality of such a set of monitoring facilities is called the
domination number. In the real world, it might be additionally required that such
a set of monitors be able to communicate among themselves in case of a security
breach or perhaps each of these monitors must be reached by at least one other mon-
itor. In these two special cases, the minimum cardinality of a monitor set is called
the connected domination number and the total domination number, respectively.
This chapter is divided into six sections. Section 4.2 contains some fundamental
results concerning upper bounds for the classical domination number. Two of the
more intensely studied variants of classical domination – connected domination and
total domination – are the focus of Sect. 4.3.
The concept of criticality has proved very useful in the past when applied to such
important graph parameters as connectivity, chromatic number, and independence
number. Only very recently has this idea been applied to domination. For the first
time, a number of results concerning criticality of various types of domination are
assembled in Sects. 4.4 and 4.5. Finally, we conclude the chapter with Sect. 4.6 in
which we suggest some directions for future study.
4.2 Bounds on the Domination Number
Clearly, V .G/ is a dominating set for G. Thus .G/ .G/. It is easy to see that
.G/ D .G/ if G is complete. If the graph under consideration has no isolated ver-
tices, then a bound on its domination number can be improved considerably. Many
researchers have been concerned with establishing upper bounds on the domination
number since determining the domination number of a graph is an NP-complete
problem (see [31, 65] or [71], page 34). Various bounds on the domination number
are given in terms of other graph parameters, for example, in terms of order and min-
imum degree (see [16, 29, 30, 40, 78, 104, 111, 117]), diameter (see [48, 67, 71, 103]),
size and the minimum degree (see [79, 119]), and others (see [90, 102, 116]). The
reader is directed to [42, 44, 71, 77, 96] for more on these bounds.
We now state some fundamental results on bounding the domination number.
The first result was given by Ore in 1962.
Theorem 1 ([111]). Let G be a graph with ı.G/ 1. Then .G/ 12 .G/.
Payan and Xuong [114] characterized the graphs that achieve the bound in The-
orem 1, as we show in Theorem 2. Before stating this theorem we need a new
definition. The corona of a graph H denoted by H ı K1 is the graph obtained from
H by adding a pendant edge to each vertex of H .
Theorem 2 ([114]). Let G be a graph with ı.G/ 1. Then .G/ D 12 .G/ if and
only if each component of G is isomorphic to C4 or to H ı K1 for some connected
graph H .
The bound in Theorem 1 may be improved if the minimum degree of a graph is
increased as shown in the following theorems.
Fig. 4.1 Graphs G with ı.G/ 2 and .G/ > 25 .G/
Theorem 3 ([104]). Suppose G is a connected graph with ı.G/ 2. Then G is

either one of seven graphs in Fig. 4.1 or .G/ 25 .G/.
When certain cycle lengths are forbidden, the bound in Theorem 3 was improved
by Frendrup et al. [60] and Harant and Rautenbach [70].
Theorem 4 ([70]). If G is a graph with ı.G/ 2 and G does not contain cycles
of length 4; 5; 7; 10, or 13, then .G/ 38 .G/.
As a corollary of Theorem 4, an upper bound on the domination number for
bipartite graphs follows.
Corollary 1 ([70]). If G is a bipartite graph with ı.G/ 2 and G does not contain
cycles of length 4 or 10, then .G/ 38 .G/.
Theorem 5 ([117]). If G is a graph with ı.G/ 3, then .G/ 38 .G/.
Beside lestablishing
m Theorem 5, Reed [117] conjectured that if G is 3-regular,
.G/ .G/ 3
. This conjecture is true for Hamiltonian 3-regular graphs (see
[46]), but it was recently shown to be false in general by Kostochka and Stodol-
sky [92]. They constructed a connected 3-regular graph G of order 60 having
.G/ D 21. Further, they found a sequence of connected 3-regular graphs fGk g1 kD1
with .Gk / D 46k and .Gk / 16k such that limk!1 .G k/
.Gk / 8
23 D 1
3 C 1
69 .
However, as they pointed out, their examples contain cutedges. But even more
recently, the two authors, and, independently, Kelmans (unpublished private com-
munication), have obtained 2-connected examples. However, it is unknown at this
point if Reed’s conjecture holds for 3-connected 3-regular graphs. In a related work,
Kawarabayashi et al. [90] proved that a 2-edge-connected 3-regular graph G of girth
at least 3k satisfies .G/ 3kC2
9kC3 .G/.
Kostochka and Stodolsky [93] have also proved the following result.
Theorem 6 ([93]). If G is a connected 3-regular graph with .G/ > 8, then
.G/ 11
4
.G/.
The next two results provide bounds on the domination number of graphs with
minimum degree 4 and 5.
Theorem 7 ([98]). If G is 4-regular, then .G/ 4
11
.G/.
Theorem 8 ([140]). If G is a graph with ı.G/ 5, then .G/ 5

14 .G/.
In 1998, Clark et al. [40] established an upper bound on the domination number
based on the degree sequence of a graph. Their result stated in Theorem 9 has proved
to be a useful tool in establishing Theorem 10 by Hellwig and Volkmann [78].
Theorem 9 ([40]). Suppose G is a graph with ı.G/ 1. Then

Qı.G/C1
.G/ 1 kD1 kC k 1 .G/.
ı.G/
Theorem 10 ([78]). Suppose G is a connected graph:

(i) If ı.G/ D 6, then .G/ 17
6
.G/.
1 ˘
(ii) If ı.G/ 7, then .G/ 3 .G/ .
The upper bound on the domination number can be very small if the graphs under
consideration are planar or are of small diameter.
Theorem 11 ([71], page 55). Let G be a graph with diam.G/ D 2. Then .G/
ı.G/.
The bound in Theorem 11 follows immediately from the fact that, in a graph G
of diameter 2, a neighborhood of a vertex v 2 V .G/ dominates G for any v. This
bound was improved by Hellwig and Volkmann [78] as follows.
Theorem 12 ([78]). Let G be a graph with diam.G/ D 2. Then
(i) .G/ .G/.
(ii) If G contains an induced complete graph Kı.G/ with all its vertices of degree
ı.G/, then .G/ 3.
Hellwig and Volkmann [78] also established an upper bound on the domination
number of graphs having diameter 2 in terms of their order. Further, they presented
several sufficient conditions for .G/ ı.G/ 1 to hold in graphs G having diam-
eter 2. They also posed the problem of characterizing graphs G having diameter 2
with .G/ D ı.G/.
MacGillivray and Seyffarth [103] established an upper bound for planar graphs
having small diameter.
Theorem 13 ([103]). Suppose G is a planar graph. Then
(i) If diam.G/ D 2; .G/ 3.
(ii) If diam.G/ D 3; .G/ 10.
MacGillivray and Seyffarth [103] also showed that the bound in Theorem 13(i)
is best possible since the planar graph G in Fig. 4.2 is of diameter 2 and .G/ D 3.
They pointed out that the bound in Theorem 13(ii) might not be best possible. How-
ever, they have no example of a planar graph having diameter 3 and domination
number greater than 6. They also gave examples of planar graphs of diameter 4 with
arbitrarily large domination numbers.
In 2002, Goddard and Henning [67] improved Theorem 13 as follows.
Fig. 4.2 The planar graph G

with diam.G/ D 2
and .G/ D 3
G:
Theorem 14 ([67]). Suppose G is a planar graph:

(i) If diam.G/ D 2, then either .G/ 2 or G is isomorphic to the graph in
Fig. 4.2.
(ii) If diam.G/ D 3 and rad.G/ D 2, then .G/ 6.
(iii) If diam.G/ D 3 and G is sufficiently large, then .G/ 7.
The bounds in Theorem 14(ii) and (iii) were slightly improved by Dorfling
et al. [48].
Theorem 15 ([48]). Suppose G is a planar graph with diam.G/ D 3. Then
(i) .G/ 9.
(ii) If rad.G/ D 2, then .G/ 5.
(iii) If G is sufficiently large, then .G/ 6.
4.3 Two Other Types of Domination
The concept of domination can be extended to yield new concepts by combining

it with other graph parameters. For example, suppose that the dominating set S
has an additional property such as being connected (it is then called a connected
dominating set), being independent (it is then called an independent dominating
set), having no isolated vertex (it is then called a total dominating set), or being a
clique (it is then called a dominating clique), etc. Hence, there are lots of variations
on domination. In this section we concentrate on two of the more widely studied
variants of domination: total domination and connected domination. The reader is
directed to [71, 72] and also [42, 77, 96] which deal with other types of domination.
A dominating set S of a graph G is said to be a total dominating set if GŒS has
no isolated vertex; that is, a subset S of V .G/ is a total dominating set for G if every
vertex in V .G/ is adjacent to a vertex of S . The total domination number of a graph
G, denoted by t .G/, is the minimum size of any total dominating set of G. We
call a total dominating set with cardinality t .G/ a t .G/-set. Note that since only
graphs with no isolated vertex can contain a total dominating set, henceforth when
referring to total domination, we assume all graphs under consideration have no iso-
lates. Clearly, a graph with no isolated vertex contains at least one total dominating
set, namely the set of all its vertices. It follows by definition that for any graph G
with no isolated vertex, .G/ t .G/ and t .G/ 2: It is easy to see that for
n 2; t .Kn / D 2 and for m; n 1; t .Km;n / D 2. Zwierzchowski [144] com-
puted the total domination numbers of a path Pn and a cycle Cn .
Lemma 1 ([144]). For integer n 3,

8n
ˆ
ˆ 2; for n 0.mod4/;
< nC1
; for n 1.mod4/;
t .Pn / D t .Cn / D nC22
ˆ 2 ; for n 2.mod4/;
:̂ nC1
2 ; for n 3.mod4/:
Total domination was first studied by Cockayne et al. [43] in 1980. Since then this
topic has received much attention. An excellent survey of this topic may be found in
the two books by Haynes et al. [71,72]. A more recent survey is due to Henning [82].
As is the case with domination number, determining the total domination number
of a graph is also NP-complete (see [82]), so bounds on total domination number
have been a natural subject for investigation. We begin with a property of minimum
dominating sets in graphs established by Bollobás and Cockayne [20] which leads
to a relationship between domination and total domination numbers in a graph with
no isolated vertex.
Theorem 16 ([20] or see [82]). Every graph G with no isolated vertex has a mini-
mum dominating set D in which each vertex v 2 D has the property that there exists
a vertex v0 2 V .G/ D that is adjacent to v, but to no other vertex of D.
Theorem 17 ([82]). For every graph G with no isolated vertex, .G/ t .G/
2.G/.
The next result concerns an upper bound on the total domination number in terms
of the order of the graph.
Theorem 18 ([43]). If G is a connected graph with .G/ 3, then t .G/

2
3
.G/.
The 2-corona of a graph H , denoted by H ı P2 , is the graph obtained from H

by adding a path of length 2 to each vertex of H . Brigham et al. [23] characterized
graphs achieving the bound in Theorem 18 as follows.
Theorem 19 ([23]). Let G be a connected graph with .G/ 3. Then t .G/ D

2
3
.G/ if and only if G is C3 ; C6 or H ı P2 for some connected graph H .
Henning [82] established an upper bound on the total domination number in

terms of minimum degree and order.
Theorem 20 ([82]). If G is a graph with ı.G/ 1, then

t .G/ 1Cln.ı.G//
ı.G/
.G/.
When the minimum degree is increased, the bound on the total domination num-
ber in Theorems 18 and 20 can be improved.
Theorem 21 ([80]). If G is a connected graph with ı.G/ 2 and G …

fC3 ; C5 ; C6 ; C10 g, then t .G/ 47 .G/.
The bound in Theorem 21 was improved by Lam and Wei [94] by imposing an
extra condition on the graph.
Theorem 22 ([94]). Suppose G is a graph with ı.G/ 2. Then t .G/ 12 .G/

if either dG .u/ C dG .v/ 5 for every two adjacent vertices u and v of G or every
component of the subgraph of G induced by its set of vertices having degree 2 has
size at most one.
Recently, Henning and Yeo [87] improved the bound in Theorem 21 for a con-
nected graph G with ı.G/ 2 and .G/ 3 to 12 ..G/ C p/ where p is defined
in terms of the sum of the number of paths having certain specified properties. For
more details, the reader is directed to [87]. The next two results give upper bounds
on the total domination number when the minimum degree is at least 3 or 4, respec-
tively. Note that Theorem 23 can also be regarded as a corollary of Theorem 22.
Theorem 23 ([15, 94, 127]). If G is a graph with ı.G/ 3, then t .G/ 12 .G/.
Theorem 24 ([127]). If G is a graph with ı.G/ 4, then t .G/ 37 .G/.
If the graph under consideration is planar, the next result is an immediate conse-
quence of Theorem 14(i).
Theorem 25 ([67]). If G is a planar graph with diam.G/ D 2, then t .G/ 3.
Theorem 26 ([48]). Suppose G is a planar graph with diam.G/ D 3. Then

(i) t .G/ 10.
(ii) If rad.G/ D 2, then t .G/ 5.
(iii) If G is sufficiently large, then t .G/ 7.
Upper bounds on the total domination number have also been established in terms
of the size of the graph ([81,121]), the girth ([47,74,86]), and the size of a maximum
matching ([83, 85]). Bounds in the presence of forbidden subgraphs such as K1;3
([53–55, 85]) have been studied as well.
We now turn our attention to connected domination. A dominating set S for G
is a connected dominating set if GŒS is connected. The minimum cardinality of a
connected dominating set is called the connected domination number of G and is
denoted by c .G/. We call a connected dominating set with cardinality c .G/, a
c .G/-set. Note that since a graph must be connected to have a connected dominat-
ing set, henceforth when referring to connected domination, we assume all graphs
under consideration are connected. It follows directly from the definitions that for a
connected graph G; .G/ c .G/ and if .G/ D 1, then c .G/ D .G/. Further,
a connected dominating set of size at least 2 is a total dominating set for G. Hence,
.G/ t .G/ c .G/ for a connected graph G with .G/ < .G/ 1. It then
follows that for a connected graph G and for k 2 f2; 3g; t .G/ D k if and only if
c .G/ D k.
Connected domination seems to have been studied first by Sampathkumar and
Walikar [118] who attribute the terminology to Hedetniemi (see [71, 72, 77]). The
algorithmic aspects of connected domination were first discussed by Garey and

Johnson in [65] where they claimed that determining the connected domination
number of a graph is NP-complete, even when the graph is planar and regular of
degree 4. For a summary of the algorithmic status of connected domination for var-
ious special graph classes, see [45, 50, 108, 138]. For relations between connected
domination and other graph parameters (see [19, 56, 76, 100, 110, 120]).
We begin with the connected domination number for some special graph classes.
Theorem 27 ([118]).
(i) c .Kn / D 1.
1; if either m D 1 or n D 1,
(ii) c .Km;n / D
2; if m; n 2.
(iii) c .Pn / D c .Cn / D n 2 for n 3.
(iv) For any tree T with .T / 3; c .T / D .T / p.T /, where p.T / denotes
the number of endvertices in T .
Sampathkumar and Walikar [118] pointed out that the connected domination
number of a graph is bounded above by the connected domination number of any
spanning subgraph. They then used this fact together with Theorem 27(iv) to estab-
lish an upper bound on the connected domination number of graphs.
Theorem 28 ([118]). For a connected graph G with .G/ 3; c .G/
.G/ 2:
The same two authors [118] also provided a bound for the connected domination
number in terms of the maximum degree, the order, and the size of the graph.
j k
.G/
Theorem 29 ([118]). For a connected graph G; .G/C1 c .G/ 2".G/
.G/:
Note that a graph G containing a vertex of degree .G/ 1 satisfies the lower
bound and a path Pn of order n satisfies the upper bound. Hence, both these bounds
are sharp.
In 1984, Hedetniemi and Laskar [76] observed a relationship between the con-
nected domination number and the number of endvertices in a spanning tree. They
then gave an upper bound on the connected domination number in terms of the
maximum degree of the graph.
Theorem 30 ([76]). Let G be a connected graph. Then
(i) c .G/ C p.T / D .G/ where p.T / is the maximum number of endvertices in
any spanning tree of G.
(ii) c .G/ .G/ .G/.
Kleitman and West [91] provided a result concerning the minimum number of
leaves that a spanning tree in a connected graph with specified minimum degree can
have. Combining their result together with Theorem 30(i), an upper bound on the
connected domination number of graphs can be obtained.
Theorem 31 ([91]). Let G be a connected

j graph
k with ı.G/ k. Then G contains
.G/
a spanning tree with at least .G/ 3 kC1 C 2 leaves.
k page 163). If G is a connected graph with ı.G/ k, then

Corollary 2j ([71],
.G/
c .G/ 3 kC1 2.
Bounds on the connected domination number have been obtained by Duchet and
Meyneil [49] (in terms of the domination number) and by Favaron and Kratsch [56]
(in terms of the total domination number).
Theorem 32 ([49]). For a connected graph G; c .G/ 3.G/ 2.
Theorem 33 ([56]). For a connected graph G; c .G/ 2t .G/ 2.
Before closing this section, we must mention the famous conjecture on domina-
tion due to Vizing [135] which remains unsettled.
Conjecture 1. For any graphs G and H , if G H denotes the Cartesian product

of G and H , then .G/.H / .G H /:
The best bound known in this sense is due to Clark and Suen [41].
Theorem 34 ([41]). For any graphs G and H , .G/.H / 2.G H /.
Vizing’s conjecture may also be made for total and for connected domination. For
total domination, Ho [88] has established the same bound as that of Clark and Suen.
Theorem 35 ([88]). For any graphs G and H , t .G/t .H / 2t .G H /:
As far as the authors know, no analogous bound has been established for the con-
nected domination version of Vizing’s conjecture.
4.4 Results on Criticality
In studying a graph parameter P , it is often useful to study a more restricted class

of graphs, the so-called critical graphs. That is, a graph with parameter P , but in
which an alteration of a certain type (such as edge addition, edge deletion, or vertex
deletion) results in a graph no longer having property P .
In this section, we study graphs edge-critical and vertex-critical with respect to
graph parameter P where P 2 f; t ; c g. Edge-critical graphs are graphs in which
P decreases upon the addition of any missing edge while vertex-critical graphs are
graphs in which P decreases when any vertex is removed. More precisely, we say
that a graph G is k-P -edge-critical if P .G/ D k and P .G C e/ < k for every edge
e 2 E.G/ and G is k-P -vertex-critical if P .G/ D k but for each vertex v of G,
P .G v/ < k. If we do not specify a value k, we simply say that a graph is
P -edge-critical or P -vertex-critical. Of the two concepts of edge-criticality and
vertex-criticality, edge-criticality has received more attention as we show in the

coming subsections. Although the class of k-P -edge-critical graphs and the class
of k-P -vertex-critical graphs are not the same, note that every k-P -vertex-critical
graph can be extended to one that is both vertex- and edge-critical by successively
adding edges that do not decrease P (see [24]). For each P 2 f; c g, it is well
known that 1-P -edge-critical graphs are precisely the complete graphs Kn for all
positive integers n, whereas the only 1-P -vertex-critical graph is K1 .
Remark 1. Suppose G is a k-P -edge-critical graph where P 2 f; c ; t g and u

and v are nonadjacent vertices of G. Then at least one of u and v is in a P .G/-set
for G C uv. Further, if P D , then exactly one of u and v is in a .G/-set for
G C uv.
4.4.1 k--Edge-Critical Graphs
k--edge-critical graphs were first studied by Sumner and Blitch [126] in 1983.
Most of their results were concerned with the cases 2 k 3. They gave a char-
acterization of 2- -edge-critical graphs and 3- -edge-critical disconnected graphs
as we show in Theorem 36. Since then the concept of connected k- -edge-critical
graphs for k 3 has received considerable attention. Most of the known results
are confined to the case k D 3. These graphs have been studied with respect to
graph parameters such as toughness and matching, [2, 3, 5, 6, 8, 10, 36] Hamiltonic-
ity [32, 34, 37, 38, 51, 58, 107, 109, 128, 139, 141–143], and more [35, 57, 59, 73, 89,
112, 113, 122, 125, 132, 143]. We do not intend to list all of these results, but give
a brief survey on connected 3- -edge-critical graphs. For k 4, connected k- -
edge-critical graphs are far from completely understood. In fact, even for k D 3, no
characterization of such graphs is known.
The following lemma follows immediately from the definition of k- -edge-
criticality.
Lemma 2. Suppose G is k- -edge-critical and u and v are nonadjacent vertices

of G. Then
(i) .G C uv/ D k 1.
(ii) There is a subset S of V .G/ fu; vg of size k 2 such that either S [ fug
dominates G v or S [ fvg dominates G u. Further, if S [ fvg dominates
G u, then S \ NG .u/ D ;.
The following characterizations of 2- -edge-critical graphs and disconnected

3--edge-critical graphs were established by Sumner and Blitch [126].
Theorem 36 ([125, 126]).

Sn
(i) A graph G is 2- -edge-critical if and only if G D i D1 K1;ri where ri and n
are positive integers.
(ii) A graph G is a 3- -edge-critical disconnected graph if and only if G is a

disjoint union of a 2--edge-critical graph and a complete graph K1 or a dis-
joint union of a complete graph with a perfect matching removed and a complete
graph Kn where n 1.
Before stating the next result, we need some new notation. If u; v, and w are
vertices of G and fu; vg dominates G w, then we write Œu; v ! w. This so-called
arrow notation made its first appearance in [126]. Note that if G is 3- -edge-critical
and u and v are nonadjacent vertices of G, then .G C uv/ D 2 and so there is a
vertex z 2 V .G/ fu; vg such that Œu; z ! v or Œv; z ! u.
Sumner and Blitch [126] proved the next theorem for the case n 4. The cases
n D 2 and 3 were added by Flandrin et al. [59]. This result is the most useful tool
in studying 3--edge-critical graphs yet available.
Theorem 37 ([59, 126]). Let G be a connected 3- -edge-critical graph and let S
be an independent set of n 2 vertices in V .G/:
(i) Then the vertices of S can be ordered as a1 ; a2 ; : : : ; an in such a way that there
exists a sequence of distinct vertices x1 ; x2 ; : : : ; xn1 so that Œai ; xi ! ai C1
for i D 1; 2; : : : ; n 1.
(ii) If, in addition, n 4, then the xi ’s can be chosen so that x1 ; x2 ; : : : ; xn1 span
a path and S \ fx1 ; x2 ; : : : ; xn1 g D ;.
The next result concerns the diameter and number of components of 3- -edge-
critical graphs.
Theorem 38 ([126]). Suppose G is a connected 3- -edge-critical graph. Then

(i) 2 diam.G/ 3.
(ii) If S is a vertex cutset in G, then !.G S / jS j C 1.
Ananchuen and Plummer [2, 6, 8] sharpened Theorem 38(ii) as follows.
Theorem 39 ([2, 6, 8]). Let G be a connected 3- -edge-critical graph and let S be
a vertex cutset in G. Then
(i) If jS j 6; !.G S / jS j 2.
(ii) If jS j 4; !.G S / jS j 1.
(iii) If 4 jS j 5 and each component of G S has at least three vertices, then
!.G S / jS j 2.
(iv) If jS j D 3, then !.G S / 3 and if G S has exactly three components,
then each component is complete and at least one of them is a singleton.
(v) If jS j D 2, then !.G S / 3 and if G S has exactly three components,
then G must be the graph shown in Fig. 4.3 with n 2.
(vi) If jS j D 1, then !.G S / D 2 and exactly one of the components of G S
is a singleton. Furthermore, G has at most three cutvertices. If it has two, then
G is a graph of the type shown in Fig. 4.3 with n 2, and if it has three, it is
the graph shown in Fig. 4.3 with n D 1.
Fig. 4.3 A 3--edge-critical

graph with a cutvertex
2K1 K2 + Kn + K1
n≥1
Theorem 38(ii) together with Theorem 39 might be considered a result on

toughness. Both are useful for establishing results on matchings in Sect. 4.5. The
toughness of a graph G denoted by .G/ is min fjS j=!.G S / : S is a vertex
cutset of Gg. A graph G is said to be t-tough if .G/ t:
Remark 2. By Theorem 38(ii), if G is a connected 3--edge-critical graph, then G

is 1/2-tough. Further, if ı.G/ 2, then G is 2-connected, by Theorem 39, and thus
.G/ 1 (see also [36]). In fact, Blitch [18] proved that if G is a connected 3--
edge-critical graph containing v as a cutvertex, then v is adjacent to an endvertex
of G. Hence, if ı.G/ D 1, then .G/ < 1. Chen et al. [36] gave a characterization
of connected 3- -edge-critical graphs with toughness 1.
We now turn our attention to Hamiltonicity. In 1990, Wojcicka [139] proved that
every connected 3- -edge-critical graph of order at least 7 has a Hamiltonian path.
(A shorter proof was given in 2002 by Zhang and Tian [143].) Wojcicka then posed
the following conjecture.
Conjecture 2. Every connected 3- -edge-critical graph having minimum degree at

least 2 has a Hamiltonian cycle.
Moreover, she conjectured that, in general, for k 3, .k 1/-connected

k--edge-critical graphs are Hamiltonian. Yuansheng et al. [142] showed that
this conjecture is not true for k D 4 by constructing a class of 3-connected 4- -
edge-critical non-Hamiltonian graphs. Conjecture 2 was settled via the following
two results and is now referred to as “Wojcicka’s theorem” by Mynhardt [109].
Theorem 40 ([58]). If G is a connected 3- -edge-critical graph with ı.G/ 2,

then ˛.G/ ı.G/ C 2.
Theorem 41 ([58, 128]). Suppose G is a connected 3- -edge-critical graph with

ı.G/ 2:
(i) If ˛.G/ ı.G/ C 1, then G is Hamiltonian.
(ii) If ˛.G/ D ı.G/ C 2, then G is Hamiltonian.
Part (i) of the above theorem was proved by Favaron et al. [58] and Tian
et al. [128] established part (ii).
The next corollary is a consequence of Wojcicka’s theorem and Remark 2,
together with the observation that if a graph G is Hamiltonian, then .G/ 1.
Corollary 3. Suppose G is a connected 3- -edge-critical graph. Then G is Hamil-

tonian if and only if .G/ 1.
Recently, Chen and Tian [34] obtained an even simpler proof of Wojcicka’s
theorem by using Hanson’s [68] and Bondy–Chvátal’s [21] closure operations.
A result closely related to Wojcicka’s theorem was proved by Xue and
Chen [141]. They established that if G is a connected 3--edge-critical with
ı.G/ D 1, then G A is Hamiltonian where A D fv 2 V .G/jdG .v/ D 1g.
A graph G is Hamiltonian-connected if every two distinct vertices are joined by
a Hamiltonian path. Chen et al. [37] posed a conjecture similar to that of Wojcicka.
Conjecture 3. A connected 3- -edge-critical graph is Hamiltonian-connected if
and only if .G/ > 1.
This conjecture was proved in a series of four papers [32, 37, 38, 51] by Chen,
Cheng, Ng, Tian, Wei, and Zhang.
4.4.2 k-t -Edge-Critical Graphs
The concept of a k-t -edge-critical graph was first introduced by van der Merwe
et al. [130] in 1998. Since t .G/ 2 for any graph G with no isolates, the first
nontrivial case for k-t -edge-critical graphs is k D 2. But it is easy to show that
the only 2-t -edge-critical graphs are the complete graphs Kn with n 2. Most
of the nontrivial results on k-t -edge-critical graphs are concerned with the case
k D 3 and were established by van der Merwe et al. [130, 131, 133, 134], Hanson
and Wang [69], and more recently by Simmons [123].
In [130] van der Merwe et al. showed that the addition of an edge to a graph may
decrease the total domination number of the resulting graph by at most two.
Theorem 42 ([130]). For any edge e 2 E.G/, t .G/ 2 t .G C e/ t .G/.
It then follows that if G is a k-t -edge-critical graph, then for an edge e 2
E.G/; t .G C e/ D k 1 or k 2.
Observe that if G is k-t -edge-critical, then for any pair of nonadjacent vertices
u and v of G, at least one of u and v must be in a minimum total dominating set
for G C uv. Further, if t .G C uv/ D k 2, then u and v share a minimum total
dominating set for G C uv.
A k-t -edge-critical graph G with t .G Ce/ D k 2 for every edge e 2 E.G/ is
called supercritical (cf. [130]). These graphs were characterized by van der Merwe
et al. [131].
Theorem 43 ([131]). A graph G is supercritical if and only if G is the union of
two or more nontrivial complete graphs.
We now turn our attention to 3-t -edge-critical graphs.
Theorem 44 ([130]). Suppose G is a 3-t -edge-critical graph. Then
(i) 2 diam.G/ 3.
(ii) Every vertex of G is adjacent to at most one endvertex.
(iii) G has at most one cutvertex.
Note that Theorem 44(ii) also holds for k-t -edge-critical graphs for k 3. Further,
it follows by Theorem 44(iii) that no tree is 3-t -edge-critical.
The next two results provide information on 3-t -edge-critical graphs containing
a cutvertex.
Theorem 45 ([130]). Suppose G is a 3-t -edge-critical containing x as a cutver-
tex. Then
(i) x 2 t .G/-set for every t .G/-set of G.
(ii) diam.G/ D 3.
(iii) G x has exactly two components.
(iv) x is adjacent to an endvertex.
Theorem 46 ([130]). Let G be a graph with a pendent edge uv (where v is a cutver-
tex and u an endvertex) and let A D N.v/ fug and B D V .G/ N Œv: Then G is
3-t -edge-critical if and only if:
(i) GŒA is complete and jAj 2.
(ii) GŒB is complete and jBj 2.
(iii) Every vertex in A is adjacent to jBj 1 vertices in B and every vertex in B is
adjacent to at least one vertex in A.
The next corollary follows immediately.
Corollary 4 ([130]). If G is a 3-t -edge-critical with an endvertex u, then
(i) .G/ D 2.
(ii) G u is Hamiltonian.
van der Merwe et al. [130] proved that for any graph G, there is a 3-t -edge-
critical graph H such that G is an induced subgraph of H . Consequently, it is not
possible to characterize 3-t -edge-critical graphs in terms of forbidden subgraphs.
Simmons [123] defined the closure of a 3-t -edge-critical graph G, denoted by
D t .G/, to be the graph obtained from G by adding the edge uv to G for each pair
of nonadjacent vertices u and v if fu; vg dominates G. It was then shown that:
Theorem 47 ([123]). For any 2-connected 3-t -edge-critical graph G; G is
Hamiltonian if and only if D t .G/ is Hamiltonian.
Simmons [123] also established several results for D t .G/ and showed that these
results also hold for G when G is 3-t -edge-critical.
Theorem 48 ([123]). Let G be a 3-t -edge-critical graph and I an independent
set in G with jI j D m 3. Then the vertices in I can be ordered as a1 ; a2 ; : : : ; am
in such a way that there exists a path x1 ; x2 ; : : : ; xm1 in G I where fxi ; ai g is a
minimum total dominating set for G ai C1 for i D 1; 2; : : : ; m 1:
Theorem 49 ([123]). Let G be a 2-connected 3-t -edge-critical graph. If the inde-
pendence number ˛.G/ 3, then ˛.G/ ı.G/C2: Moreover, if ˛.G/ D ı.G/C2,
then every maximum independent set contains all the vertices of degree ı.G/.
Theorem 50 ([123]). Let G be a connected 3-t -edge-critical graph. If S is a ver-

tex cutset of G, then G S has at most jS j C 1 components.
Note that Theorems 48 and 50 are analogous to Theorems 37 and 38(ii), respec-
tively.
4.4.3 k-c -Edge-Critical Graphs
k-c -edge-critical graphs were first introduced by Chen et al. [33] in 2004. They
gave a characterization of 2-c -edge-critical graphs and provided conditions for
some particular classes of graphs to be critical. They also established some results
concerning the case k D 3, most of which have previous analogues for ordinary
domination critical graphs. Ananchuen [1] studied k-c -edge-critical graphs with
cutvertices and gave a characterization for such graphs when k D 3. Ananchuen
et al. [11] studied matching properties in 3-c -edge-critical graphs as we show in
Sect. 4.5.
The first result in this section shows that the addition of an edge to a graph may
decrease the connected domination number of the resulting graph by at most two.
Thus this result is analogous to Theorem 42 for total domination number.
Theorem 51 ([33]). Let G be a connected graph. For any edge e 2 E.G/; c .G/
2 c .G C e/ c .G/:
It then follows that if G is k-c -edge-critical, then for each e 2 E.G/; c .G C e/ D
k 1 or k 2.
The next result provides a characterization of 2-c -edge-critical graphs.
Theorem
Sn 52 ([33]). A connected graph G is 2-c -edge-critical if and only if G D
i D1 K1;ri for ri 1 and n 2.
By Theorem 36(i), it is easy to see that G is a connected 2- -edge-critical graph
if and only if G is a 2-c -edge-critical graph.
Chen et al. [33] proved that for an integer n 3, no path or tree of order n is
c -edge-critical. Further, neither K1;k , for a positive integer k 2, nor Kr;s , for
maxfr; sg 3, where r and s are positive integers, is c -edge-critical. However,
Cn , a cycle of order n, is c -edge-critical for every integer n 4.
For k D 3, Chen et al. [33] established a bound on the diameter and the number
of components of k-c -edge-critical graphs analogous to Theorem 38. (Just replace
with c .)
Ananchuen [1] studied k-c -edge-critical graphs with cutvertices and established
the following.
Theorem 53 ([1]). For k 3, let G be a k-c -edge-critical graph with a cutver-
tex x. Then
(i) x 2 S for every c .G/-set S of G.
(ii) G x contains exactly two components.
(iii) If C is a component of G x, then c .C / k 1 and GŒNC .x/ is complete.

Further, if c .C / D k 1, then C is .k 1/-c -edge-critical.
Theorem 54 ([1]). For k 3, let G be a k-c -edge-critical graph with a cutvertex

x. Suppose C1 and C2 are the components of G x. Let A D GŒV .C1 / [ fxg and
B D GŒV .C2 / [ fxg. Then
(i) k 1 c .A/ C c .B/ k.
(ii) c .A/ C c .B/ D k if and only if exactly one of C1 and C2 is a singleton.
For 3-c -edge-critical graphs, Ananchuen [1] improved the result of Chen
et al. [33] on a number of components.
Theorem 55 ([1]). Let G be a 3-c -edge-critical graph and S a vertex cutset of G

with jS j 2. Then !.G S / jS j.
One might expect a result analogous to Theorem 39 for 3-c -edge-critical graphs.
But this is not the case. In [1] it was shown that the bound in Theorem 55 is best
possible.
4.4.4 k--Vertex-Critical Graphs
Recall that a graph G is k- -vertex-critical if .G/ D k and .G v/ < k for
each vertex v 2 V .G/. It is not difficult to see, for example, that C3kC1 is .k C 1/-
-vertex-critical. Clearly, a disconnected graph G is -vertex-critical if and only if
each component of G is -vertex-critical. So in the rest of this section, we concern
ourselves with connected graphs only.
The concept of k- -vertex-criticality was first introduced by Brigham et al.
[24,25]. Clearly, the only 1- -vertex-critical graph is K1 . Brigham et al. [25] pointed
out that the 2--vertex-critical graphs are precisely those obtained from the com-
plete graphs K2n by deleting a perfect matching. For k > 2, an understanding of the
structure of k--vertex-critical graphs is far from complete. However, some struc-
tural properties have been established in terms of an upper bound on the order
[24, 25] and the diameter [63, 64].
In what follows, Dv denotes any minimum dominating set for G v. The first
result provides basic properties that have proved very useful in studying k--vertex-
critical graphs.
Lemma 3 ([24, 25]). Let G be a k--vertex-critical graph. Then

(i) For each v 2 V .G/; jDv j D k 1 and NG Œv \ Dv D ;.
(ii) For every pair of distinct vertices u and v, Du ¤ Dv .
(iii) If dG .v/ 1, NG Œv is not complete.
(iv) There exists no pair of vertices u and v of G such that NG Œu NG Œv.
The next result establishes an upper bound on the order of a k- -vertex-critical
graph.
Theorem 56 ([24, 25]). Let G be a k- -vertex-critical graph. Then

(i) .G/ ..G/ C 1/.k 1/ C 1.
(ii) .G/ 13 .2".G/ C 3k .G//.
Brigham et al. [24] conjectured that if G is a k--vertex-critical graph with

.G/ D ..G/ C 1/.k 1/ C 1, then G is regular. This conjecture was settled
in the affirmative by Fulman et al. [64]. In the same paper [24], Brigham et al. also
posed a conjecture on an upper bound of the diameter of k--vertex-critical con-
nected graphs which they proved for k 5 and which Fulman et al. [64] later
proved for k 2.
Theorem 57 ([64]). The diameter of a k- -vertex-critical connected graph is at

most 2.k 1/.
Fulman et al. [64] showed that the bound in Theorem 57 is best possible. They
also characterized 3- -vertex-critical graphs with diameter 4 and 4- -vertex-critical
graphs with diameter 6 described in Theorem 58. Recall that a block of a graph is a
maximal connected subgraph of G with no cutvertices of itself. An end block of G
is a block containing exactly one cutvertex of G.
Theorem 58 ([64]).
(i) A graph G with diameter 4 is 3- -vertex-critical if and only if G has two blocks,
each of which is 2- -vertex-critical.
(ii) A graph G with diameter 6 is 4- -vertex-critical if and only if it has three
blocks, two of which are end blocks and all of which are 2- -vertex-critical.
Before proceeding, we need a new definition. Let G and H be disjoint graphs.

H G, the coalescence of H and G, is the graph obtained by identifying one vertex
of H with one vertex of G. (Note that the identified vertices become a cutvertex of
H G.) Brigham et al. [24, 25] showed that:
Theorem 59 ([24, 25]). Let H and G be graphs ¤ K1 . Then

(i) .H / C .G/ 1 .H G/ .H / C .G/.
(ii) If both H and G are -vertex-critical or if H G is -vertex-critical, then
.H G/ D .H / C .G/ 1.
(iii) H G is -vertex-critical if and only if both H and G are -vertex-critical.
They then used the above result and induction to establish the following.
Theorem 60 ([24,25]). A graph G is -vertex-critical if and only if each block of G

is -vertex-critical. Further,Pif G is -vertex-critical and contains G1 ; G2 ; : : : ; Gn
as its blocks, then .G/ D niD1 .Gi / .n 1/.
Brigham et al. [24, 25] also used the idea of coalescence to show that any graph
G with .G/ D k 3 can be embedded in a k- -vertex-critical graph. They first
showed that for a given graph G with .G/ 3, there exists a 3--vertex-critical
graph H containing G as an induced subgraph. The graph H can be constructed
as follows. Let V .G/ D fv1 ; v2 ; : : : ; vp g. Note that p 3 since .G/ 3. Now
let V .H / D fv1 ; v2 ; : : : ; vp ; w1 ; w2 ; : : : ; wp ; x1 ; x2 ; : : : ; xp g and E.H / D E.G/ [
fwi xj ; wi vj ; xi vj j1 i; j p and j ¤ i g. It is not difficult to show that H
is 3--vertex-critical. Clearly, if .G/ D k D 3, then H is the required graph in
which G can be embedded. If .G/ D k 3, then they showed that H C3.k3/C1
is the desired graph in which G can be embedded. Note that .H C3.k3/C1 / D
.H / C .C3.k3/C1 / 1 D 3 C .k 2/ 1 D k.
Hence we have the following theorem.
Theorem 61 ([24, 25]). Let G be any graph with .G/ D k 3. Then

(i) There exists a 3- -vertex-critical graph H containing G as an induced sub-
graph.
(ii) G can be embedded in a k- -vertex-critical graph.
Note that for any graph G, .G [ 2K1 / 3, thus Theorem 61(i) also holds for any
graph G with .G/ < 3.
It follows immediately by Theorem 61 that it is not possible to characterize k- -
vertex-critical graphs in terms of forbidden subgraphs.
A graph is claw-free if it does not contain the graph K1;3 as an induced subgraph.
Ananchuen and Plummer [7] studied the connectivity of claw-free 3--vertex-
critical graphs in terms of minimum degree. They showed that:
Theorem 62 ([7]). Let G be a connected claw-free 3- -vertex-critical graph. Then

(i) G is 2-connected.
(ii) If G is of even order or if ı.G/ 3, then G is 3-connected.
(iii) If ı.G/ 5, then G is 4-connected.
We conclude this section by reminding the reader that the concept of vertex
criticality may also be applied to other variations of domination such as distance
domination (see [72] Chap. 12, and [84, 129]), as well as independent domination
[14]. (See also [26–28, 39, 75, 115].)
4.4.5 k-P-Vertex-Critical Graphs Where P 2 ft ; c g
Observe that a graph containing an isolated vertex cannot be totally dominated with
any vertex set. Similarly, a disconnected graph cannot be dominated by any con-
nected dominating set. Hence, it makes sense to add an extra assumption for a vertex
to be deleted when we want to study vertex deletion with respect to total domination
and connected domination.
A graph G with no isolated vertex is k-t -vertex-critical if t .G/ D k and for

each v 2 V .G/ that is not adjacent to any vertex of degree one, t .G v/ < k. A
graph G with .G/ 2 is k-c -vertex-critical if c .G/ D k but c .G v/ < k for
every vertex v 2 V .G/. Note that if we assume that the connectivity of G is at least
2, then G is 3-c -vertex-critical if and only if G is 3-t -vertex-critical. Hence, for
graphs with connectivity at least 2, results dealing with 3-c -vertex-critical graphs
may be interpreted as results pertaining to 3-t -vertex-critical graphs and vice versa
since for any graph G; c .G/ D 3 if and only if t .G/ D 3.
k-t -vertex-critical graphs were first studied by Goddard et al. [66] in 2004 and
later on by Mojdeh and Rad [105, 106]. It is easy to see that G is t -vertex-critical
if and only if each component of G is t -vertex-critical. So we restrict our attention
to connected graphs only. The following basic result is similar to Lemma 3.
Lemma 4 ([66]). Suppose G is a k-t -vertex-critical graph. Let S.G/ D fu 2

V .G/ju is a support vertex in Gg. Then
(i) For each v 2 V .G/ S.G/, if Dv is a minimum total dominating set for G v,
then jDv j D k 1 and Dv \ NG Œv D ;.
(ii) For each v 2 V .G/ S.G/, there is no vertex u of G with uv … E.G/ and
NG .u/ NG .v/.
Theorem 63 ([66]). Let G be a connected graph of order at least 3 with at least

one endvertex. Then, G is k-t -vertex-critical if and only if G D H ı K1 for some
connected graph H of order k with ı.H / 2.
It follows immediately by Theorem 63 that no tree is t -vertex-critical.

A graph H is vertex diameter k-critical if diam.H /Dk and diam.H v/ > k.
Hanson and Wang [69] observed that for a graph G; t .G/ D 2 if and only if
diam.G/ > 2. By combining this result together with a concept of vertex diame-
ter k-criticality, Goddard et al. [66] obtained the following characterization.
Theorem 64 ([66]). A connected graph G is 3-t -vertex-critical if and only if G is

vertex diameter 2-critical or G is K3 ı K1 .
Goddard et al. [66] also gave an upper bound for the diameter of k-t -vertex-
critical graphs which is sharp for small k.
Theorem 65 ([66]). Let G be a k-t -vertex-critical graph. Then

(i) diam.G/ 2k 3.
(ii) For k 8, the diameter of G is at most the value given by Table 4.1.
Table 4.1 Upper bounds on

k 3 4 5 6 7 8
the diameter of
k-t -vertex-critical graphs diam.G/ 3 4 6 7 9 11
with 3 k 8
Finally, they posed several open problems, for example, the characterization of a
k-t -vertex-critical graph G of order .G/.k 1/ C 1 and k C .G/, respectively.
These two problems were addressed by Mojdeh and Rad [105, 106] and more
recently by Wang et al. [136].
We now turn our attention to k-c -vertex-critical graphs. It is easy to see that the
only 1-c -vertex-critical graph is K1 and the 2-c -vertex-critical graphs are obtained
from the even complete graphs K2n , with n 2, by deleting a perfect matching.
For k 3, the structure of k-c -vertex-critical graphs is much more complicated.
k-c -vertex-critical graphs were studied in [12, 13], where most of the results are
concerned with 3-c -vertex-critical graphs. Some basic properties of 3-c -vertex-
critical graphs especially with respect to connectivity are established which were
used to study matching properties in 3-c -vertex-critical graphs as we show in the
next section. The following result is analogous to Lemma 3(i, ii, iv).
Lemma 5 ([12]). Suppose G is k-c -vertex-critical. Let Dv be a minimum con-

nected dominating set for G v. Then
(i) If v 2 V .G/, Dv \ NG Œv D ;.
(ii) If u; v 2 V .G/ and u ¤ v, then Du ¤ Dv .
(iii) If v 2 V .G/, then jDv j D k 1.
(iv) If v 2 V .G/, then there is no u ¤ v such that NG Œv NG Œu.
Theorem 66 ([12]). If G is a 3-c -vertex-critical graph, then either G D C5 or G

is 3-connected.
In the case when G is exactly 3-connected, we can say more about its structure.
Theorem 67 ([12]). Suppose G is a 3-c -vertex-critical graph and S is a vertex

cutset in G with jS j D 3. Then
(i) jE.GŒS /j 1.
(ii) G S consists of precisely two components.
Theorem 67 can then be used to establish the following results.
Theorem 68 ([12]). Suppose G is a 3-c -vertex-critical graph and S is a minimum

vertex cutset in G with jS j D 3. Let C1 and C2 be the two components of G S
where jV .C1 /j jV .C2 /j. Then
(i) Either jV .C1 /j 2 or jV .C2 /j 2.
(ii) If jV .C1 /j D 2, then jV .C2 /j D 2, and G is isomorphic to the graph G0 in
Fig. 4.4.
(iii) If jV .C1 /j D 1 and S is independent, then G is isomorphic to one of G0 or
G00 , both of which are shown in Fig. 4.4.
(iv) If jV .C1 /j D 1 and S contains an edge, then G has G1 or G2 as a spanning
subgraph, where G1 and G2 are shown in Fig. 4.5.
Go G⬘o
Fig. 4.4 The 3-c -vertex-critical graphs G0 and G00
Kn Kn Kn Kn
(Kn + Kn) - perfect matching (Kn + Kn)-perfect matching
G1 G2
Fig. 4.5 The graphs G1 and G2
4.5 Matching Properties
Recall that a perfect matching in a graph G is a matching that covers all of the
vertices of G while a near-perfect matching is a matching that covers all but one of
the vertices of G.
A graph G is k-factor-critical if and only if for every set S V .G/ with jS j D k,
the graph G S contains a perfect matching. Note that if G is k-factor-critical then
.G/ k.mod 2/. k-factor-critical graphs are called factor-critical if k D 1 and
bicritical if k D 2. Factor critical and bicritical graphs play an important role in a
canonical decomposition theory for arbitrary graphs in term of their matchings. The
interested reader is referred to [101] for much more on this subject.
In this section, we are concerned with the existence of a perfect matching, a near-
perfect matching, and being k-factor-critical for the classes of 3-P -edge-critical
graphs and 3-P -vertex-critical graphs where P 2 f; c g.
4.5.1 3-P-Edge-Critical Graphs and Matching Properties
We begin by recalling Tutte’s famous theorem on perfect matchings.

Theorem 69 (Tutte’s theorem (see [22] page 76)). A graph G has a perfect
matching if and only if !o .G S / jS j, for all S V .G/.
By combining Theorem 38(ii) and Tutte’s theorem, the first part of Theorem 70
below follows immediately for P D . This was established by Sumner and
Blitch [126]. For P D c ; Chen et al. [33] also established a result similar to
Theorem 38(ii). So the first part of Theorem 70 also holds for P D c ; (see [33]).
The second part of Theorem 70 was established in [3] for P D and in [11] for
P D c :
Theorem 70 ([3, 11, 33, 126]). For P 2 f; c g, let G be a connected 3-P -edge-
critical graph. Then
(i) If .G/ is even, G contains a perfect matching.
(ii) If .G/ is odd, G contains a near-perfect matching.
Sufficient conditions for 3- -edge-critical graphs to be k-factor-critical for
k D 1; 2; 3 are presented next.
Theorem 71 ([3, 10]). Suppose G is a 3- -edge-critical graph.
(i) If G is 2-connected of odd order, then G is factor-critical.
(ii) Suppose further that G is 3-connected of even order and if G is either planar
or having minimum degree at least 4, then G is bicritical.
(iii) If G is 4-connected of odd order and ı.G/ 5, then G is 3-factor-critical.
The next theorem shows that the hypotheses on both the connectivity and min-
imum degree in Theorem 71 can be relaxed if the graph under consideration is
claw-free.
Theorem 72 ([3,10]). Suppose G is a 3- -edge-critical claw-free graph. Then, for
k 2 f2; 3g, if G is k-connected with ı.G/ k C 1 and .G/ k.mod2/, then G is
k-factor-critical.
In [10] it was conjectured that Theorem 72 holds for k 2. The following
conjecture was also posed.
Conjecture 4. Suppose G is a graph with k 2 and suppose k 1 and .G/ have
the same parity. Then if G is k-connected and 3- -edge-critical with ı.G/ k C 1,
G is .k 1/-factor-critical.
Now we turn our attention to sufficient conditions for 3-c -edge-critical graphs
to be k-factor-critical graphs for k D 1; 2; 3.
Theorem 73 ([11]). Suppose G is a 3-c -edge-critical graph.
(i) If .G/ D 2n C 1 5 and ı.G/ 2, then G is factor-critical.
(ii) If G is 3-connected with .G/ D 2n 8 and ı.G/ n1, then G is bicritical.
(iii) If G is 4-connected of odd order and K1;4 -free, then G is 3-factor-critical.
Note that the above minimum degree requirement of 3-c -edge-critical graphs to
be bicritical is much stronger than that for 3- -edge-critical graphs. However, this
bound is sharp and it cannot be lowered even if the connectivity is increased.
4.5.2 3-P-Vertex-Critical Graphs and Matching Properties
From the point of view of matchings, the properties of 3-P -vertex-critical graphs,
for P 2 f; c g, differ quite dramatically from those of the 3-P -edge-critical graphs.
For example, by Theorem 70, every connected even 3-P -edge-critical graph must
have a perfect matching and every connected odd 3-P -edge-critical graph must have
a near-perfect matching. These conclusions do not hold for general 3-P -vertex-
critical graphs as shown below.
We first present an infinite family Hk;.k/k of 3--vertex-critical graphs (see [4])
2
and an infinite family Jk of 3-c -vertex-critical graphs (see [12]).
Let k be any positive integer with k 5. We proceed to construct the graph
which we call Hk;.k/k . The vertex set consists of two disjoint subsets of vertices
2
called central and peripheral, respectively. Let fv1 ; v2 ; : : : ; vk g denote the set of
central vertices. The subgraph induced by these central vertices will be the complete
graph Kk with the Hamiltonian cycle v1 v2 vk v1 deleted. The peripheral vertices

will be k2 k in number and will be denoted by the symbol fi; j g where the

(unordered) pair fi; j g (i ¤ j ) ranges over all the k2 k subsets of size 2 of the
set 1; : : : ; k, except those having j D i C 2 where i C 2 is read modulo k. The
neighbor set of peripheral vertex fi; j g will be precisely the set of all central
vertices, except i and j . There are no edges joining pairs of peripheral vertices.
Let k 6 be a positive integer. We construct the graph Jk as follows. Let the
integers 1; 2; : : : ; k span a complete k-graph with the Hamiltonian cycle 12 k1
removed. These k vertices are called central vertices. Consider a second set of k.k
3/=2 k peripheral vertices labeled with unordered pairs of distinct integers
fi; j g, 1 i < j k, except for exactly those pairs of the form fi; i C 1g and
fi; i C 2g modulo k. Now join the pair labeled fi; j g to all central vertices except
i and j . Figure 4.6 shows graphs H6;9 and J6 , respectively.
It is not difficult to see that the graphs Hk;.k/k for k 6 and Jk for k 8 do
2
not contain a perfect (or near-perfect) matching. Hence, 3-P -vertex-critical graphs,
for P 2 f; c g, need not have a perfect (or near-perfect) matching. So what might
be some reasonable conditions one might place on a 3-P -vertex-critical graph suf-
ficient to guarantee the existence of a perfect (or near-perfect) matching? One of
the classical theorems about matching is the following, due independently to Sum-
ner [124] and Las Vergnas [95].
Theorem 74 ([95, 124]). Every connected claw-free graph of even order has a
perfect matching.
The next result can be considered as a variation on this theme.
Theorem 75 ([4, 9]). Suppose G is a K1;5 -free 3--vertex-critical graph. Then

(i) If .G/ is even, then G has a perfect matching.
(ii) If .G/ 11 is odd with ı.G/ 1, then G has a near-perfect matching.
~{1, 4}
~{3, 4} ~{4, 5}
1 ~{1, 4}
6 2
1
~{2, 3} ~{5, 6}
6 2
5 3
4 5 3
~{2, 5} ~{3, 6}
4
~{1, 2} ~{1, 6} ~{2, 5} ~{3, 6}
H6, 9 J6
Fig. 4.6 The 3--vertex-critical graph H6;9 and the 3-c -vertex-critical graph J6
The lower bound on v.G/ in part (ii) is best possible.

The following conjecture is found in [4, 9].
Conjecture 5. Suppose G is a 3- -vertex-critical graph. Then

(i) If .G/ is even K1;7 -free, then G contains a perfect matching.
(ii) If .G/ is odd K1;5 -free 2-connected with ı.G/ 3, then G is factor-critical.
Wang and Yu [137] showed that Conjecture 5(ii) is true with two small excep-
tions.
If a 3- -vertex critical graph is also claw-free, more can be said. The following
theorem due independently to Favaron et al. [52] and to Liu and Yu [99] is use-
ful here.
Theorem 76 ([52,99]). If G is a .k C 1/-connected claw-free graph of order n and

if n k is even, then G is k-factor-critical.
The next theorem follows immediately by Theorems 62 and 76.
Theorem 77 ([7]). Let G be a connected claw-free 3- -vertex-critical graph. Then

(i) If G has odd order, then G is factor-critical.
(ii) If G has even order, then G is bicritical.
(iii) If G has odd order and ı.G/ 5, then G is 3-factor-critical.
We now turn our attention to 3-c -vertex-critical graphs. We saw above that 3-c -
vertex-critical graphs need not contain a perfect (or near-perfect) matching. Suffi-
cient conditions for 3-c -vertex-critical graphs to contain a perfect (or near-perfect)
matching are given in the following theorem. This theorem can be considered as
another variation of Theorem 74.
Theorem 78 ([13]). Suppose G is a K1;7 -free 3-c -vertex-critical graph. Then

(i) If .G/ is even, then G contains a perfect matching.
(ii) If .G/ is odd, then G contains a near-perfect matching.
For k-factor-critical results, we have:
Theorem 79 ([13]). Suppose G is a 3-c -vertex-critical graph of even order. If G

is either (i) K1;4 -free, or (ii) K1;5 -free and 5-connected, then G is bicritical.
Theorem 80 ([13]). Suppose G is a 3-c -vertex-critical graph of odd order. Then

(i) If G contains a vertex cutset S with jS j D 3, then G is factor-critical.
(ii) If G is K1;6 -free, then G is factor-critical.
(iii) If G is K1;3 -free and ı.G/ 4, then G is 3-factor-critical.
In closing, we would like to remind the reader that if the connectivity

of a graph is at least 2, then G is 3-c -vertex-critical if and only if G is
3-t -vertex-critical. Hence, the results dealing with 3-c -vertex-critical graphs pre-
sented in this section may be interpreted as results pertaining to 3-t -vertex-critical
graphs as well.
4.6 Summary and Conclusions
So what are the possible future directions in the study of domination? Domination
and its many variations form a vast subject. Already two entire books have been
written on the subject [71,72]. And since their publication in 1998, nearly 1000 new
research papers on domination have appeared in scientific journals worldwide! It is
therefore beyond the scope of this chapter to speculate individually on the future
of all these variants. Certainly, with much of the world preoccupied with security
issues these days, domination in all its forms will attract ever more attention.
It seems clear that on the applied side, researchers will continue to classify
domination problems confined to special classes of graphs as to whether they are
polynomially solvable or NP-complete. In Chap. 8 of [72], chapter author Kratsch
provides a nice table of algorithmic complexity results for five of the more widely
studied variants of domination as applied to 15 different special classes of graphs.
His table will no doubt continue to be enlarged.
On the theoretical side, many unsolved problems will no doubt continue to oc-
cupy the efforts of researchers. In closing, we mention just two of our favorites. The
first is the study of well-dominated graphs; i.e., those graphs in which every minimal
dominating set is minimum. Graphs in this class have a trivially polynomial proce-
dure to determine their domination number, namely the greedy algorithm. Clearly,
one can decide in polynomial time if a graph is not well-dominated; just exhibit
two minimal dominating sets of differing cardinalities. Hence the well-dominated

problem is in the class co-NP. But can a well-dominated graph be so certified in
polynomial time? That is, is the well-dominated problem in NP? This is unknown.
Finally, in line with our emphasis on criticality issues in this chapter, we mention
the following problem. Is there a polynomial algorithm to decide if a graph is edge-
critical or vertex-critical with respect to domination (connected domination, total
domination, etc.)? Although most domination problems for general graphs have
been shown to be NP-complete, that does not automatically make the answer to
this question “no.” As far as we know, it has not been proven that to recognize a
domination critical graph one must know its domination number.
References
1. Ananchuen N (2007) On domination critical graphs with cutvertices having connected domi-
nation number 3. Int Math Forum 2:3041–3052
2. Ananchuen N, Plummer MD (2003) Some results related to the toughness of 3-domination
critical graphs. Discrete Math 272:5–15
3. Ananchuen N, Plummer MD (2004) Matching properties in domination critical graphs. Dis-
crete Math 277:1–13
4. Ananchuen N, Plummer MD (2005) Matching in 3-vertex-critical graphs: the even case. Net-
works 45:210–213
5. Ananchuen N, Plummer MD (2006) Erratum to: Matching properties in domination critical
graphs. Discrete Math 306:291–291
6. Ananchuen N, Plummer MD (2006) Erratum to: Some results related to the toughness of
3-domination critical graphs. Discrete Math 306:292
7. Ananchuen N, Plummer MD (2006) On the connectivity and matchings in 3-vertex-critical
claw-free graphs. Utilitas Math 69:85–96
8. Ananchuen N, Plummer MD (2006) Some results related to the toughness of 3-domination
critical graphs II. Utilitas Math 70:11–32
9. Ananchuen N, Plummer MD (2007) Matchings in 3-vertex-critical graphs: the odd case. Dis-
crete Math 307:1651–1658
10. Ananchuen N, Plummer MD (2007) 3-Factor-criticality in domination critical graphs. Dis-
crete Math 307:3006–3015
11. Ananchuen N, Ananchuen W, Plummer MD (2008a) Matching properties in connected dom-
ination critical graphs. Discrete Math 308:1260–1267
12. Ananchuen W, Ananchuen N, Plummer MD (2008b) Vertex criticality for connected domina-
tion. Utilitas Math (to appear)
13. Ananchuen W, Ananchuen N, Plummer MD (2008c) Connected domination: vertex criticality
and matchings, (submitted) (to appear)
14. Ao S (1994) Independent domination critical graphs. M.Sc. thesis, Department of Mathemat-
ics and Statistics, University of Victoria
15. Archdeacon D et al. (2004) Some remarks on domination. J Graph Theory 46:207–210
16. Baogen X, Cockayne EJ, Haynes TW, Hedetniemi ST, Shangchao Z (2000) Extremal graphs
for inequalities involving domination parameters. Discrete Math 216:1–10
17. Berge C (1973) Graphs and hypergraphs. North-Holland, Amsterdam
18. Blitch PM (1983) Domination in graphs. Ph.D. thesis, Department of Mathematics and Statis-
tics, University of South Carolina
19. Bo C, Liu B (1996) Some inequalities about connected domination number. Discrete Math
159:241–245
20. Bollobás B, Cockayne EJ (1979) Graph theoretic parameters concerning domination,

independence and irredundance. J Graph Theory 3:241–250
21. Bondy JA, Chvátal V (1976) A method in graph theory. Discrete Math 15:111–135
22. Bondy JA, Murty USR (1976) Graph theory with applications. Macmillan, London
23. Brigham RC, Carrington JR, Vitray RP (2000) Connected graphs with maximum total domi-
nation number. J Combin Math Combin Comput 34:81–96
24. Brigham RC, Chinn PZ, Dutton RD (1984) A study of vertex domination critical graphs.
Tech. Report M-2, Department of Mathematics, University of Central Florida
25. Brigham RC, Chinn PZ, Dutton RD (1988) Vertex domination-critical graphs. Networks
18:173–179
26. Brigham RC, Haynes TW, Henning MA, Rall DF (2005) Bicritical domination. Discrete Math
305:18–32
27. Burton T, Sumner DP (2006) Domination dot-critical graphs. Discrete Math 306:11–18
28. Burton T, Sumner DP (2007) -Excellent, critically dominated, end-dominated, and dot-
critical trees are equivalent. Discrete Math 307:683–693
29. Caro Y, Roditty Y (1985) On the vertex-independence number and star decomposition of
graphs. Ars Combinatoria 20:167–180
30. Caro Y, Roditty Y (1990) A note on the k-domination number of a graph. Int J Math Sci
13:205–206
31. Chang GJ (1998) Algorithmic aspects of domination in graphs. In: Du D-Z, Pardalos PM
(eds) Handbook of combinatorial optimization, vol 3. Kluwer, Boston, pp 339–405
32. Chen Y, Edwin Cheng TC, Ng CT (2008) Hamilton-connectivity of 3-domination critical
graphs with ˛ D ı C 1 5. Discrete Math 308:1296–1307
33. Chen XG, Sun L, Ma D-X (2004) Connected domination critical graphs. Appl Math Lett
17:503–507
34. Chen Y, Tian F (2003) A new proof of Wojcicka’s conjecture. Discrete Appl Math 127:
545–554
35. Chen Y, Tian F, Wei B (2002) Codiameters of 3-connected 3-domination critical graphs.
J Graph Theory 39:76–85
36. Chen Y, Tian F, Wei B (2002) The 3-domination-critical graphs with toughness one. Utilitas
Math 61:239–253
37. Chen Y, Tian F, Wei B (2003) Hamilton-connectivity of 3-domination-critical graphs with
˛ ı. Discrete Math 271:1–12
38. Chen Y, Tian F, Zhang Y (2002) Hamilton-connectivity of 3-domination critical graphs with
˛ D ı C 2. Eur J Combinator 23:777–784
39. Chengye Z, Yuansheng Y, Linlin S (2008) Domination dot-critical graphs with no critical
vertices. Discrete Math 308:3241–3248
40. Clark WE, Shekhtman B, Suen S (1998) Upper bounds for the domination number of a graph.
Congr Numer 132:99–123
41. Clark WE, Suen S (2000) An inequality related to Vizing’s conjecture. Electron J Combinator
7(4):3
42. Cockayne EJ (1978) Domination of undirected graphs – a survey. In: Alavi, Y., Lick, D.R.
(eds) Theory and applications of graphs in America’s bicentennial year. Springer, Berlin,
pp 141–147
43. Cockayne EJ, Dawes RM, Hedetniemi ST (1980) Total domination in graphs. Networks
10:211–219
44. Cockayne EJ, Hedetniemi ST (1977) Towards a theory of domination in graphs. Networks
7:247–261
45. Colbourn CJ, Stewart LK (1990) Permutation graphs: connected domination and Steiner trees.
46. Cropper M, Greenwell D, Hilton AJW, Kostochka AV (2005) The domination number of
cubic Hamiltonian graphs. AKCE Int J Graph Combinator 2:137–144
47. DeLaViña E, Liu Q, Pepper R, Waller B, West DB (2007) Some conjectures of Graffiti.pc on
total domination. Congr Numer 185:81–95
48. Dorfling M, Goddard W, Henning MA (2006) Domination in planar graphs with small
diameter II. Ars Combinatoria 78:237–255
49. Duchet P, Meyniel H (1982) On Hadwiger’s number and the stability number. In: Bollobás B
(ed) Graph theory. Annals of Discrete Mathematics, vol 13. North-Holland, Amsterdam,
pp 71–74
50. Duckworth W, Mans B (2002) On the connected domination number of random regular
graphs. In: Ibarra OH, Zhang L (eds) Computing and combinatorics. Lecture notes in com-
puter science, vol 2387. Springer, Berlin, pp 210–219
51. Edwin Cheng TC, Chen Y, Ng CT (2009) Codiameters of 3-domination critical graphs with
toughness more than one. Discrete Math 309:1067–1078
52. Favaron O, Flandrin E, Ryjác̆ek Z (1997) Factor-criticality and matching extension in DCT-
graphs. Discuss Math Graph Theory 17:271–278
53. Favaron O, Henning MA (2004) Paired-domination in claw-free cubic graphs. Graph Combi-
nator 20:447–456
54. Favaron O, Henning MA (2008) Total domination in claw-free graphs with minimum de-
gree 2. Discrete Math 308:3213–3219
55. Favaron O, Henning MA (2008) Bounds on total domination in claw-free cubic graphs. Dis-
crete Math 308:3491–3507
56. Favaron O, Kratsch D (1991) Ratios of domination parameters. In: Kulli VR (ed) Advances
in graph theory. Vishwa, Gulbarga, pp 173–182
57. Favaron O, Sumner DP, Wojcicka E (1994) The diameter of domination k-critical graphs.
58. Favaron O, Tian F, Zhang L (1997) Independence and hamiltonicity in 3-domination-critical
graphs. J Graph Theory 25:173–184
59. Flandrin E, Tian F, Wei B, Zhang L (1999) Some properties of 3-domination-critical graphs.
60. Frendrup A, Henning MA, Randerath B, Vestergaard PD (2009) An upper bound on the dom-
ination number of a graph with minimum degree 2. Discrete Math 309:639–646
61. Fujita S, Kameda T, Yamashita M (1995) A resource assignment problem on graphs. In:
Staples J, Eades P, Katoh N, Moffat A (eds) Algorithms and computation. Lecture notes in
computer science, vol 1004. Springer, London, pp 418–427
62. Fujita S, Kameda T, Yamashita M (2000) A study on r-configurations-a resource arrangement
problem. SIAM J Discrete Math 13:227–254
63. Fulman J (1994) Domination in vertex and edge critical graphs. Manuscript, Department of
Mathematics, Harvard University
64. Fulman J, Hanson D, MacGillivray G (1995) Vertex domination-critical graphs. Networks
25:41–43
65. Garey MR, Johnson DS (1979) Computers and intractability: a guide to the theory of NP-
completeness. W.H. Freeman, San Francisco, CA
66. Goddard W, Haynes TW, Henning MA, van der Merwe LC (2004) The diameter of total
domination vertex critical graphs. Discrete Math 286:255–261
67. Goddard W, Henning MA (2002) Domination in planar graphs with small diameter. J Graph
Theory 40:1–25
68. Hanson D (1993) Hamilton closures in domination critical graphs. J Combin Math Combin
Comput 13:121–128
69. Hanson D, Wang P (2003) A note on extremal total domination edge critical graphs. Utilitas
Math 63:89–96
70. Harant J, Rautenbach D (2009) Domination in bipartite graphs. Discrete Math 309:113–122
71. Haynes TW, Hedetniemi ST, Slater PJ (1998) Fundamentals of domination in graphs. Marcel
Dekker, New York
72. Haynes TW, Hedetniemi ST, Slater PJ (eds) (1998) Domination in graphs – advanced topics.
Marcel Dekker, New York
73. Haynes TW, Henning MA (1998) Domination critical graphs with respect to relative comple-
ments. Australas J Combinator 18:115–126
74. Haynes TW, Henning MA (2009) Upper bounds on the total domination number. Ars
Combinatoria 91:243–256
75. Haynes TW, Phillips JB, Slater PJ (1999) Realizability of .j; t /-critical graphs for sets of
values. Congr Numer 137:65–75
76. Hedetniemi ST, Laskar R (1984) Connected domination in graphs. In: Bollobás B (ed) Graph
theory and combinatorics. Academic, London, pp 209–217
77. Hedetniemi ST, Laskar RC (1990) Bibliography on domination in graphs and some basic
definitions of domination parameters. Discrete Math 86:257–277
78. Hellwig A, Volkmann L (2006) Some upper bounds for the domination number. J Combin
Math Combin Comput 57:187–209
79. Henning MA (1999) A characterisation of graphs with minimum degree 2 and domination
number exceeding a third their size. J Combin Math Combin Comput 31:45–64
80. Henning MA (2000) Graphs with large total domination number. J Graph Theory 35:21–45
81. Henning MA (2005) A linear Vizing-like relation relating the size and total domination num-
ber of a graph. J Graph Theory 49:285–290
82. Henning MA (2009) A survey of selected recent results on total domination in graphs. Dis-
83. Henning MA, Kang L, Shan E, Yeo A (2008) On matching and total domination in graphs.
84. Henning MA, Oellermann OR, Swart HC (2003) Distance domination critical graphs. J Com-
bin Math Combin Comput 44:33–45
85. Henning MA, Yeo A (2006) Total domination and matching numbers in claw-free graphs.
Electron J Combinator 13, # R 59, 28
86. Henning MA, Yeo A (2008) Total domination in graphs with given girth. Graph Combinator
24:333–348
87. Henning MA, Yeo A (2007) A new upper bound on the total domination number of a graph.
Electron J Combinator 14, # R 65, 10
88. Ho PT (2008) A note on the total domination number. Utilitas Math 77:97–100
89. Jinquan D (1995) Some results on 3-domination critical graphs. Acta Sci Nat Univ NeiMong-
gol 26:39–42
90. Kawarabayashi K, Plummer MD, Saito A (2006) Domination in a graph with a 2-factor.
91. Kleitman DJ, West DB (1991) Spanning trees with many leaves. SIAM J Discrete Math 4:
99–106
92. Kostochka AV, Stodolsky BY (2005) On domination in connected cubic graphs. Discrete
Math 304:45–50
93. Kostochka AV, Stodolsky BY (2009) An upper bound on the domination number of n-vertex
connected cubic graphs. Discrete Math 309:1142–1162
94. Lam PCB, Wei B (2007) On the total domination number of graphs. Utilitas Math 72:223–240
95. Las Vergnas M (1975) A note on matchings in graphs, Colloque sur la Théorie des Graphes
(Paris, 1974) Cahiers Centre Études Rech Oṕer 17:257–260
96. Laskar R, Walikar HB (1981) On domination related concepts in graph theory. In: Rao SB
(ed) Combinatorics and graph theory. Lecture notes in mathematics, vol 885. Springer, Berlin,
pp 308–320
97. Liu CL (1968) Introduction to combinatorial mathematics. McGraw-Hill, New York
98. Liu H, Sun L (2004) On domination number of 4-regular graphs. Czechoslovak Math J
54:889–898
99. Liu G, Yu Q (1998) On n-edge-deletable and n-critical graphs. Bull Inst Combinator Appl
24:65–72
100. Liying K, Erfang S (1995) On connected domination number of a graph. In: Ku T-H (ed)
Combinatorics and graph theory’95, vol 1. World Science, River Edge, NJ, pp 199–204
101. Lovász L, Plummer MD (1986) Matching theory. Annals of Discrete Mathematics, vol 29.
North-Holland, Amsterdam
102. Löwenstein C, Rautenbach D (2008) Domination in graphs of minimum degree at least two
and large girth. Graph Combinator 24:37–46
103. MacGillivray G, Seyffarth K (1996) Domination numbers of planar graphs. J Graph Theory
22:213–229
104. McCuaig W, Shepherd B (1989) Domination in graphs with minimum degree two. J Graph
Theory 13:749–762
105. Mojdeh DA, Rad NJ (2006) On the total domination critical graphs. Electron Notes Discrete
Math 24:89–92
106. Mojdeh DA, Rad NJ (2007) On an open problem concerning total domination critical graphs.
Expositiones Math 25:175–179
107. Moodley L (2000) Wojcicka’s theorem: complete, consolidated proof. J Combin Math Com-
bin Comput 33:129–179
108. Moscarini M (1993) Doubly chordal graphs, Steiner trees, and connected domination. Net-
works 23:59–69
109. Mynhardt CM (1998) On two conjectures concerning 3-domination-critical graphs. Congr
Numer 135:119–138
110. Newman-Wolfe RE, Dutton RD, Brigham RC (1988) Connecting sets in graphs – a domina-
tion related concept. Congr Numer 67:67–76
111. Ore O (1962) Theory of graphs. Am Math Soc Colloq Publ 38
112. Paris M (1994) Note: the diameter of edge domination critical graphs. Networks 24:261–262
113. Paris M, Sumner DP, Wojcicka E (1999) Edge-domination-critical graphs with cut-vertices.
114. Payan C, Xuong NH (1982) Domination-balanced graphs. J Graph Theory 6:23–32
115. Phillips JB, Haynes TW (2000) A generalization of domination critical graphs. Utilitas Math
58:129–144
116. Rautenbach D (2008) A note on domination, girth and minimum degree. Discrete Math
308:2325–2329
117. Reed B (1996) Paths, stars and the number three. Comb Probab Comput 5:277–295
118. Sampathkumar E, Walikar HB (1979) The connected domination number of a graph. J Math
Phys Sci 13:607–613
119. Sanchis LA (1997) Bounds related to domination in graphs with minimum degree two.
120. Sanchis LA (2000) On the number of edges in graphs with a given connected domination
number. Discrete Math 214:193–210
121. Shan E, Kang L, Henning MA (2007) Erratum to: A linear Vizing-like relation relating the
size and total domination number of a graph. J Graph Theory 54:350–353
122. Shiu WC, Zhang L-Z (2008) Pancyclism of 3-domination-critical graphs with small minimum
degree. Utilitas Math 75:175–192
123. Simmons J (2005) Closure operations and hamiltonian properties of independent and total
domination critical graphs. Ph.D. thesis, Department of Mathematics and Statistics, Univer-
sity of Victoria
124. Sumner DP (1976) 1-Factors and anti-factor sets. J Lond Math Soc 13:351–359
125. Sumner DP (1990) Critical concepts in domination. Discrete Math 86:33–46
126. Sumner DP, Blitch P (1983) Domination critical graphs. J Combin Theory B 34:65–76
127. Thomassé S, Yeo A (2007) Total domination of graphs and small transverals of hypergraphs.
Combinatorica 27:473–487
128. Tian F, Wei B, Zhang L (1999) Hamiltonicity in 3-domination-critical graphs with ˛ D ı C2.
Discrete Appl Math 92:57–70
129. Tian F, Xu J-M (2008) Distance domination-critical graphs. Appl Math Lett 21:416–420
130. van der Merwe LC, Mynhardt CM, Haynes TW (1998) Total domination edge critical graphs.
Utilitas Math 54:229–240
131. van der Merwe LC, Mynhardt CM, Haynes TW (1998) Criticality index of total domination.
132. van der Merwe LC, Mynhardt CM, Haynes TW (1999) 3-domination critical graphs with
arbitrary independent domination numbers. Bull ICA 27:85–88
133. van der Merwe LC, Mynhardt CM, Haynes TW (2001) Total domination edge critical graphs
with maximum diameter. Discuss Math Graph Theory 21:187–205
134. van der Merwe LC, Mynhardt CM, Haynes TW (2003) Total domination edge critical graphs
with minimum diameter. Ars Combinatoria 66:79–96
135. Vizing VG (1968) Some unsolved problems in graph theory. Uspekhi Mat Nauk 23:117–134
136. Wang C, Hu Z, Li X (2009) A constructive characterization of total domination vertex critical
137. Wang T, Yu Q (2009) Factor-critical property in 3-dominating-critical graphs. Discrete Math
309:1079–1083
138. White K, Farber M, Pulleyblank W (1985) Steiner trees, connected domination and strongly
chordal graphs. Networks 15:109–124
139. Wojcicka E (1990) Hamiltonian properties of domination-critical graphs. J Graph Theory
14:205–215
140. Xing H-M, Sun L, Chen X-G (2006) Domination in graphs of minimum degree five. Graph
141. Xue Y, Chen Z (1991) Hamiltonian cycles in domination-critical graphs. J Nanjing Univ
27:58–62
142. Yuansheng Y, Chengye Z, Xiaohui L, Yongsong J, Xin H (2005) Some 3-connected 4-edge-
critical non-Hamiltonian graphs. J Graph Theory 50:316–320
143. Zhang L-Z, Tian F (2002) Independence and connectivity in 3-domination-critical graphs.
144. Zwierzchowski M (2007) Total domination number of the conjunction of graphs. Discrete
Math 307:1016–1020
Chapter 5
Spectrum and Entropy for Infinite
Directed Graphs
Jun Ichi Fujii
Abstract From the viewpoint of operator theory, we discuss spectral properties for
infinite directed graphs that have bounded valences. Graphs may have selfloops, but
they are assumed not to have multiedges. Note that we use the transpose adjacency
operator throughout this chapter by reason of this viewpoint. As a subsidiary effect,
one may read this as a visual introduction to operator theory.
Keywords Infinite directed graph Spectrum Entropy Numerical range Fractal

Coding theory
MSC2000: Primary 05C50; Secondary 94A17, 94A24, 05C20, 05C38, 05C90,

47A10, 47A12
In this chapter, we observe spectral properties for infinite directed graphs and dis-
cuss entropies for them from the viewpoint of operator theory. First we give an
exact definition of the adjacency operator for an infinite directed graph and then
its representation by the Shatten operator also called dyad. In Sect. 5.2, we give in-
variants for graphs related to their spectra, e.g., the spectral radii, numerical ones,
and norms. These are monotone increasing quantities as graphs are growing. Also,
coloring problems for directed graphs are closely related to locations for spectra
in the complex plane. In Sect. 5.3, we introduce various products for two graphs
and discuss these spectral invariants. In Sect. 5.4, we consider (infinite) directed
trees, which are often generated by (finite) graphs. Infinite (generating) directed
trees are interesting objects related to other mathematical ones, e.g., Fibonacci se-
quences, self-similar fractals or entropies. Based on this consideration, we introduce
two types of entropies for graphs. In infinite graphs, the topological entropy differs
from the spectral entropy although these coincide for finite graphs. In an extreme
J.I. Fujii ()

Department of Arts and Sciences (Information Science), Osaka Kyoiku University,
Asahigaoka, Kashiwara, Osaka 582-8582, Japan

106 J.I. Fujii
case, the former is twice as large as the latter. As an application for graphs in the
last section, we use Ziv’s entropy and show a source coding theorem which is a
generalization of Ziv’s one.
5.1 Adjacency Operator and Dyadic Representation
For a directed graph G with the vertices V .G/ of G, an arrow (or arc) from u to v
is denoted by .u; v/ or u ! v and the set of all arrows by E D E.G/. We exclude
multigraphs here and V .G/ is countable. The set of vertices V D V .G/ corresponds
to an orthonormal basis fev g of a (complex) Hilbert space
( ˇ )
X ˇ X
ˇ
H D `2 .V .G// D `2 .G/ D x D xv ev ˇ jxv j2 < 1
ˇ
v2V v2V
sX
P
with the inner product hx; yi D v2V xv yv and the norm kxk D jxv j2 .
v2V
Following Mohar’s adjacency operator for undirected graphs in [20], Fujii et al. [12]
defined the adjacency operator A D A.G/ for a directed graph G as the closed
operator with the domain
8 ˇ ˇ ˇ 9
< X ˇ X ˇ X ˇ2 =
ˇ ˇ ˇ
Dom A D xD xv ev 2 H ˇ ˇ xv ˇ < 1
: ˇ ˇ v!u ˇ ;
v2V u2V
and the value for the above x

!
X X
Ax D xv eu : (5.1)
u2V v!u
Here we remark that this definition is not a usual adjacency operator but its trans-
pose. If A.G/ is selfadjoint (or transpose invariant), then G is considered as an
undirected graph. Define the outdegree d C .v/ (resp. indegree d .v/) for a vertex v
as the cardinal number of the arrows from (resp. to) v. It is easy to see that
X X
d C .v/ D kAev k D 1 and d .v/ D kA ev k D 1:
u v u!v

1 1 1 2
For example, is the adjacency operator for the graph ı ı and
0 0
d C .1/ D d C .2/ D 1; d .1/ D 2 and d .2/ D 0:

5 Spectrum and Entropy for Infinite Directed Graphs 107
A graph G is said to have a bounded valency k if d ˙ .v/ 5 k for all v 2 V .G/

(One might think A.G/ is an infinite matrix with each row-sum and each column-
sum are not greater than k). Then we have (see [12, Theorem 2]):
Proposition 1. An infinite directed graph G has a bounded valency if and only if

A.G/ is a bounded operator on H. In this case, the valency k implies
n ˇ o
ˇ
kA.G/k inf t = 0 ˇ kA.G/xk 5 tkxk .8x 2 H/ 5 k:
Proof. Suppose G has the valency k. Then the property

X
n.ja1 j2 C C jan j2 / ja1 C C an j2 D jai aj j2 = 0
15i <j 5n
shows
X X X X
kA.G/xk2 D j xv j2 5 d .u/ jxv j2
u2V v!u u2V v!u
XX X
2
5k jxv j D k d .v/jxv j2
C
u2V v!u v2V

X
2
5k jxv j2 D k 2 kxk2 ;
v2V
so that kA.G/k 5 k. Conversely suppose G does not have any finite valency. We
may assume that for any N there exists evN with d C .evN / > N . Then
kA.G/evN k D d C .evN / > N D N kevN k
implies that A.G/ cannot be bounded. t

u
Throughout this chapter, we assume G has a bounded valency; that is, A.G/ is a
bounded operator. So we define the norm of the graph G by kGk D kA.G/k. Since
A.G/ D tA.G/ is the adjacency operator for the converse directed graph for G,
the graph G denotes it.
Finally in this section, we give a representation of A.G/. Each arrow .u; v/ is
expressed as a dyad ev ˝ eu for u; v 2 V .G/, where .ev ˝ eu /x D hx; eu iev for
x 2 H. Then the adjacency operator A.G/ of G has a dyadic representation
!
XX X
A.G/ eu ˝ ev D eu ˝ ev in short ;
u2V v!u v!u
where the sum is in the strong operator topology; that is,
An ! A ” k.An A/xk ! 0 for all vectors x 2 H:

108 J.I. Fujii
P
Then we obtain (5.1) again: For x D w2V xw ev ,
!
X X X X X X
A.G/x D hew ; ev ixw eu D xw eu D xw eu :
u;w2V v!u u;w2V w!u u2V w!u
5.2 Spectral Invariants
Since A.G/ represents G itself, we adopt definitions for notions of G by those of

A.G/ in the operator theory (as a beginner’s book, see [17]):
˚ ˇ
spectrum .G/ D .A.G// D ˇ A I is not invertible ;
˚ ˇ
numerical range W .G/ D W .A.G// D hA.G/x; xi ˇ kxk D 1 ;
˚ ˇ
spectral radius r.G/ D r.A.G// D sup ˇ 2 .G/ ;
˚ ˇ
numerical radius w.G/ D w.A.G// D sup ˇ 2 W .G/ :
The spectrum is a nonempty closed set and included by W .G/, the closure of W .G/,
which is convex (the Toeplitz–Hausdorff theorem). If the closed convex hull of .A/
coincides with W .A/, then A is called convexoid. Recall G is normally symmetric
if G satisfies
˚ ˇ ˚ ˇ
u 2 V .G/ ˇ v ! u; w ! u 2 E.G/ D u 2 V .G/ ˇ v u; w u 2 E.G/ :
Then we can show as in [12] that G is normally symmetric if and only if A.G/
is normal; i.e., A.G/ A.G/ D A.G/A.G/ . Thus normally symmetric (and hence
undirected) graphs are convexoid. An example for convexoid graphs which is not
normally symmetric is the backward shift U , which is discussed in the preced-
ing paragraph of Theorem 3. Moreover, the following relations are well known in
operator theory:
r.G/ D lim kA.G/n k1=n 5 w.G/ 5 kGk 5 2w.G/; (5.2)

n!1
where r.G/ D w.G/ D kGk holds if G is normally symmetric. In operator theory,

each equality in the inequalities (5.2) determines a class of operators, respectively
(cf. [17]). If G is purely directed, i.e., A.G/ C A.G/ defines the undirected graph
G which is called the symmetric cover of G, then w.G/ D 2w.G/; see [24].
Since the triangle inequality
w.A C B/ 5 w.A/ C w.B/
holds for all operators, the numerical radius determines an equivalent norm to the
usual one.
v w
Example 1. Take a nilpotent graph N2 W ı ! ı with the adjacency matrix
A.N2 / D ew ˝ ev . The term “nilpotent” is derived from the property
A.N /2 D O (We discuss a general case later around Theorem 9). Then
1
r.N2 / D 0; w.N2 / D and kN2 k D kev kkew k D 1:
2
Another typical example that shows the difference between finite and infi-
nite graphs is given by Mohar and Woess [21]: A graph G is called k-regular
if d ˙ .v/ D k for all v 2 V .G/. If G is finite, then r.G/ D k [3]. But it
does not hold for the following tree, which motivated us to study entropies for
graphs.
p Let T be the 3-regular homogeneous undirected tree (Fig. 5.1); then

Example 2.
r.T / D 2 2 is shown in [21, (7.6)] in spite of k D 3.
First we observe properties for the spectrum and the numerical range in the com-
plex plane [13, 14].
Theorem 1. The spectrum .G/ and the numerical range W .G/ of a graph G are
symmetric with respect to the real axis.
P
Proof. For a unit vector x, we put its conjugate x D v xv ev . Then, for D
hA.G/x; xi 2 W .G/, via dyadic representation, we have
X X XX
D xv xw heu ; ew i D xv xu ;
v;w2V v!u v2V v!u
and hence
XX
D xv xu D hA.G/x; xi 2 W .G/:
v2V u v
Fig. 5.1 Regular

homogeneous undirected tree
110 J.I. Fujii
Consider the approximate point spectrum .G/;

˚ ˇ
.G/ .A.G// D 2 Cˇ9kxn k D 1I k.A.G/ /xn k ! 0 :
Similarly we can show .G/ is symmetric. Since .G/ D .G/ [ .G /, we have
.G/ is also symmetric. t
u
Recall that G is called a bipartite graph if V .G/ can be divided into two disjoint
sets V0 and V1 such that there is no arrow between two vertices in the same set.
More generally, if V .G/ can be divided into m disjoint sets Vk .k D 0; : : : ; m 1/
such that all the arrows from Vk strike in V.kC1/ mod m , then G is called cyclically
m-partite.
Example 3. The following graph is cyclically 3-partite:
8
ˆ
~ }!~ } ! ~ <} 2 V0
ˆ
# % # - # % # - # ~ 2 V1
ˆ
~! ~ ! :̂ 2 V
2
Theorem 2. The spectrum .G/ and the numerical range W .G/ of a cyclically
m-partite graph G are invariant under the 2
m
-rotation in the complex plane.
Proof. Rearranging the vertices according to the direct sum decomposition
H `2 .V / D `2 .V0 / ˚ ˚ `2 .Vm1 /;
we may assume that the adjacency operator is of the form for adjacency suboperators
Aj on `2 .Vj /:
0 1
O Am1
BA0 O O C
B C
A.G/ D B : : :: C :
@ :: :: : A
O Am2 O
Then, for a unit vector x D .xk / 2 `2 .V0 / ˚ ˚ `2 .Vm1 /, we have
hA.G/x; xi D hAm1 xm1 ; x0 i C hA0 x0 ; x1 i C C hAm2 xm2 ; xm1 i:
For D exp.2 i=m/, take
y D t.x0 ; m1 x1 ; m2 x2 ; : : : ; xm1 /:
Note that mCk D k and
y D t.x0 ; x1 ; 2 x2 ; : : : ; m1 xm1 /:
Thereby, kyk D 1 and hA.G/y; yi D hA.G/x; xi D . Thus 2 W .G/, that

is, W .G/ is invariant for the rotation. Similarly we have .G/ is invariant. t
u
Corollary 1. The spectrum and the numerical range of a bipartite graph are
symmetric at the origin.
Next we see the radii of graphs. It is known that the spectrum is closed but the
numerical range is not: For example, let U be the backward shift graph
ı ı ı ı :
Then W .U / is open unit disc [18, Sol. 168(2)] and .U / is the closed one [18,
Sol. 67], and therefore w.U / D 1 … W .U /. In this case, r.U / D 1 2 .U /,
which implies .U / 6 W .U / and .A/ W .A/ holds for all operators A. In
general, the statements r.A/ 2 .A/ and w.A/ 2 W .A/ are false. But r.G/ 2 .G/
and w.G/ 2 W .G/ hold for any graphs G as we later. We show in [14] the former,
which is a natural infinite
P version of the Perron–Frobenius
P theorem. To see the latter,
for a unit vector x D v xv ev , define jxj D v jxv jev . Then

jhA.G/x; xij 5 hA.G/jxj; jxji and jxj D 1:
Thus w.G/ 2 W .G/ holds [9].

Theorem 3. For any graph G, the relations r.G/ 2 .G/ and w.G/ 2 W .G/ hold.
Moreover, there exist positive unit vectors xn 2 `2 .G/ with k.r.G/ A.G//xn k !
0 and consequently r.G/ 2 .G/.
To show the above results on the spectral radius, we need a notation and a lemma
as in Bonsall’s method in [23]. For H D `2 .G/, define an equivalence relation
on the direct sum H ˚ H by i.x; y/ .y; x/ and the equivalence class of
.x; y/ is denoted by Œx; y as we identify C with IR ˚ IR. Then the quotient space
B D H ˚ H= is a Banach space with a norm
kŒx; yk D sup k.cos t/x C .sin t/yk;

t
where kxk C kyk = kŒx; yk = maxfkxk; kykg hold. For A 2 B.H/, define AQ on
Q y D ŒAx; Ay. Then the map A 7! AQ is an isometrical isomorphism and
B by AŒx;
Q Then we have
hence r.A/ D r.A/.
Lemma 1. For a complex number with jj > r.G/ for some graph G,
Q 1 Œx; yk 5 k.jj A.G//1 .x C y/k

k. A.G//
for all nonnegative vectors x .i.e., xv = 0 for all v 2 V / and y in H.

Q and
Proof. Put A D A.G/. For D re i t , we have r D jj > r.A/ D r.A/
1
X 1
X
Q 1 Œx; y D
. A/ n AQn1 Œx; y D r n e i nt AQn1 Œx; y
nD1 nD1
1
X
D r n AQn1 Œ.cos nt/x C .sin nt/y; .cos nt/y .sin nt/x:
nD1
112 J.I. Fujii
For a vector function

X
P .s/ D r n An1 .cos.nt C s//x C .sin.nt C s//y ;
n
the nonnegativity for r n An1 , x, and y shows
Q 1 Œx; yk D sup kP .s/k 5 k.r A/1 .x C y/k:

k. A/ t
u
s
Proof of Theorem 3. We have only to show the results on the spectral radius. Sup-
pose r D r.G/ … .G/. Put A D A.G/. For re i t 2 .A/ D .A/, Q take positive
numbers frn g # r and a vector z 2 B with
Q 1 zk D 1
lim k.rn e i t A/
n!1
via the uniform boundedness theorem. Here we can take positive vectors v; w; x; y
with z D Œv w; x y. In fact, take positive vectors xk and yk with
x D x1 x2 C i.x3 x4 / and y D y1 y2 C i.y3 y4 /:
Then we can rearrange
z D Œx; y D Œx1 x2 ; y1 y2 C Œi.x3 x4 /; i.y3 y4 /

D Œx1 x2 ; y1 y2 C Œ.y3 y4 /; x3 x4
D Œ.x1 C y4 / .x2 C y3 /; .y1 C x3 / .y2 C x4 /:
It follows from Lemma 1 that

Q 1 zk 5 k.rn e i t A/
k.rn e i t A/ Q 1 Œv; xk C k.rn e i t A/
Q 1 Œw; yk
5 k.rn A/1 .v C x/k C k.rn A/1 .w C y/k
5 k.rn A/1 k.k.v C x/k C k.w C y/k/;
which contradicts the choice of z. Thus r.G/ 2 .G/.

Next we see r.G/ 2 .G/. Then we can take positive numbers tn # r.G/ and a
positive vector z 2 H with
lim k.tn A/1 zk D 1:

n!1
Moreover, putting a strictly positive unit vector y by

zCw X
yD where w D 2k ev.k/ ;
kz C wk
k
we also have
lim k.tn A/1 yk D 1:
n!1
Take unit vectors xn D .tn A/1 y=k.tn A/1 yk. It follows that
k.r.G/ A/xn k 5 k.r.G/ tn /xn k C k.tn A/xn k

kyk
D jr.G/ tn j kxn k C
k.tn A/1 yk
1
D tn r.G/ C ! 0;
k.tn A/1 yk
which shows r.G/ 2 .G/ and gives the required vectors xn . t

u
Recall the spanning subgraph G 0 of G is a graph such that V .G/ D V .G 0 / and

E.G/ E.G 0 /. Then kGk, r.G/ and w.G/ are monotone increasing:
Theorem 4. If G 0 is a spanning subgraph of G, then
kG 0 k 5 kGk; r.G 0 / 5 r.G/ and w.G 0 / 5 w.G/:
Proof. For nonnegative unit vector x, we have 0 5 hA.G 0 /x; xi 5 hA.G/x; xi and
kA.G 0 /xk2 D hA.G 0 / A.G 0 /x; xi 5 hA.G/ A.G/x; xi D kA.G/xk2 :
Thus the numerical radius and the norm are monotone increasing. So is the spectral
radius by
r.G 0 / D lim kA.G 0 /n k1=n 5 lim kA.G/n k1=n D r.G/: t

u
n!1 n!1
Although one might conjecture that r.G/ (or else) is approximated by finite span-
ning subgraphs Gn , it is false: Consider the unilateral shift graph:
U W ı ! ı ! ı ! :
Then all the finite subgraphs of U are nilpotent, and r.U / D 1. But Y. Seo gave the
following interesting example in [15] which has the approximating finite subgraphs
slightly related to Chebyshev polynomials Tn with Tn .cos x/ D cos nx. (We give
another proof here based on Seo’s idea.)
Example 4. Let an infinite graph G be
1 3 5 2n 1
ı ı ı ı
GW l l l l
ı!ı! ı ! ı !
2 4 6 2n :
114 J.I. Fujii
Then we have
0 1 0 1
01 10 1 000
B1 0 000 C B0 220 C
B C B C
B0 0 011 C B0 220 0 C
B C B C
B C B 0C
A.G/ D B0 1 100 C and A.G/ A.G/ D B0 002 2 C;
B C B C
B0 0 000 C B0 002 2 0C
B :: C B :: C
@0 0 011 :A @0 000 0 :A
:: :: :: :: :: :: :: ::
: : : 00 : : : : 0 0 :
p
which shows r.G/ 5 kGk D kA.G/ A.G/k D 2. Take corresponding finite
graphs for each natural numbers n:
1 3 5 2n 1
ı ı ı ı
Gn W l l l l
ı! ı!ı! ı
2 4 6 2n :
Considering the characteristic polynomial (of order 2n) Sn .x/ for Gn ,

0 1
x 1 1 0
B 1 x 0 0 C
B C
B 0 x C
B 0 1 C
B C
B 0 1 1 x C
B C
Sn .x/ det.A.Gn / xI / D det B :: C:
B : C
B C
B x 1 1 0 C
B C
B
B 1 x 0 0 CC
@ 0 0 x 1 A
0 1 1 x
Putting the determinant (polynomial of order 2n 1) for the following .2n 1/

.2n 1/ matrix (and expanding it at the 1st row to get Sn1 ):
0 1
1 1 0
B0 x 1 C
B C
B1 1 x C
B C
B C
B :: C
Rn .x/ D det B : C D Sn1 .x/ C .1/2 Rn1 .x/;
B C
B x 1 1 0 C
B C
B
B 1 x 0 0 C
C
@ 0 0 x 1 A
0 1 1 x
we can expand Sn :
Sn .x/ D x 2 Sn1 .x/ Rn .x/:
It follows that
Sn .x/ Sn1 .x/ D x 2 .Sn1 Sn2 / .Rn .x/ Rn1 .x//

D x 2 .Sn1 Sn2 / Sn1 .x/;
and consequently
Sn .x/ x 2 Sn1 .x/ C x 2 Sn2 D 0:
Putting
p
x 2 C i 4x 2 x 4
D ;
2
which is a solution of t 2 x 2 t C x 2 D 0, we have
n n .n n /.x 2 1/
Sn .x/ D S1 .x/ D p :
i 4x 2 x 4
Let x D 2 cos y. Then

n n
4 cos2 yC4i sin y cos y 4 cos2 y4i sin y cos y
2 2
Sn .2 cos y/ D .4 cos2 y 1/
4i sin y cos y
4 cos2 y 1
D 2n cosn y ..cos y C i sin y/n .cos y i sin y/n /
2i sin 2y
4 cos2 y 1
D 2nC1 .cosn y/.sin ny/ :
2i sin 2y
For y D =n, we have
4 cos2 n 1
Sn 2 cos D 2nC1 cosn .sin / D 0:
n n 2i sin 2
n
Thus 2 cos n 2 .Gn /, so that

2 cos 5 r.Gn / 5 r.GnC1 / 5 5 r.G/ 5 2 D lim 2 cos ;
n n!1 n
which implies r.Gn / " r.G/ as n ! 1.

116 J.I. Fujii
5.3 Products for Graphs
If V .G/ D V .G 0 /, then the product A.G/A.G 0 / (in particular, A.G/n ) makes sense,
but it does not always represent the adjacency operator of some graph in discourse.
This usual product is discussed in the next section. Here we investigate some “prod-
ucts” for graphs.
First we introduce the tensor product for graphs [10]. The tensor product `2 .V / ˝
` .W / for Hilbert spaces `2 .V / and `2 .W / can be defined as `2 .V W / where
2
ev ˝ ew denotes .ev ; ew / which forms the basis of `2 .V / ˝ `2 .W /. The inner product

of it means
hx1 ˝ y1 ; x2 ˝ y2 i D hx1 ; x2 ihy1 ; y2 i:
The tensor product A ˝ B for operators A and B is defined by
.A ˝ B/.x ˝ y/ D Ax ˝ By;
which is an extension of the Kronecker product for matrices. It follows from the
definition
.A ˝ B/.C ˝ D/ D AB ˝ CD:
It is known that
kA ˝ Bk D kAkkBk and .A ˝ B/ D .A/.B/:
Note that W .A ˝ B/ W .A/W .B/ and the equality does not always hold. In
fact, let
0 1 0 0
AD ; B D tA D :
0 0 1 0
˚ ˇ
Then W .A/ D W .B/ D W .A ˝ B/ D ˇjj 5 1=2 . In particular,
1 1
w.A/w.B/ D < D w.A ˝ B/;
4 2
and r.A ˝ B/ D r.A/r.B/. Indeed,
r.A ˝ B/ D lim k.A ˝ B/n k1=n D lim kAn ˝ B n k1=n

n!1 n!1
n n 1=n
D lim .kA kkB k/ D r.A/r.B/:
n!1
Now, we define the tensor product G ˝ H for graphs G and H by

X X
A.G ˝ H / D A.G/ ˝ A.H / D .eu ˝ ev / ˝ .ex ˝ ew /
.v!u/2V .G/ .w!x/2V .H /
X X
D .eu ˝ ex / ˝ .ev ˝ ew /:
.v!u/2V .G/ .w!x/2V .H /
So, summing up, we have:

Theorem 5. For graphs G and H ,
kG ˝ H k D kGkkH k; .G ˝ H / D .G/.H /; r.G ˝ H / D r.G/r.H /;

W .G ˝ H / W .G/W .H / and w.G ˝ H / = w.G/w.H /:
P1
Example 5. Let U D kD1 ekC1 ˝ ek be the (unilateral) shift:
1 2 3

U W ı ! ı ! ı ! r.U / D 1
and S C.2/ the supercomplete graph:

v w
S C.2/ W ı ! ı r.S C.2// D 2 :
Since
A.S C.2// D ev ˝ ev C ev ˝ ew C ew ˝ ev C ew ˝ ew ;
we have
1
X
A.S C.2/˝U / D ev.kC1/ ˝ evk Cev.kC1/ ˝ ewk Cew.kC1/ ˝ evk Cew.kC1/ ˝ ewk
kD1
where the new vertices vk are determined by evk D ev ˝ ek . Thus the tensor product
S C.2/ ˝ U is
v1 v2 v3 v4
ı ! ı ! ı ! ı
S C.2/ ˝ U W %
& % & % & r S C.2/ ˝ U D 2 :
ı ! ı ! ı ! ı
w1 w2 w3 w4

In general, we have r S C.n/ ˝ U D n.
Next we mention the Hadamard (Schur) product for graphs. Let G and H be
infinite directed graphs with V .G/ D V .H /. Then the Hadamard product G
H is
defined by A.G/
A.H /;
hA.G/
A.H /ev ; ew i D hA.G/ev ; ew ihA.H /ev ; ew i:
Take isometric operator U (i.e., U U D I ) from `2 .V / to `2 .V / ˝ `2 .V / deter-

mined by Uev D ev ˝ ev for all v 2 V , namely, as a dyadic representation,
X
U D .ev ˝ ev / ˝ ev :
v2V
118 J.I. Fujii
Then we have the Toyama–Marcus–Khan theorem [6, 10, 22]:
A.G/
A.H / D U .A.G/ ˝ A.H //U;
which is a useful tool to investigate properties of the Hadamard product.

Since we have E.G
H / D E.G/ \ E.H /, the Hadamard product G
H is a
spanning subgraph of G and H . Thus Theorem 5 implies
kG
H k 5 kGk; kH k; r.G
H / 5 r.G/; r.H / and w.G
H / 5 w.G/; w.H /:
Noting that A ˝ B D .A ˝ I /.I ˝ B/ D .I ˝ B/.A ˝ I /, we have
.A ˝ I C I ˝ B/ D .A/ C .B/
for all bounded operators. But, even for graphs G and H , the operator A.G/ ˝ I C
I ˝ A.H / is not always the adjacency one of some graph. Here we adopt Mohar’s
term [21]: A graph G is called simple if there is no selfloop.
Then, for simple graphs G and H , the graph G ˚ H defined by
A.G ˚ H / D A.G/ ˝ I`2 .V .H // C I`2 .V .G// ˝ A.H / (5.3)
is called the Cartesian product. Although the Cartesian product can be defined for
all simple graphs, we also define it for graphs if (5.3) determines some graph. In the
case of Example 5, we have:
Example 6. Although the shift U in Example 5 is simple, a supercomplete graph
S C.n/ is not. But the Cartesian product S C.2/ ˚ U can be defined as

ı ! ı ! ı ! ı
S C.2/ ˚ U W l l l l r S C.2/ ˚ U D 3
ı ! ı ! ı ! ı

The definition (5.3) implies r S C.n/ ˚ U D n C 1 in general.
In general, spectral relations for the Cartesian products for simple graphs are:
Theorem 6. For simple graphs G and H , the following hold:
.G ˚ H / D .G/ C .H /; and W .G ˚ H / W .G/ C W .H /
and
kG ˚H k 5 kGkCkH k; r.G ˚H / D r.G/Cr.H /; w.G ˚H / D w.G/Cw.H /:
Proof. For unit vectors x and y
hA.G/x; xi C hA.H /y; yi D hA.G/x; xihy; yi C hx; xihA.H /y; yi

D hA.G/ ˝ I C I ˝ B/x ˝ y; x ˝ yi 2 W .G ˚ H /;
which implies the inclusion for numerical ranges. Moreover it shows
w.G ˚ H / = w.G/ C w.H /
and the reversed inequality is the triangle one, so that we have the equality. Other
relations are clear. t
u
For simple undirected graphs, Mohar and Woess [21] introduced the NEPS (i.e.,
the noncomplete extended p-sum) which is a general concept including tensor and
Cartesian products. We extend it to the directed case in [10]: Let C be a nonempty
subset of the two-dimensional binary space f0; 1g2 . For simple graphs G and H , the
NEPS G H is defined as the graph with vertices V D V .G/ V .H / satisfying
C
X
A.G H / D A.G/c1 ˝ A.H /c2 (5.4)
C
.c1 ;c2 /2C
with convention X 0 D I . If the right-hand side of (5.4) determines a graph, it can

be defined even for the nonsimple case.
If C D f.1; 1/g, then NEPS means tensor product and C D f.1; 0/; .0; 1/g gives
C
the Cartesian one. Now we have general spectral results by (5.4).
Theorem 7. For simple graphs G and H ,
8 ˇ 9
< X ˇ =
ˇ
.G H / D c1 c2 ˇ 2 .G/; 2 .H /
C : ˇ ;
.c1 ;c2 /2C
and X
r.G H / D r.G/c1 r.H /c2 :
C
.c1 ;c2 /2C
Remark 1. Recently, from the viewpoint of quantum information theory, Accardi

et al. discussed other products of rooted undirected simple graphs G (i.e., there is a
unique vertex eG called the root. Rooted graphs are extended easily to the directed
case; in particular, we will discuss the “rooted directed tree” to consider entropy for
all graphs). The orthogonal product for G and H is the graph obtained by attaching
a copy of H by its root eH to each vertex of G except its root eG . If a copy of H is
attached also to eG in addition to the orthogonal product, then it is called the comb
product. The star product is obtained by attaching a copy of H by eH only to eG .
Their main interest is in the free product .V; E/ of a finite set of rooted graphs Gk :
Define the set of vertices as the words by
˚ ˇ
V D feg [ v1 v2 vm ˇ vk 2 V .Gjk / n feGjk g jk 6D jkC1 ;
where e is newly added as the empty word. The empty word means ev D ve D e for
all vertices v and the original roots ek are identified with e. Define the edge by
˚
E D fvu; v0 ug j fv; v0 g 2 [j E.Gj /; u; vu; v0 u 2 V :
120 J.I. Fujii
If the length ` of each word in E is restricted to ` 5 m for some m, then the free
product is called an m-free one. (for details, see [1]).
All these notions can be extended to the directed case; for example, the above E
is redefined by
˚
E D fvu; v0 ug j v ! v0 2 [j E.Gj /; u; vu; v0 u 2 V ;
so that we have the definition of the free product for directed rooted graphs. Here
we give each example for directed graphs. Let
ı v2
%
H W ı and G W ı ! ı
w eH eG v1 &
ı v3 ;
then we have
orthogonal product comb product star product

ı ı ı v2
% % %
e e
ı!ı ; ı!ı ; ı! ı
& w e v1
& &
ı ı ı v3
and
v2 w ı ı ! wv2
- %
2-free product ı ı ! ı ! wv1
v1 w
. &
ı ı ! wv3 :
v3 w
5.4 Directed Path and Tree
To see the spectral structure of graphs, we consider directed trees and paths. Here
a k-path from v to w in G means a set of connected k arrows from v to w in
G whose existence corresponds to the .v; w/-element of A.G/k . If A.G/k deter-
mines some graph, then G is called k-powerable (for k D 2, squarable). If A.G/ is
k-idempotent (i.e., A.G/k D A.G/) or k-nilpotent (i.e., A.G/k D O), then G is
k-powerable. The permutation graphs and shift ones are k-powerable for all k 2 R.
Algebraic operators, such as idempotent and nilpotents, have a specific spectral
property: Equation p.A/ D O implies p./ D 0 for 2 .A/ by the spectral
mapping theorem. Thus, for k-idempotent (resp. nilpotent) A, we have
n ˇ o
2 ij ˇ
.A/ e k1 ˇ j D 1; : : : ; k 1 [ f0g .resp. .A/ D f0g/ ;
and hence r.A/ D 1 (resp. 0). Moreover it has a standard block matrix form

I T O T
AD resp. ;
O O O O
so that we have
˚ ˇ ˚ ˇ
W .A/ D 1 C hT y; xi ˇ kxk2 C kyk2 D 1 resp. hT y; xi ˇ kxk2 C kyk2 D 1
p
kT k kT k
w.A/ D 1 C resp. and kAk D 1 C kT k2 .resp. kT k/ :
2 2
Example 7. A typical connected k-idempotent finite graph Ik is defined by the k k

adjacency matrix
0 1
0 0 1 1
B1
B 0 01C C
B
B : :: C
:: :: C
B0 1 :: : : :C Rk1 1k1
A.Ik / D B : CD ;
B: :: :: C 0k1 0
B: : : 0 0 1C
B C
@0 1 0 1A
0 0 0 0
where Rk1 is the k 1-dimensional cyclic permutation and 1k1 (resp. 0k1 )
is the k 1-dimensional column (resp. row) vector with entries 1 (resp. 0). Then
p
1C k1
p
r.Ik / D 1, w.Ik / D 2
and kIk k D k. These graphs are:
a a a
j I3 a I4 I5 @I
I2 a
6 ]
J @ a 6
S
a J
6 a
/
- wa
S

HH J ? @
a a
j a
- a -Ra
@
Clearly, the above notions can be rephrased in terms of k-paths.

Theorem 8. The following equivalences hold.
(1) A graph G is k-powerable if and only if G has at most one k-path between each
pair of vertices.
(2) A graph G is k-idempotent if and only if the condition that G has a unique
k-path from v to w is equivalent to v ! w 2 E.G/.
(3) A graph G is k-nilpotent if and only if G has no k-path.
Similarly to (1) in the above theorem, we give a condition that the usual product
makes sense.
122 J.I. Fujii
Corollary 2. For graphs G and H with V D V .G/ D V .H /, the product

A.G/A.H / determines some graph GH if and only if
˚ ˇ
# u 2 V ˇ v ! u 2 E.H /; u ! w 2 E.G/ 5 1
for all pairs .v; w/ of vertices in V .

A quasinilpotent operator is the one with .N / D f0g, or equivalently r.N / D 0.
For example, the backward weighted shift
0 1
0 21 0
B0 0 22 0 C
B C
Uf2 k g D B0 0 0 23 C
@ A
:: :: :: ::
: : : :
2 4 6
satisfies Uf2k g Uf2 k g D diag.0; 2 ; 2 ; 2 ; : : :/ and thereby
n.n1/
1 n
kUf2 k g k D 2 and k.Uf2 k g / k D 2
2 :
It follows that
n1
n 1=n
r.Uf2 k g / D lim k.Uf2k g / k D lim 2 2 D 0:
n!1 n!1
Thus the quasinilpotent operator is not always nilpotent. Nevertheless all quasi-
nilpotent graphs are nilpotent and r.G/ … .0; 1/ for all graphs G.
Theorem 9. The following statements are equivalent: (i) G is nilpotent, (ii) G is
quasinilpotent, and (iii) r.G/ < 1.
Proof. It suffices to show (iii) implies (i). In fact, suppose that r.G/ < 1. Then there
exists n with kA.G/n k < 1. Since all the entries of A.G/n are nonnegative integers,
its norm is not less than 1 unless it is a zero operator. Thus A.G/n must be zero; that
is, G is nilpotent. t
u
Next we consider trees generated by a graph. Here a .mono/ rooted tree means
a nontrivial directed tree graph G with a unique origin; that is, a graph G with the
valency k has no selfloops and there is a vertex v0 called the origin such that
d C .v/ 5 k for all v 2 V; d C .v0 / 6D 0

d .v0 / D 0 and d .v/ D 1 for v 6D v0 :
Thus, the minimum graph in the rooted trees is ı ! ı. Note also that a rooted tree
T is not normally symmetric but k-powerable for all k. Note that we can take T 0
naturally with A.T 0 / D A.T /2 and V .T 0 / D V .T /, which is denoted by T 2 . Then
we have that T 2 is a rooted tree again and so is T n for each n.
For a rooted tree T , let T ŒnI v be the number of n-paths starting from the vertex v.
C C
In particular, T Œn denotes T ŒnI v0 . Thus, T ŒnI v D d.n/ .v/ where d.n/ is the degree
n
function in T . So we can obtain the norm, the spectral radius, and afterwards the
(prototype of) entropy of a rooted tree.
Theorem 10. If T is a rooted tree, then

p
r.T / D lim max T ŒnI v1=.2n/ and kT k D max d C .v/:
n!1 v2V v2V
Proof. Since d .v/ 1 except v0 , then A.T / A.T / is the diagonal matrix
diag.d C.v1 /; d C .v2 /; /, so that we obtain the formula for norm kT k. Thereby
p n1
1 1
r.T / D lim kT n k n D lim max T ŒnI v D lim max T ŒnI v 2n : u
t
n!1 n!1 v2V n!1 v2V
Example 8. Let Tk be the (rooted) k-regular .directed/ tree, that is, a rooted tree
with d C .v/ k. The 1-regular treep
T1 is also called the unilateral shift and denoted
also by U . Then we have r.Tk / D k.
Example 9. For a monotone-increasing sequence c D .c.n// in N , let Mc be the

class of rooted trees T with T Œc.n/ D 1 for all n. Define a locally k-regular tree
Fc 2 Mc as a rooted tree with valency k = 2 such that Fc Œm D kFc Œm 1 for all
m 2 N nfc.n/jn 2 N g. So we have
log Fc Œn log Fc Œc.n/

lim inf D lim inf D 0:
n!1 n n!1 c.n/
In this tree Fc , d C .v/ D k except the vertices that are the terminals of paths from
the origin whose lengths are c.n/ 1. For j with 0 < j 5 c.n/ c.n 1/, we have

log Fc Œc.n/ j .c.n/ c.n 1/ j / log k c.n 1/
D D 1 log k
c.n/ j c.n/ j c.n/ j

c.n 1/ log Fc Œc.n/ 1
5 1 log k D :
c.n/ 1 c.n/ 1
It follows that

log Fc Œn log Fc Œc.n/ 1 c.n 1/
lim sup D lim sup D 1 lim sup log k:
n!1 n n!1 c.n/ 1 n!1 c.n/ 1
Thus, lim sup.log Fc Œn/=n D 0 if c.n/ is a polynomial of n. However, it is equal to

n
.log k/.M 1/=M for c.n/ D M n and log k for c.n/ D M N .
124 J.I. Fujii
Considering this example, we define H0 .T / as
1
H0 .T / D lim sup log T Œn;
n!1 n
which is a prototype of entropy. Then, in Example 8, we have
H0 .Tk / D log k D 2 log r.Tk /:
For a rooted tree T with the valency k, it holds for any n that T Œn 5 Tk Œn D k n .
So we have an upper bound of H0 .T / by Example 9 and a lower bound.
Lemma 2. Let T be a rooted tree with the valency k. If T is infinite, then 0 5

H0 .T / 5 log k, and otherwise H0 .T / D 1.
For a nontrivial directed graph G with the valency k and a fixed vertex w in G,
define the free-generating tree T .GI w/ as the rooted tree satisfying (T0 )–(T2 ).
(T0 ) There is a surjection ˚ from V .T .GI w// onto V .G/,
(T1 ) d C .v/ D d C .˚.v// for all v 2 V .T .GI w//,
(T2 ) ˚.v0 / D w for the origin v0 of T .GI w/.
For the sake of convenience, we identify v0 with w. All the directed paths in
T .GI w/ correspond one-to-one to those in G via ˚. Thus, the number of the
n-paths from w in G is exactly T .GI w/Œn. For example:
Example 10. For all the following graphs Gk , the free-generating rooted tree
T .Gk I v/ for any vertex v is a unilateral shift U :

G1 W ı G2 W ı ı G3 W ı !ı G4 W ı ! ı
ı
G5 W . - G6 W ı ! ı ! ı G7 D U W ı ! ı ! ı ! :
ı ! ı
Example 11. For the homogeneous k-regular undirected tree Uk (i.e., d ˙ .v/ k),
the free-generating tree T .Uk I v/ is the k-regular tree Tk for all v.
The following lemma is a characterization of nilpotent graphs in terms of the

free-generating trees. Recall that the length of a finite tree T is the maximum of the
lengths of the paths in T .
Lemma 3. A graph G is nilpotent if and only if all free-generating trees of G are

finite and their lengths are bounded.
It is easy to see that T .T I v0 / D T for a rooted tree T with the origin v0 .

For a k-regular tree Tk , we have T .Tk I v/ D Tk for all v in Tk . In the fol-
lowing simple example, we see how the entropy of the free-generating tree is
changing.
Example 12. Consider a rooted tree G D T2;4 defined as the star product graph for
ı ! T2 and ı ! T4 attaching to the root to each tree T2 and T4 :
e1 e2
v0
T2;4 W ı
. &
T2 T4
Then we have H0 .T .GI v1 // D log 2 and H0 .T .GI v2 // D log 4. In order to obtain

H0 .T .GI v0 //, let us see the number of n-paths T .GI v0 /Œn from the origin v0 .
Since
T .GI v0 /Œn D 2n1 C 4n1 ;
we have
log.2n1 C 4n1 / log.2n1 C 4n1 /

H0 .T .GI v0 // D lim sup D lim D log 4:
n!1 n n!1 n
Finally in this section, we give an interesting example for free-generating trees,

which shows clearly the property of the original graph.
Example 13. It is known that the following undirected graph G

ı ! ı ;
which is frequently used as an elementary automaton, is closely related to the
Fibonacci sequence
.a0 ; a1 ; a2 ; : : :/ D .1; 1; 2; 3; 5; 8; 13; 21; : : :/ (5.5)

p
1C 5
and the golden ratio 2
. In fact, its adjacency matrix is

0 1
A D A.G/ D
1 1
and its spectrum (in this case, eigenvalues) is

p
1˙ 5
2 .A/;
2
which shows r.G/ is the golden ratio. Also the transition

an an1 0 1 an1
DA D
anC1 an 1 1 an
gives the Fibonacci relation, cf. [19]:
anC1 D an C an1 :
126 J.I. Fujii
Then, the initial vector t.a0 ; a1 / D t.1; 1/ yields the above sequences (5.5).
Moreover, by the Jordan decomposition, we have
0 p n 1
1 5 p
1 2p 2p @ 2 0 1 C 5 2
n
A D p p n A p
4 5 1 5 1C 5 0 1C 5
2
51 2
which shows
0p !nC1 p !nC1 1
1 @ 1C 5 1 5 A:
an D p
5 2 2
But it is not easy to see that the above graph G gives (5.5). So we consider the free-
generating tree of T D T .GI v0 /. (To make it easy, we label and color vertices.)

GW ı ! :
v0 v1
Then (5.5) appears as each number an of the nth node vertices in T and the relation
between G and the Fibonacci sequence is visually clear.
v0 d 1
?
t 1
v1

t 9 d? 2

t
) d? ?
t 3

t ?
d ?
t
t ?
d 5
t ?
d t? t ?
d t ?
d t? 8
t ?
d ?
t t ?
d t ?
d ?
t t ?
d ?
t t ?
d 13
Thereby, we have
1
H0 .T .GI v0 // D lim sup log an
n!1 n
0 p !nC1 p !nC1 11=n
1=n
1
D lim sup log p @ 1C 5
1 5 A
n!1 5 2 2
p !.nC1/=n p
1C 5 1C 5
D lim log D log :
n!1 2 2
Thus we have the logarithm of the golden ratio. This gives us much information to
consider entropies for infinite directed graphs.
5.5 Two Entropies for Graphs
Based on the preceding section, we define two entropies of graphs. First, according
to the case of finite graphs, we defined an entropy h.G/ for a graph G.
Definition 1. For a nonnilpotent graph G, the spectral entropy h.G/ is defined by

h.G/ D log r.G/.
This entropy for finite graphs was observed again as the complexity in the sense
of Kolmogorov by Fujii, Nakamura, Seo, and Watatani [16]. (This is extended to the
complexity for positive operators in [8].)
loghA.G/n u; ui
h.G/ D lim
n!1 n
0 1
1
B :: C
where u D @ : A. Here, for each natural number n, the number
1
an .G/ D hA.G/n u; ui
is called the Schwarz constant for G and is equal to the number of n-paths in G.
To consider the distribution of spectral entropies for graphs, we give the following
example.
Example 14. For k = 2, n = 1, there exist finite graphs fGn .k/g with r.Gn .k// D
k 1=n . For example, for the cyclic permutation U.n/ with n vertices, i.e.,
0 1
0 0 0 1
B1 0
B 0C C
n1
X B :: :: C
A.U.n// D Rn D e.kC1/ mod n ˝ ek D B
B0 1 : :CC;
kD0 B: :: C
@ :: : 0A
0 0 1 0
let Gn .k/ be a graph including exactly k U.n/’s as subgraphs with only one common
vertex called the center, as in the following examples, see Fig. 5.2.
128 J.I. Fujii
b
G2 .2/ G3 .2/ b b G4 .2/
b
b @
Ib
6 AA
U
kD2 ?
b b @
R b
6 b @Ib
1 1 1
r D2 r D2 r D2
A
KA
2
?
3 4
b
b - b @
R b
nD2 nD3 nD4

b b b b
b b b b
KAU
A
A
KA
A
KA
kD3 b b - b - b @
Rb -I b - b
@
r D 32 6 b @Ib
1
b? A
KA
1 1
r D 33 rD3 4
b - b @
R b
G2 .3/ G3 .3/ G4 .3/
Fig. 5.2 Gn .k/
Then the number of m-paths in Gn .k/ is

0 1 0 1
n1 j k n1 j k
X mCj X mCj
C1 A
am .Gn .k// D k @ k n AD@ k n
;
j D0 j D0
where b c means Gauss’ symbol. Then complexity formula shows

0 11=m
n1
X j
mCj
k mCn1 1=m
k b n cC1
C1 A
r.Gn .k// D lim @ k n
D lim
m!1 m!1
j D0
mC1
D lim k mnnC1 D k 1=n
m!1
by replacing m with mn n C 1.
Considering the tensor products for the above examples, we have the distribution
for the spectral radii or entropies for graphs by Theorem 5.
Theorem 11. The entropies h.G/ for graphs G are densely distributed in the half-
line Œ0; 1/.
Examples 12–14 suggest another entropy for graphs as in [5]. Let an .v/ be the
number of n-paths in G started from the vertex v:
X
an .v/ D hA.G/n ev ; eu i:
u2V .G/
Definition 2. For a nonnilpotent graph G, the topological (or combinatorial) en-

tropy H.G/ of a graph G is defined by
log an .v/
H.G/ D sup lim :
v2V .G/ n!1 n
Then we showed in [5] that

Theorem 12. For all nonnilpotent graphs G, the topological entropy is estimated
by the spectral entropy h.G/:
h.G/ 5 H.G/ 5 2h.G/:
Moreover if G is a finite graph, then h.G/ D H.G/.

Proof. By Lemma 3, T .GI v/Œn may be assumed to be nonzero. Let p.vI n/ V
be the vertices that are the terminals of n-paths from v. For the adjacency operator
A of G, we have
ˇ ˇ2
ˇX ˇ X
2 ˇ n ˇ
T .GI v/Œn D ˇ hA ev ; ew iˇ 5 jhAn ev ; ew ij2
ˇ w ˇ
w2p.vIn/
X
5 kAn ev k2 kew k2 5 kAn k2 T .GI v/Œn:
w2p.vIn/
Thus, T .GI v/Œn1=n 5 kAn k2=n ! r.G/2 for all v, hence H.G/ 5 2h.G/.
To show h.G/ D log r.G/ 5 H.G/, put A D A.G/, B D A , and r D
r.G/ D r.A/ D r.B/. Theorem 3 shows there exist unit positive approximate
proper vectors fxn g of r for B such that kzn k 5 1=.nk n1 / where zn D .B r/xn .
Here we may assume that there is a vertex v with ı infn hev ; xn i > 0. Putting
˛n D ..An1 C rAn2 C C r n1 /ev ; zn /; we have
X X
T .G W v/Œn D hAn ev ; ew i D hev ; B n ew i
w2V w2V
= hev ; B xn i D hev ; r n xn i C hev ; .B n1 C rB n2 C C r n1 /zn i

n
D r n hev ; xn i C ˛n = ır n C ˛n :
Note that ˛n is bounded by the following inequalities:
0 5 ˛n 5 .kAn1 ev k C rkAn2 ev k C C r n1 kev k/kzn k

5 .k n1 C rk n2 C C r n1 /kzn k 5 nk n1 kzn k 5 1
since r 5 k. Thereby we have
1 1
H.G/ = lim sup log T .GI v/Œn = lim sup log.ır n C ˛n / D log r D h.G/:
n!1 n n!1 n
130 J.I. Fujii
Next we show the equality for the finite case. The above equation holds when
r.G/ < 1. So suppose G is a finite nonnilpotent graph. Then G has an infinite free-
generating tree and consequently G has a cycle. Considering (strongly) connected
components, we may assume that the adjacency matrix A.G/ is irreducible. Then
the Perron–Frobenius theorem shows that there exists the unit positive eigenvector
p for an eigenvalue r.G/. Let e be a vector whose entries are all 1. Then
T .GI v/Œn D hG n ev ; ei
where ev is the vector corresponding to the vertex v. It follows from the positivity of
p that there exists a positive number ˛ such that ˛p e is a positive vector. Then
r.G/n hp; ei D hG n p; ei 5 hG n e; ei 5 ˛hG n p; ei D ˛ r.G/n hp; ei
for all n. By he; ei D dim `2 .V / D ]V , we have
1
H.G/ D sup lim sup log T .GI v/Œn
v n!1 n
P
1 T .GI v/Œn 1 hG n e; ei
= lim sup log v D lim sup log
n!1 n he; ei n!1 n he; ei
1 r.G/n hp; ei
= lim log D log r.G/ D h.G/:
n!1 n he; ei
Conversely, we have
1
H.G/ 5 lim sup loghG n e; ei
n!1 n
1
5 lim sup log.˛ r.G/n hp; ei/ D log r.G/ D h.G/
n!1 n
so that h.G/ D H.G/ holds. t

u
The above theorems show the distribution for H.G/.
Corollary 3. The entropies H.G/ for nonnilpotent graphs G are densely dis-
tributed in the half-line Œ0; 1/.
We have that the estimation in Theorem 12 is best possible by the following

example.
Example 15. As in Fig. 5.3, let Tk;m be the directed tree such that in the nth nodes,
.km/wn
k vertices have k arrows and others have none, where wn is the number of
c
PP

) ? PP
q
P
c c c
@
? R
@ @
? R
@
c c c c c c
C C C C
?CW ?CW ?CW ?CW
ccc ccc ccc ccc
p pp pp
p p pp pp
p p pp pp
p p pp pp
p pp
p
?
Cantor set
Fig. 5.3 The tree T3;1 and the Cantor set
the nth node vertices and the root (i.e., 0th node) vertex has k arrows, or w1 D k.
(In particular, Tk D Tk;0 is the k-ary directed tree.) For a tree Tk;m , we have
wn D k.k m/n1
and Tk;m is squarable in the sense that A.Tk;m /2 is also an adjacency operator for
2
some graph, say Tk;m . In fact,
2 n
Tk;m D Tk.km/;m.km/ and in general Tk;m D Tk.km/n1 ;m.km/n1 :
So the topological entropy is
log k.k m/n1

H.Tk;m / D lim
n!1 n
log k C .n 1/ log.k m/
D lim D log.k m/:
n!1 n
On the other hand, by A.Tk;m / A.Tk;m / D kP for some projection P , we have

the norm p
kTk;m k D k
and hence the spectral entropy is
n
log kTk;m k
h.Tk;m / D log r.Tk;m / D lim
n!1 n
p
log .k m/n log.k m/
D lim D :
n!1 n 2
The above examples Tk;m are attractive ones which represent fractals called self-
similar sets (see, e.g., [4]). For example, T3;1 represents the Cantor set as in Fig. 5.3.
132 J.I. Fujii
Other examples for self-similar sets are in the following table.
Self-similar set k m J Scale Similarity dimension

Cantor dust 3 1 1 1/3 log 2= log 3
Sierpiński gasket 4 1 2 1/2 log 3= log 2
Menger sponge 27 7 3 1/3 log 20= log 3
Here J is the dimension of the space on which the figure in discourse lies. In these
fractals, the ratio is k 1=J and the number of self-similar maps is k m. Thus the
similarity dimension is d D J log.k m/= log k and the relation to the entropies is
J log.k m/ J h.Tk;m / JH.Tk;m /

d D D D :
log k log kTk;m k 2 log kTk;m k
5.6 Ziv’s Entropy and Coding
Finally, we apply our discussion to coding theory. If we put a letter on each arrow
in G, we may consider an infinite path in G as a message on G. Hereafter suppose
G is a finite directed graph, and consequently h.G/ D H.G/.
For a message x D .v0 ; v1 ; v2 ; : : :/ on a graph G, let xŒn be the n-path
.v0 ; v1 ; : : : ; vn / in x, say the first n-words in x. For a shift S on the message
S.: : : ; vi ; : : :/ D .: : : ; vi C1 ; : : :/, put
˚ ˇ
Xn D ] S j .x/Œn ˇ j D 1; 2; : : : ;
the number of n-words in x. Then a kind of complexity of x is defined; see [25].

Definition 3. For a message x on G, Ziv’s entropy h.x/ is defined by
log Xn
h.x/ D lim :
n!1 n
By the definition, we have
Theorem 13. For all messages x on a finite directed graph G, h.x/ 5 h.G/. If G
is irreducible, then there exists a message x such that h.x/ D h.G/.
Proof. Since Xn is not greater than the Schwarz constant an D an .G/, we have
h.x/ 5 h.G/.
Next suppose G is irreducible. For any integer m = 1, let x1m ; x2m ; : : : ; xamm
be all the distinct m-words on G. For two words xim D v1 v2 vm and xinC1 D
u1 u2 un , there exists a path .vm ; w1 ; : : : ; wk ; u1 / from vm to u1 in G since G is
irreducible. Let wm;n m n
i;j be w1 w2 wk if xi xi C1 is not the word on G, and otherwise
m m;n m
the empty word. Then xi wi;j xi C1 is the word on G. Thus we put a message x by
x D x11 w1;1 1 1 1;2 2 2;2 2

1;2 x2 xa1 wa1 ;1 x1 w1;2 x2 ;
and hence we have Xm D am .G/ for all m. Therefore h.x/ D h.G/. t

u
Remark 2. The above argument for entropy or complexity is in the nonstochastic

situation. Here we mention the relation between the entropy of graphs and that of
a probability matrix. By setting probabilities P on all arrows in G, we obtain a
transition matrix G.P/ of a Markov chain. Then it is known that
h.G/.D H.G// D max H.G.P//;

P
where H.G.P// is the entropy as a Markov source. In fact, for A.G/ D .aij / and
its Frobenius vector f D .ri /, the above maximum is attained at B D .bij / with
ri aij
bij D :
rj r.G/
Here we deal with block source encoding and decoding without noise, which
is used for data compression. The (finite state) block encoder (resp. decoder) with
length N means the map W x 7! y (resp. W y 7! x)O for a message x, the
encoded message y, and the replica (i.e., decoded message) xO such that the i th
O
block S iN .y/ŒN (resp. S iN .x/ŒN ) depends only on S iN .x/ŒN (resp. S iN .y/ŒN )
for all i . Then, Ziv showed the following lemma in [25].
x / 5 h.y/ 5 h.x/ for every encoder-

Lemma 4. (Ziv’s Data processing lemma) h.b
decoder pair.
Here we assume that the messages x and xO are written by an alphabet of M letters
and y by that of M 0 letters with M = M 0 . Considering the case that the encoded
message is on a finite directed graph, we can show the estimation by the entropy
of the graph, which is better than by log M 0 , and considered as a generalization of
Ziv’s result [25].
Theorem 14. (Bound for invertibility) Let F be a finite directed graph and suppose
that a message x is encoded to the message on F . If h.x/ > h.F /, then x 6D b
x.
Proof. To show the contraposition, suppose that there exists a block encoder ' and
a block decoder such that x D b x . Then Theorem 13 implies h.y/ 5 h.F /. It
follows from Ziv’s data processing lemma that h.b x / 5 h.y/ 5 h.F /. By x D b x,
we have h.x/ D h.b x /, so that h.x/ 5 h.F /. t
u
Finally in this section, we try to generalize Ziv’s block source coding theorem
in [25], which, however, included a somewhat ambiguous part. In [2], S. Arimotro
reformulated it to a mathematically accurate statement. Now we generalize Ziv–
Arimoto’s coding theorem by a finite graph. Recall that an irreducible finite graph
G is aperiodic if there is a positive integer m such that there exists an m-path from
v to u for all vertices v and u.
134 J.I. Fujii
Theorem 15. (Coding theorem of graph version) For an aperiodic finite directed
graph F , let x be the message on the alphabet of M letters and encoded messages
on F . If h.x/ < h.F / for all x, then there exists a pair of N -block encoder and
decoder with x D xO ..x//.
Proof. To estimate length for codewords, suppose that we can take N and its largest
divisor ` with `2 M ` 5 N . For all the distinct `-words x1` ; x2` ; ; xs` in the i th
block S iN .x/ŒN , we have s D X` 5 M ` . Since F is aperiodic, there exists a
set of m-paths from u and v for all vertices u and v of F . Taking an integer k with
bkm = M ` = bkm1 where bn is the Schwarz constant of F , we can translate the
words xi` over A into the codewords yikm on F . As in the proof of Theorem 13,
there exist m-words zm i with y1
km m km m
z1 y2 z2 yM km m
zs being also the words on
F , which is called the list of the casts and defines the first L letters in the codeword
S iN .y/ŒN . Then we have

km1
L D .k m C m/s D kX` 5 X` m C 1 C log M `
log bkm1

mC1 k m 1 log M
5N 2
C :
` log bkm1 `
Now parse S iN .x/ŒN as
S iN .x/ŒN D S iN .x/Œ`S iN C` .x/Œ` S i.N C1/` .x/Œ`:
There are at most N` vectors in the parsed S iN .x/ŒN . Then the remainder of the
i th block codeword S iN .y/ŒN is taken to be the list of the addresses: Each word
S iN Cj ` .x/Œ` is encoded into a word on F pointing to the place of the correspond-
ing `-word in the list part. Thus the length Q D q m of this codeword is large
enough if
bQ1 < X` 5 bQ ;
or equivalently
qm1
q <mC1C log X` :
log bqm1
For the addresses wqm

1 ; : : : ; wqm
P for
S iN .x/Œ`; S iN C` .x/Œ`; : : : ; S i.N C1/` .x/Œ`;
respectively, we can take m-words z0i such that wqm

1 z01 wqm
2 z02 wqm
P z0P is also a
N N
word on F of length . ` /q. If K D L C . ` /q turns out to be less than N , prolong
it by adding .N K/-words whose letters are all equal to the first letter in F (say
0). For K = N , summing up the list of the casts and the addresses, we have

N
K DLC q
`

mC1 k m 1 log M mC1 q m 1 log X`
5N C C C :
`2 log bkm1 ` ` log bqm1 `
Now we show that we can take N . Since

1 1
lim log X` D h.x/ < log r.F / D lim log bqm1
`!1 ` q!1 q m 1
N
and lim D 0, we can take N large enough to make K 5 N . t
u
`!1 `
Remark 3. If F D S C.M 0 / is the supercomplete graph with vertices M 0 , then we

can obtain the coding theorem by Ziv and Arimoto from Theorem 13.
Corollary 4. Let G be a finite directed graph with M arrows and F an aperiodic

finite directed graph with M 0 arrows. If h.G/ < h.F / and M = M 0 , then there
exists a pair of a block encoder and a decoder with length N such that x D
b
x ..x// for all messages x on G.
Proof. It follows from Theorem 13 that h.x/ 5 h.G/ < h.F / for all messages x
on G. Thereby Theorem 15 implies the required result. u
t
5.7 Notes
The adjacency operator for graphs was introduced by Mohar [20] for an undi-
rected case and then by Fujii et al. [12] for a general case. The latter is the starting
point of our study of infinite directed graphs from the viewpoint of operator theory
[5, 7, 9–11, 13–16, 19, 24]. In particular, Seo and the author investigated spectral
properties and various operations for graphs. Based on these studies, the author
introduced two entropies of infinite graphs and discussed the difference between
them [5]. On the other hand, considering S. Arimoto’s idea for Ziv’s coding theo-
rem in a Japanese text [2], Y. Seo and the author obtained a generalization of his
theorem in [11].
References
1. Accardi L, Staszewski R, Salacity R (2007) Decompositions of the free prod-

uct of graphs. Infix Dampens Anal Quantum Probed Relax Top 10:303–334.
http://arxiv.org/pdf/math/0609329.pdf
2. Arimoto S (1980) Probability, information and entropy (in Japanese). Morikita, Tokyo
3. Cvetković DM, Doob M, Sachs H (1980) Spectra of graphs. Academic, New York
136 J.I. Fujii
4. Edgar GA (1990) Measure, topology and fractal geometry. Springer, New York
5. Fujii JI (1993) Entropy of graphs. Math Japon 38:39–46
6. Fujii JI (1995) The Marcus-Khan theorem for Hilbert space operators. Math Japon 41:531–535
7. Fujii JI, Fujii M (1993) Theorems of Williams and Pasadena. Math Japon 38:35–37
8. Fujii JI, Fujii M (2002) Kolmogorov’s complexity for positive definite matrices. Lin Algebra
Appl 341:171–180
9. Fujii JI, Seo Y (1993) Graphs and numerical center of mass. Math Japon 38:351–359
10. Fujii JI, Seo Y (1995) Graphs and tensor products of operators. Math Japon 41:245–252
11. Fujii JI, Seo Y (1997) Entropy and coding for graphs. Int J Math Stat Sci 6(1):63–77
12. Fujii M, Sasaoka H, Watatani Y (1989) Adjacency operators of infinite directed graphs. Math
Japon 34:727–735
13. Fujii M, Sasaoka H, Watatani Y (1990) The numerical range of an infinite directed graph. Math
Japon 35:577–582
14. Fujii JI, Sasaoka H, Watatani Y (1991) The spectrum of an infinite directed graph. Math Japon
36:607–625
15. Fujii M, Nakamoto M, Seo Y (1996) Graphs and Gersgorin’s theorem. Math Japon 44:517–523
16. Fujii M, Nakamoto M, Seo Y, Watatani Y (1996) Graphs and Kolmogorov’s complexity. Math
Japon 44:113–117
17. Furuta T (2001) Invitation to linear operators. Taylor & Francis, New York
18. Halmos PR (1982) A Hilbert space problem book, 2nd edn. Springer, Berlin, New York
19. Matsumoto A, Seo Y (1996) Graphs and Fibonacci numbers. Math Japon 44:317–322
20. Mohar B (1982) The spectrum of an infinite graph. Lin Algebra Appl 48:245–256
21. Mohar B, Woess W (1989) A survey on spectra of infinite graphs. Bull Lond Math Soc 21:
209–234
22. Paulsen I (1986) Completely bounded maps and dilations (Pitman Res Notes Math 146).
Longman Scientific and Technical, Essex, and John Wiley and Sons, New York
23. Schaefer HH (1980) Topological vector spaces. Springer, Berlin, New York
24. Seo Y (1993) Graphs and nilpotent operators. Math Japon 38:1089–1093
25. Ziv J (1978) Coding theorems for individual sequences. IEEE Trans Inf Theory IT-24:405–412
Chapter 6
Application of Infinite Labeled Graphs
to Symbolic Dynamical Systems
Kengo Matsumoto
Abstract We apply a theory of infinite labeled graphs to studying presentations

and classifications of symbolic dynamical systems, by introducing a class of infinite
labeled graphs, called -graph systems. Its matrix presentation is called a symbolic
matrix system. The notions of a -graph system and symbolic matrix system are
generalized notions of a finite labeled graph and symbolic matrix for sofic sub-
shifts to general subshifts. Strong shift equivalence and shift equivalence between
symbolic matrix systems are formulated so that two subshifts are topologically
conjugate if and only if the associated canonical symbolic matrix systems are
strong shift equivalent. We construct several kinds of shift equivalence invariants
for symbolic matrix systems. They are the dimension groups, the K-groups, and
the Bowen–Franks groups that are generalizations of the corresponding notions for
nonnegative matrices. They yield topological conjugacy invariants of subshifts. The
entropic quantities called -entropy and volume entropy for -graph systems are
also studied related to the topological entropy of symbolic dynamics.
Keywords Subshifts Symbolic dynamics -Graph systems Strong shift

equivalence Bowen–Franks group K-theory Topological entropy
MSC2000: Primary 37B10; Secondary 28D20, 46L80
6.1 Introduction
Graph theory has intersections with other branches of mathematics. The theory of
symbolic dynamics is one of them. It has significant uses for coding theory and
formal language theory in information sciences. The class of symbolic dynami-
cal systems is a basic part of topological dynamical systems. Graph-theoretical
K. Matsumoto ()
Department of Mathematics, Joetsu University of Education, Joetsu 943-8512, Japan

138 K. Matsumoto
techniques and linear algebraic techniques are very useful to study symbolic
Z
Q1Let ˙ be a finite set, called an alphabet. Let ˙ be the infinite
dynamical systems.
product spaces i D1 ˙i where ˙i D ˙, endowed with the product topology.
The transformation on ˙ Z given by ..xi /i 2Z / D .xi C1 /i 2Z is called the (full)
shift. Let be a shift-invariant closed subset of ˙ Z i.e. ./ D . The topological
dynamical system .; j / is called a subshift. QWe denote j by and write the
subshift as for short. We denote by X . 1 i D1 ˙i / the set of all right-infinite
sequences that appear in .
Symbolic dynamical systems have several subclasses by viewing the underlying
graphs. The class of Markov shifts, which are often called SFT (shifts of finite type)
comes from finite directed graphs, and the class of sofic shifts, which are a general-
ization of Markov shifts, comes from finite directed labeled graphs. In the study of
Markov shifts and sofic shifts, graph-theoretical techniques are very useful. More
generally we apply a theory of infinite labeled graphs to studying general symbolic
dynamical systems, by introducing a class of infinite labeled graphs, called -graph
systems. Its matrix presentation is called a symbolic matrix system. The notions of
the -graph system and symbolic matrix system are generalized notions of a finite
labeled graph and symbolic matrix for sofic shifts to general subshifts. Strong shift
equivalence and shift equivalence between symbolic matrix systems are formulated
such that two subshifts are topologically conjugate if and only if the canonical sym-
bolic matrix systems are strong shift equivalent. We construct several kinds of shift
equivalence invariants for symbolic matrix systems. They are the dimension groups,
the Bowen–Franks groups, and the nonzero spectra that are generalizations of the
corresponding notions for nonnegative matrices. The K-groups for symbolic ma-
trix systems are introduced. They are also shift equivalence invariants and stronger
than the Bowen–Franks groups but weaker than the dimension triples. These kinds
of shift equivalence invariants naturally induce topological conjugacy invariants for
subshifts. In particular the K-groups and the Bowen–Franks groups induce not only
topological conjugacy invariants for subshifts, but also flow equivalence invariants.
As entropic quantities, the volume entropy and the -entropy for -graph systems
are introduced. They are shift equivalence invariants and hence induce topological
conjugacy invariants of subshifts. The -entropy measures a distance from sofic
shifts. The volume entropy does not necessarily coincide with classical topological
entropy unless the subshift is sofic.
A finite sequence D .1 ; :::; k / of elements j 2 ˙ is called a word. We
denote by jj the length k of . A word D .1 ; :::; k / is said to appear in
x D .xi /i 2Z 2 ˙ Z if xm D 1 ; :::; xmCk1 D k for some m 2 Z. For a subshift
, we denote by Bk ./ the set of all words of length k appearing in some x 2 ,
where B0 ./ denotes the empty word. We set B ./ D [1 B ./. A matrix
kD0 k
with entries in nonnegative integers is called a nonnegative matrix. Throughout the
chapter, ZC and N denote the set of all nonnegative integers, and the set of all posi-
tive integers, respectively. For an introduction to the theory of symbolic dynamical
systems, see [21, 33] (cf. [11, 27]).
The chapter is organized as follows. In Sects. 6.2–6.4, basic classes of subshifts
called topological Markov shifts that are defined by finite directed graphs, sofic
shifts that are defined by finite labeled graphs, and coded shifts that are defined
6 Application of Infinite Labeled Graphs to Symbolic Dynamical Systems 139
by codes, respectively, are briefly explained. In Sect. 6.5, -graph systems and
symbolic matrix systems are introduced as a presentation of subshifts. In Sect. 6.6,
strong shift equivalences and shift equivalences of symbolic matrix systems are
defined and studied. In Sect. 6.7, nonnegative matrix systems are introduced to de-
fine K-theoretic invariants of symbolic matrix systems. In Sect. 6.8, K-theoretic
invariants for symbolic matrix systems called dimension groups, K-groups, and
Bowen–Franks groups are introduced. They yield topological conjugacy invariants
of subshifts. In Sect. 6.9, spectrum, -entropy, and volume entropy for -graph sys-
tems and symbolic matrix systems are introduced. They are closely related to the
topological entropy of subshifts. In Sect. 6.10, the K-groups and the Bowen–Franks
groups for a class of nonsofic shifts is presented. In Sect. 6.11, a relation of the
K-theoretic invariants for -graph systems and symbolic matrix systems to K-theory
for C -algebras is remarked. Finally, in Sect. 6.12, conclusions and further works
are described.
6.2 Markov Shifts and Finite Directed Graphs
The classification of symbolic dynamical systems has been very important and one
of the central problems in the theory of topological dynamical systems. The clas-
sification problem was first examined for a class of symbolic dynamical systems
called topological Markov shifts. Each dynamical system of the class is determined
by a single square nonnegative matrix. Hence the behavior of such a dynamical sys-
tem depends on the underlying matrix. Let A be an n n nonnegative matrix. Put
VA D f1; : : : ; ng: the vertex set. Write A.i; j / edges from i 2 VA to j 2 VA . We
have a directed graph denoted by GA . Let ˙ be the set EA of all edges of GA . Let
sA and rA be the maps from EA to VA that assign the source vertex and the range
vertex of an edge respectively. Let A be the set of all bi-infinite sequences .ei /i 2Z
of ei 2 EA with rA .ei / D sA .ei C1 /; i 2 Z. Then A becomes a subshift, called the
topological Markov shift defined by nonnegative matrix A.
In [52], R. F. Williams introduced the notions of strong shift equivalence and
shift equivalence between nonnegative matrices and showed that two topological
Markov shifts are topologically conjugate if and only if the underlying matrices are
strong shift equivalent. Strong shift equivalence implies shift equivalence. Although
the converse implication had been a long-standing open problem, Kim and Roush
[20] have solved negatively for even irreducible matrices.
Two nonnegative matrices M and N are said to be strong shift equivalent in
1-step, written as M N; if there exist rectangular nonnegative matrices R and S
1
such that
M D RS; N D SR:
Definition 6.2.1 ([52]). Two matrices A and B are said to be strong shift equiv-
alent in l-step, written as A B; if there exist nonnegative square matrices
l
A1 ; A2 ; : : : ; Al1 such that
140 K. Matsumoto
A A1 A2 Al1 B:
1 1 1 1 1
We say A and B are strong shift equivalent if A B for some l, and write it as
l
A B:
Williams has proved the following fundamental theorem of Markov shifts.
Theorem 6.2.2 ([52]). Topological Markov shifts A and B are topologically

conjugate if and only if A and B are strong shift equivalent.
Definition 6.2.3 ([52]). Two matrices A and B are said to be shift equivalent of
lag l, written as A B; if there exist nonnegative rectangular matrices R and S
l
such that
Al D RS; B l D SR; SA D BS; RB D AR:
We say A and B are shift equivalent if A B for some l, and write it as A B:

l
Both strong shift equivalence and shift equivalence are equivalence relations, and
strong shift equivalence implies shift equivalence.
6.3 Sofic Shifts and Finite Labeled Graphs
We fix a finite set ˙ called an alphabet. We write the empty symbol ; in ˙ as 0. We

denote by S˙ the set of all finite formal sums of elements of ˙. A square matrix
with entries in S˙ is called a symbolic matrix over ˙. It is an equivalent object to
a labeled graph called a -graph [47]. There is a class of subshifts called sofic shifts
that are a generalized class of Markov shifts determined by symbolic matrices (see
[14, 25, 26, 51], etc.).
Let A.D ŒA.i; j /i;j D1;:::;n / be an n n symbolic matrix over ˙. We have a
directed graph GA from the matrix A with labeled edges by the symbols in ˙. We
denote by .e/ D ˛ 2 ˙ the label ˛ of edge e. Let A be the set of all bi-infinite
sequences ..ei //i 2Z of labels of edges ei 2 EA with rA .ei / D sA .ei C1 /; i 2 Z,
where rA .ei / and sA .ei C1 / denote the range vertex of ei and the source vertex of
ei C1 , respectively. Then A becomes a subshift, called the sofic shift defined by
symbolic matrix A.
M. Nasu in [47,48] generalized the notion of strong shift equivalence to symbolic
matrices. He showed that two sofic shifts are topologically conjugate if and only
if their canonical symbolic matrices are strong shift equivalent ([47, 48]; see also
[16]). M. Boyle and W. Krieger in [4] introduced the notion of shift equivalence
for symbolic matrices and studied topological conjugacy for sofic shifts. For two
symbolic matrices A over alphabet ˙ and A0 over alphabet ˙ 0 and a bijection
from a subset of ˙ onto a subset of ˙ 0 , A and A0 are said to be specified equivalent
under specification if A0 can be obtained from A by replacing every symbol a

appearing in A by .a/ [47, 48]. We write it as A ' A0 , or simply A ' A0 . We
call a specification from ˙ to ˙ 0 . Two symbolic matrices M and M are said
are strong shift equivalent in 1-step, written as M M; if there exist rectangular
1
symbolic matrices R and S such that
M ' RS; M ' SR:
Definition 6.3.1 ([47]). Two symbolic matrices A and B are said to be strong
shift equivalent in l-step, written as A B; if there exist symbolic matrices
l
A1 ; A2 ; : : : ; Al1 such that
A A1 A2 Al1 B:
1 1 1 1 1
We say A and B are strong shift equivalent if A B for some l, and write it as
l
A B:
For a sofic shift and x D .xn /n2N 2 X , we put
P .x/ D f.1 ; : : : ; k / 2 B ./ j .1 ; : : : ; k ; x1 ; x2 ; : : : / 2 X g:
Two x D .xn /n2N ; y D .yn /n2N 2 X are said to be past equivalent if P .x/ D P .y/.
Let V be the equivalence classes of X under the past equivalence. As is sofic,
the set V is a finite set. We write an edge labeled ˛ from Œx to Œy if Œy D Œ˛x,
where ˛x D .˛; x1 ; x2 ; : : : /. We have a finite labeled graph G with vertex set V .
The labeled graph is called the left Krieger cover graph for the sofic shift [25,26].
Let us denote by A its symbolic matrix. We call the matrix A the canonical
symbolic matrix for the sofic shift :
Nasu has proved the following fundamental theorem of sofic shifts.
Theorem 6.3.2 ([47]). Sofic shifts and 0 are topologically conjugate if and only
0
if their canonical symbolic matrices A and A are strong shift equivalent.
Definition 6.3.3 ([4]). Two symbolic matrices A and B are said to be shift equiv-
alent of lag l, written as A B; if there exist symbolic rectangular matrices
l
R and S such that
Al ' RS; B l ' SR; SA ' BS RB ' AR:
We say A and B are shift equivalent if A B for some l, and write it as A B:

l
Both strong shift equivalence and shift equivalence are equivalence relations, and
strong shift equivalence implies shift equivalence.
142 K. Matsumoto
6.4 Coded Shifts
Denote by ˙ the set of all words of an alphabet ˙. A (finite or infinite) collec-

tion C. ˙ / of words over ˙ is said to be uniquely decipherable if whenever
˛1 ˛2 ˛n D 1 2 m with ˛i ; j 2 C, then n D m and ˛i D i for i D 1; : : : ; n.
A uniquely decipherable set C is called a code. Blanchard and Hansel [2] have in-
troduced the notion of coded shift. A subshift is called a coded shift if is the
closure of the set of bi-infinite sequences obtained by freely concatenating the words
in a code C. It is denoted by C .
Proposition 6.4.1 ([2]). For a subshift over ˙, the following four conditions are
equivalent:
1. is a coded shift.
2. is presented by an irreducible countable labeled graph.
3. is the closure of the set of sequences obtained by freely concatenating the
words in a subset of ˙ .
4. contains an increasing sequence of irreducible Markov shifts whose unions
are dense in .
Irreducible sofic shifts are coded shifts, and any coded shift is irreducible.
The following are examples of coded shifts.
1. Synchronizing counter shift (cf. [9, 17, 28]). Let ˙ D fa; b; cg. Put C D
n
‚…„ƒ ‚…„ƒ n
fa b b c c j n D 0; 1; : : : g: It is easy to see that C is a code, and the coded shift
C is not sofic. Its language is accepted by a synchronizing counter automaton. It is
named the context-free shift in [33, Example 1.2.9].
2. Dyck shifts ([22]). For 2 N 2 N, let ˙ D f.1 ; : : : ; .N ; /N ; : : : ; /1 g be the
N -kinds of brackets. Define a semi-group structure in ˙ by setting
(
1 if i D j;
.i / j D
0 otherwise.
Let CN be the set of all words in ˙ whose products are reduced to 1. It is easy to
see that CN is a code, and the resulting coded shift CN is not sofic. The coded shift
is called the Dyck shift of order N and written as DN . Its language is accepted by a
push-down automaton and forms a context-free language (cf. [9, 17]).
6.5 -Graph Systems and Symbolic Matrix Systems
A symbolic matrix corresponds to a labeled graph, called a -graph, that is a pre-

sentation of a sofic shift. We consider a generalization of -graphs to present any
subshift. Details of this section are seen in [36].
We first explain the notion of the Bratteli diagram that appears in the theory of
operator algebras (see [5, 12]). A Bratteli diagram consists of a vertex set V D
V1 [ V2 [ and an edge set E D E1;2 [ E2;3 [ where each Vl and El;lC1
are finite and nonempty. We have maps s; r W E ! V such that s.El;lC1 / D Vl ,
r.El;lC1 / D VlC1 . They are called a source map and a range map, respectively. For
u 2 Vl ; v 2 VlC1 ; put
El;lC1 .u; v/ D fe 2 El;lC1 js.e/ D u; r.e/ D vg:
A labeled Bratteli diagram .V; E; / over alphabet ˙ consists of a Bratteli diagram

.V; E/ with a map from E to ˙.
Definition 6.5.1. A -graph system .V; E; ; / over alphabet ˙ consists of a la-

beled Bratteli diagram .V; E; / over ˙ and a surjective map from V n V1 to V
satisfying the following two conditions:
1. .VlC1 / D Vl for l 2 N.
2. For u 2 Vl ; w 2 VlC2 ; there exists a bijective correspondence between
[
El;lC1 .u; .w// and ElC1;lC2 .v; w/
v2VlC1 ;.v/Du
that is compatible with the labeling .

By the above condition 1, the cardinality of the set VlC1 is greater than or equal to
that of the set Vl . The above condition 2 is called the local property of the -graph
system. It yields the following two conditions:
1. For e 2 ElC1;lC2 , there exists e 0 2 El;lC1 such that
.s.e// D s.e 0 /; .r.e// D r.e 0 / and .e/ D .e 0 /:
2. For f 2 El;lC1 , v 2 VlC2 with .v/ D r.f /, there exists e 2 ElC1;lC2 such that
.s.e// D s.f /; r.e/ D v and .e/ D .f /:
Two -graph systems .V; E; ; / over ˙ and .V 0 ; E 0 ; 0 ; 0 / over ˙ 0 are said to

be isomorphic if there exist bijections ˆV W V ! V 0 , Ê W E ! E 0 , and a
specification W ˙ ! ˙ 0 such that
1. ˆV .Vl / D Vl0 and Ê .El;lC1 / D El;lC1
0
for l 2 N;
2. ˆV .s.e// D s.Ê .e// and ˆV .r.e// D r.Ê .e// for e 2 E;
3. 0 .ˆV .v// D ˆV . .v// for v 2 V;
4. 0 .Ê .e// D ..e// for e 2 E.
We construct subshifts from -graph systems. Let L D .V; E; ; / be a -graph

system over ˙. For k < l; set
144 K. Matsumoto
Pk;l D f.ek ; ekC1 ; : : : ; el1 /jei 2 Ei;i C1; r.ei / D s.ei C1 / for i D k; kC1; : : : ; l 2g
the set of all paths from Vk to Vl , and
lk times
‚ …„ ƒ
Lk;l D f.ek /.ekC1 / .el1 / 2 ˙ ˙ j .ek ; ekC1 ; : : : ; el1 / 2 Pk;l g
the set of all labeled paths from Vk to Vl . Put Ll D L1;lC1 and endow it with
discrete topology. We set
XL D f..e1 /; .e2 /; : : : / 2 ˙ N jei 2 Ei;i C1 ; r.ei / D s.ei C1 / for i 2 Ng
the set of all right infinite sequences consisting of labels along infinite paths. The
topology on XL is defined from open sets of the form
U.1 ;:::;k / D f.˛1 ; ˛2 ; : : : / 2 XL j˛i D i for i D 1; : : : ; kg
for .1 ; : : : ; k / 2 Lk : By the local property of the -graph system, one sees:
1. if .˛1 ; ˛2 ; : : : / 2 XL ; we have .˛2 ; ˛3 ; : : : / 2 XL ,
2. if .˛k ; : : : ; ˛l1 / 2 Lk;l for l > k, we have .˛k ; : : : ; ˛l1 / 2 LkC1;lC1 :
As in [33, Definition 1.3.1], a set L of words of ˙ is called a language if it satisfies
the following conditions:
(a) Every subword of a word w in L belongs to L.
(b) For a word w in L, there are nonempty words u; v in L such that uwv be-
longs to L.
Let L.L/ be the set of all words appearing in XL . That is, L.L/ D [kl Lk;l : Then
Proposition 6.5.2. L.L/ is a language.
By [33, Proposition 1.3.4], we see
Theorem 6.5.3. There exists a subshift over alphabet ˙ whose language is
L.L/. Namely the set B ./ of all admissible words of the subshift is L.L/:
The subshift is realized as
D f.: : : ; ˛2 ; ˛1 ; ˛0 ; ˛1 ; ˛2 ; : : : /j.˛n ; ˛nC1 ; : : : / 2 XL for all n 2 Zg:
We denote by L the subshift in the above theorem and call it the subshift pre-
sented by the -graph system L.
We next construct -graph systems from subshifts. For a subshift over ˙,
denote by X its right one-sided subshift. Set
l .x/ D f 2 Bl ./jx 2 X g for x 2 X ; l 2 N:

We define a nested sequence of equivalence relations in the space X . Two points

x; y 2 X are said to be l-past equivalent, written as x l y, if l .x/ D l .y/.
Denote by ˝l D X = l the quotient space. For x; y 2 X and 2 Bk ./, one
sees that
1. if x l y, we have x m y for m < l,
2. if x l y and x 2 X , we have y 2 X and x lk y for l > k.
We have the following sequence of surjections in a natural way:
˝1 ˝2 ˝l ˝lC1 :
The subshift is a sofic shift if and only if ˝l D ˝lC1 for some l 2 N. For a
fixed l 2 N, let Fil ; i D 1; 2; : : : ; m.l/ be the set of all l-past equivalence classes
of X . Hence X is a disjoint union of Fil ; i D 1; 2; : : : ; m.l/. The vertex set Vl at
level l consist of the sets Fil ; i D 1; : : : ; m.l/. We write an edge with label a from
the vertex Fil 2 Vl to FjlC1 2 VlC1 if ax 2 Fil for some x 2 FjlC1 . We denote
by El;lC1 the set of all edges from Vl to VlC1 . There exists a natural map l from
VlC1 to Vl by mapping FjlC1 to Fil when Fil contains FjlC1 . Set V D [1 lD1 Vl and
1
E D [lD1 El;lC1 . The labeling of edges is denoted by W E ! ˙. We then see

Theorem 6.5.4. For a subshift , .V ; E ; ; / becomes a -graph system

which we denote by L . Moreover the subshift L presented by L coincides
with the original subshift .
We call L the canonical -graph system for . For a -graph system L, let L
be the presented subshift by L. Then its canonical -graph system LL does not
necessarily coincide with the original -graph system L. We indeed see that the
canonical -graph system L for a subshift is left-resolving; i.e., the incoming
edges to each vertex carry different labels, and is predecessor-separated; i.e., distinct
vertices at each level have distinct predecessor sets of labels. If in particular, is
a sofic shift, its canonical -graph system is eventually realized as the left Krieger
cover graph for .
Let us consider matrix presentation of -graph systems.
Definition 6.5.5. Let .Ml;lC1 ; Il;lC1 /; l 2 N be a pair of sequences of rectangular
matrices such that the following conditions for each l 2 N are satisfied:
1. Ml;lC1 is an m.l/ m.l C 1/ rectangular matrix with entries in S˙ .
2. Il;lC1 is an m.l/ m.l C 1/ rectangular matrix with entries in f0; 1g satisfying
the relation:
Il;lC1 MlC1;lC2 D Ml;lC1 IlC1;lC2 ; l 2 N: (6.1)
We further assume that both the matrices Ml;lC1 and Il;lC1 have no zero columns
and no zero rows. For j , there uniquely exists i such that Il;lC1 .i; j / ¤ 0. By the
above conditions one sees m.l/ m.l C 1/: The pair .M; I / is called a symbolic
matrix system over ˙.
146 K. Matsumoto
Two symbolic matrix systems .M; I / over ˙ and .M0 ; I 0 / over ˙ 0 are said to
be isomorphic if m.l/ D m0 .l/ for l 2 N and there exist a specification from ˙
to ˙ 0 and an m.l/ m.l/ permutation matrix Pl for each l 2 N such that

Pl Ml;lC1 ' M0l;lC1 PlC1 ; 0
Pl Il;lC1 D Il;lC1 PlC1 for l 2 N:
The notion of a symbolic matrix system is a generalized notion of a symbolic matrix.

For an n n symbolic matrix A, we set
Ml;lC1 D A; Il;lC1 D En for l 2N
where En denotes the identity matrix of size n. Then .Ml;lC1 ; Il;lC1 /; l 2 N is

a symbolic matrix system. The following proposition shows that symbolic matrix
systems are nothing but the matrix presentation of -graph systems.
Proposition 6.5.6. There exists a bijective correspondence between the set of all
isomorphism classes of symbolic matrix systems and the set of all isomorphism
classes of -graph systems.
We say a symbolic matrix system is canonical for a subshift if its corresponding
-graph system is canonical. It is denoted by .M ; I /.
a b 1 0
For example, set for each l 2 N, Ml;lC1 D and Il;lC1 D : The
b 0 0 1
-graph system for the symbolic matrix system gives rise to the even shift, denoted
by Y . Its canonical symbolic matrix system is given by the following matrices:

a aCb b 1 1 0
MY1;2 D ; Y
I1;2 D
b 0 0 0 0 1
and
2 3 2 3
a a b 1 0 0
MYl;lC1 D 40 b 05 ; Y
Il;lC1 D 40 1 05 for l 2:
b 0 0 0 0 1
6.6 Strong Shift Equivalences and Shift Equivalences
In this section, we define two kinds of strong shift equivalences between symbolic
matrix systems. One is called the properly strong shift equivalence that exactly re-
flects a bipartite decomposition of the associated -graph systems. The other one
is called the strong shift equivalence that is weaker than the former strong shift
equivalence. They coincide at least among symbolic matrix systems whose -graph
systems are predecessor-separated and left-resolving, and hence between canonical
symbolic matrix systems for subshifts. The latter is more easily defined and treated
than the former. The main purpose in this section is to see that topological conjugacy
between two subshifts is completely characterized by strong shift equivalence be-
tween their canonical symbolic matrix systems. We first define properly strong shift
equivalence between two symbolic matrix systems as a generalization of strong shift
equivalence between two nonnegative matrices defined by Williams in [52] and be-
tween two symbolic matrices defined by Nasu in [47]. For the details of this section
see [36]. P
For alphabets
P C; D, put C D D P fcd jc 2 C; d 2 Dg: For x D j cj 2 SC
and y D k dk 2 SD , define xy D j;k cj dk 2 SC D .
Let .M; I / and .M0 ; I 0 / be symbolic matrix systems over ˙ and ˙ 0 ,
respectively, where Ml;lC1 ; Il;lC1 are m.l/ m.l C1/ matrices and M0l;lC1 ; Il;lC1
0
0 0
are m .l/ m .l C 1/ matrices.
Definition 6.6.1. Two symbolic matrix systems .M; I / and .M0 ; I 0 / are said to be
properly strong shift equivalent in 1-step, written as .M; I / .M0 ; I 0 /; if there
1pr
exist alphabets C; D and specifications
' W ˙ ! C D; W ˙0 ! D C
and increasing sequences n.l/; n0 .l/ on l 2 N such that for each l 2 N, there exist
an n.l/ n0 .l C 1/ matrix Pl over C; an n0 .l/ n.l C 1/ matrix Ql over D; an
n.l/ n.l C 1/ matrix Xl over f0; 1g, and an n0 .l/ n0 .l C 1/ matrix Xl0 over f0; 1g
satisfying the following equations:
'
Ml;lC1 ' P2l Q2lC1 ; M0 l;lC1 ' Q2l P2lC1 ; (6.2)
0 0 0
Il;lC1 D X2l X2lC1 ; Il;lC1 D X2l X2lC1 (6.3)
and
Xl PlC1 D Pl X 0 lC1 ; Xl0 QlC1 D Ql XlC1 : (6.4)
It follows by (6.1) that n.2l/ D m.l/ and n0 .2l/ D m0 .l/ for l 2 N.
Two symbolic matrix systems .M; I / and .M0 ; I 0 / are said to be properly strong
shift equivalent in N-step, written as .M; I / .M0 ; I 0 /; if there exists a
N pr
sequence of symbolic matrix systems .M.i / ; I .i / /; i D 1; 2; : : : ; N 1 such that
.M; I / .M.1/ ; I .1/ / .M.N 1/ ; I .N 1/ / .M0 ; I 0 /:

1pr 1pr 1pr 1pr
We simply call it a properly strong shift equivalence.
Lemma 6.6.2. Properly strong shift equivalence is an equivalence relation on

symbolic matrix systems.
148 K. Matsumoto
Proof. It suffices to show that .M; I / .M; I /: Put C D ˙; D D f0; 1g:

1pr
Define ' W a 2 ˙ ! a 1 2 C D and W a 2 ˙ ! 1 a 2 D C: Let Ek be the
k k identity matrix. Set
P2l D P2lC1 D Ml;lC1 ; Q2l D Em.l/ ; Q2lC1 D Em.lC1/ ;

0 0
X2l D Em.l/ ; X2lC1 DIl;lC1 ; X2l D Il;lC1 ; X2lC1 D Em.lC1/ :
They give a properly strong shift equivalence in 1-step between .M; I / and .M; I /.
u
t
We now introduce the notion of a bipartite symbolic matrix system and a bipartite
-graph system.
Definition 6.6.3. A symbolic matrix system .M; I / over ˙ is said to be bipartite if

there exist disjoint subsets C; D ˙ and increasing sequences n.l/; n0 .l/ on l 2 N
with m.l/ D n.l/ C n0 .l/ such that for each l 2 N, there exist an n.l/ n0 .l C 1/
matrix Pl;lC1 over C; an n0 .l/ n.l C 1/ matrix Ql;lC1 over D; an n.l/ n.l C 1/
matrix Xl;lC1 over f0; 1g and an n0 .l/n0 .l C1/ matrix Xl;lC1
0
over f0; 1g satisfying
the equations
" #
0 Pl;lC1 Xl;lC1 0
Ml;lC1 D ; Il;lC1 D 0 :
Ql;lC1 0 0 Xl;lC1
Since the relations Il;lC1 MlC1;lC2 D Ml;lC1 IlC1;lC2 and hence

0 0
Xl1;l Pl;lC1 D Pl1;l Xl;lC1 ; Xl1;l Ql;lC1 D Ql1;l Xl;lC1 :
hold, the following lemma is straightforward.
Lemma 6.6.4. For a bipartite symbolic matrix system .M; I / as above, set
Pl D Pl;lC1 ; Ql D Ql;lC1 ; Xl D Xl;lC1 ; X 0 l D X 0 l;lC1
and
l;lC1 D P2l Q2lC1 ;
MCD MDC
l;lC1 D Q2l P2lC1 ;
CD DC 0 0
Il;lC1 D X2l X2lC1 ; Il;lC1 D X2l X2lC1 :
Then both pairs .MCD ; I CD / and .MDC ; I DC / are symbolic matrix systems over
C D and D C , respectively, and they are properly strong shift equivalent in 1-step.
Definition 6.6.5. A -graph system .V; E; ; / over ˙ is said to be bipartite if

there exist disjoint subsets C; D ˙ such that ˙ D C [ D and disjoint subsets
VlC ; VlD Vl for each l 2 N such that VlC [ VlD D Vl and
1. for each e 2 El;lC1
s.e/ 2VlD ; r.e/ 2 VlC1

C
if and only if .e/ 2 C;
s.e/ 2VlC ; r.e/ 2 D
VlC1 if and only if .e/ 2 D;
D
2. .VlC1 / D VlD ; C
.VlC1 / D VlC :
Lemma 6.6.6. A symbolic matrix system is bipartite if and only if its corresponding
-graph system is bipartite.
Nasu introduced the notion of bipartite subshift in [47, 48]. A subshift over
alphabet ˙ is said to be bipartite if there exist disjoint subsets C; D ˙ such that
any .xi /i 2Z 2 is either
xi 2 C and xi C1 2 D for all i 2 Z or xi 2 D and xi C1 2 C for all i 2 Z:
Let .2/ be the 2-higher power shift for . Put
CD D f.ci di /i 2Z 2 .2/ jci 2 C; di 2 Dg;

DC D f.di ci /i 2Z 2 .2/ jci 2 C; di 2 Dg:
They are subshifts over alphabets C D and D C , respectively. Hence .2/ is

partitioned into the two subshifts CD and DC .
Lemma 6.6.7. A subshift is bipartite if and only if its canonical symbolic matrix
system .M ; I / is bipartite.
Proof. It is clear that a bipartite canonical symbolic matrix system gives rise to a
bipartite subshift from the preceding lemma. Suppose that is bipartite with respect
to alphabets C; D. Denote by .V ; E ; ; / the canonical -graph system L
for . As in the construction of the canonical -graph system, the vertex set Vl is
the set of all l-past equivalence classes fFil gi D1;:::;m.l/ . Put
VlC D fFil jx1 2 D for all .x1 ; x2 ; : : : / 2 Fil g;

VlD D fFil jx1 2 C for all .x1 ; x2 ; : : : / 2 Fil g
so that we have a disjoint union VlC [ VlD D Vl to yield a bipartite decomposition
of L . t
u
Let be a bipartite subshift over ˙ with respect to alphabets C; D: We have two

symbolic matrix systems .MCD ; I CD / and .MDC ; I DC / over C D and D C
from the bipartite canonical symbolic matrix system .M ; I / for , respectively.
They are naturally identified with the canonical symbolic matrix systems for the
subshifts CD and DC , respectively.
150 K. Matsumoto
Corollary 6.6.8. For a bipartite subshift with respect to alphabets C; D, we have
.MCD ; I CD / .MDC ; I DC /
1pr
a properly strong shift equivalence in 1-step.
The following notion of bipartite conjugacy has been introduced by Nasu in

[47, 48]. The conjugacy from CD onto DC that maps .ci di /i 2Z to .di ci C1 /i 2Z
is called the forward bipartite conjugacy. The conjugacy from CD onto DC that
maps .ci di /i 2Z to .di 1 ci /i 2Z is called the backward bipartite conjugacy. A topo-
logical conjugacy between subshifts is called a symbolic conjugacy if it is a 1-block
map given by a bijection between the underlying alphabets of the subshifts. Nasu
proved the following factorization theorem.
Lemma 6.6.9 ([47]). Any topological conjugacy between subshifts is factorized

into a composition of the form
D
n n
n1 n1
1 1
0
where
0 ; : : : ;
n are symbolic conjugacies and 1 ; : : : ; n are either forward or
backward bipartite conjugacies.
Thanks to the above Nasu’s result, we reach the following theorem.

Theorem 6.6.10. For two subshifts and 0 , let .M; I /, and .M0 ; I 0 / be their
canonical symbolic matrix systems for and 0 , respectively. If and 0 are topo-
logically conjugate, the symbolic matrix systems .M; I / and .M0 ; I 0 / are properly
strong shift equivalent.
Conversely, assume that two symbolic matrix systems .M; I / over ˙ and .M0 ; I 0 /
over ˙ 0 are properly strong shift equivalent in 1-step. Let L and L0 be their associ-
ated -graph systems for .M; I / and .M0 ; I 0 /, respectively.
Lemma 6.6.11. Let ' W ˙ ! C D and W ˙ 0 ! D C be specifications that
give a properly strong shift equivalence in 1-step between .M; I / and .M0 ; I 0 /. For
a word x1 x2 2 B2 .L / of the presented subshift L , put '.xi / D ci di ; i D 1; 2
where ci 2 C; di 2 D. Then there uniquely exists y0 2 ˙ 0 such that .y0 / D d1 c2 .
Theorem 6.6.12. If two symbolic matrix systems are properly strong shift equiva-
lent, their presented subshifts are topologically conjugate.
Proof. Suppose .M; I / .M0 ; I 0 /: We use the same notation as in the def-
1pr
inition of properly strong shift equivalence. Set D L and 0 D L0 : By
the preceding lemma, we have a 2-block map ˆ from B2 ./ to ˙ 0 defined by
ˆ.x1 x2 / D y0 where .y0 / D d1 c2 and '.xi / D ci di ; i D 1; 2. Let ˆ1 be
the sliding block code induced by ˆ so that ˆ1 is a map from to ˙ 0 Z . We also
write as ˆ the map from to the set of all words of ˙ 0 defined by
ˆ.x1 x2 xn / D ˆ.x1 x2 /ˆ.x2 x3 / ˆ.xn1 xn /:
To prove ˆ1 ./ 0 , it suffices to show that for any word w in , ˆ.w/ is an

admissible word in 0 . For w D w1 w2 wn 2 Bn ./ and any fixed l n C
1, we find j D 1; 2; : : : ; m.l C n/ and k D 1; 2; : : : ; m.l/ such that w appears
in Ml;lCn .k; j /, where Ml;lCn D Ml;lC1 MlCn1;lCn . Take i D 1; 2; : : : ;
m.l n/ with Iln;l .i; k/ D 1, where Iln;l D Iln;lnC1 Il1;l . Hence w
appears in Iln;l Ml;lCn .i; j /. Put '.wi / D ci di ; i D 1; 2; : : : ; n. By the equality
'
Il1;l Ml;lCn ' X2l2 P2l1 Q2l P2lC1 Q2lC2 P2lC2n3 Q2lC2n2 X2lC2n1 ;
the word d1 c2 d2 c3 dn1 cn appears in a component of Q2l P2lC1 Q2lC2

P2lC2n3 : Hence the word 1 .d1 c2 / 1 .d2 c3 / 1 .dn1 cn / appears in a
component of M0l;lC1 M0lC1;lC2 M0lCn2;lCn1 : Thus ˆ.w/ is an admissible
word in 0 so that the sliding block code ˆ1 maps to 0 . Similarly,
we can construct a sliding block code ‰1 from 0 to that is an inverse
of ˆ1 . t
u
Properly strong shift equivalence exactly corresponds to a finite sequence of bi-

partite decompositions of symbolic matrix systems and -graph systems. The def-
inition of properly strong shift equivalence for symbolic matrix systems, however,
needs rather more complicated formulations than that of strong shift equivalence
for nonnegative matrices. We next introduce the notion of strong shift equivalence
between two symbolic matrix systems that is a simpler and weaker condition than
properly strong shift equivalence. Let .M; I / and .M0 ; I 0 / be two symbolic matrix
systems over alphabet ˙ and ˙ 0 , respectively. Let m.l/ and m0 .l/ be the sequences
for which Ml;lC1 ; Il;lC1 are m.l/ m.l C 1/ matrices and M0l;lC1 ; Il;lC1 0
are
0 0
m .l/ m .l C 1/ matrices, respectively.
Definition 6.6.13. Two symbolic matrix systems .M; I / and .M0 ; I 0 / are said to
be strong shift equivalent in 1-step, written as .M; I / .M0 ; I 0 /; if there exist
1st
alphabets C; D and specifications
' W ˙ ! C D; W ˙0 ! D C
such that for each 1 < l 2 N, there exist an m.l 1/ m0 .l/ matrix Hl over C and
an m0 .l 1/ m.l/ matrix Kl over D satisfying the following equations:
' 0
Il1;l Ml;lC1 ' Hl KlC1 ; Il1;l M0l;lC1 ' Kl HlC1
and
0 0
Hl Il;lC1 D Il1;l HlC1 ; Kl Il;lC1 D Il1;l KlC1 :
152 K. Matsumoto
Two symbolic matrix systems .M; I / and .M0 ; I 0 / are said to be strong shift equiv-
alent in N-step, written as .M; I / .M0 ; I 0 /; if there exist symbolic matrix
N st
systems .M.i / ; I .i / /; i D 1; 2; : : : ; N 1 such that
.M; I / .M.1/ ; I .1/ / .M.N 1/ ; I .N 1/ / .M0 ; I 0 /:

1st 1st 1st 1st
We simply call it a strong shift equivalence. Similarly to the case of properly strong
shift equivalence, we see that strong shift equivalence on symbolic matrix systems
is an equivalence relation.
Proposition 6.6.14. Properly strong shift equivalence in 1-step implies strong shift
equivalence in 1-step.
Proof. Let Pl ; Ql ; Xl , and Xl0 be the matrices in the definition of properly strong
shift equivalence in 1-step between .M; I / and .M0 ; I 0 /: We set
0
Hl D X2l1 P2l1 ; Kl D X2l1 Q2l1 :
They give rise to a strong shift equivalence in 1-step between .M; I / and .M0 ; I 0 /.
t
u
Conversely we have
Proposition 6.6.15 ([41]). Let .M; I / and .M0 ; I 0 / be the symbolic matrix sys-
tems for -graph systems L and L0 , respectively. Suppose that both L and L0 are
left-resolving and predecessor-separated. The following conditions are equivalent:
1. .M; I / and .M0 ; I 0 / are strong shift equivalent in l-step.
2. .M; I / and .M0 ; I 0 / are properly strong shift equivalent in l-step.
Hence the two notions, strong shift equivalence and properly strong shift equiva-
lence, coincide with each other in the canonical symbolic matrix systems.
By a similar argument to the proof of Theorem 6.6.12, we obtain
Theorem 6.6.16. If two symbolic matrix systems (not necessarily canonical) are
strong shift equivalent, their presented subshifts are topologically conjugate.
We next introduce the notion of shift equivalence between two symbolic matrix
systems as a generalization of Williams’s notion for nonnegative matrices [52] and
Boyle–Krieger’s notion for symbolic matrices [4]. Let .M; I / and .M0 ; I 0 / be two
symbolic matrix systems over alphabets ˙ and ˙ 0 , respectively. For N 2 N, we put
.˙/N D ˙ ˙ and .˙ 0 /N D ˙ 0 ˙ 0 W the N -times products.
Definition 6.6.17. For N 2 N, two symbolic matrix systems .M; I / and .M0 ; I 0 /
are said to be shift equivalent of lag N if there exist alphabets CN ; DN and specifi-
cations
'1 W ˙ CN ! CN ˙ 0 ; '2 W ˙ 0 DN ! DN ˙
and
1 W .˙/N ! CN DN ; 2 W .˙ 0 /N ! DN CN
such that for each l 2 N, there exist an m.l/ m0 .l C N / matrix Hl over CN and
an m0 .l/ m.l C N / matrix Kl over DN satisfying the following equations:
'1 '2
Ml;lC1 HlC1 ' Hl M0lCN;lCN C1 ; M0l;lC1 KlC1 ' Kl MlCN;lCN C1 ;
1 0 2
Il;lCN MlCN;lC2N ' Hl KlCN ; Il;lCN M0lCN;lC2N ' Kl HlCN
and
0 0
Il;lC1 HlC1 D Hl IlCN;lCN C1 ; Il;lC1 KlC1 D Kl IlCN;lCN C1 :
We denote this situation by
.M; I / .M0 ; I 0 / or .H; K/ W .M; I / .M0 ; I 0 /

lagN lagN
and simply call it a shift equivalence.

Similarly to the case of nonnegative matrices and symbolic matrices, we see that
1. .M; I / .M0 ; I 0 / implies .M; I / .M0 ; I 0 / for all L N .
lagN lagL
2. .M; I / .M0 ; I 0 / and .M0 ; I 0 / .M00 ; I 00 / imply .M; I /
lagN lagN 0 lagN CN 0
.M00 ; I 00 /:
Hence shift equivalence is an equivalence relation on symbolic matrix systems.

Proposition 6.6.18. Strong shift equivalence in N -step implies shift equivalence of
lag N in symbolic matrix systems.
For a subshift .; / over ˙, its n-higher power shift ..n/ ; / is defined to be the
subshift .; n / over .˙/n (cf. [33]). Two subshifts are called eventually conjugate
if their n-higher power shifts are topologically conjugate for all large enough n [19,
52]. Williams and Kim and Roush showed that two square nonnegative matrices are
shift equivalent if and only if the associated topological Markov shifts are eventually
conjugate. Boyle and Krieger generalized their result to symbolic matrices and sofic
subshifts [4]. For a symbolic matrix system .M; I /; let be the presented subshift.
We set for l 2 N,
n
Il;lC1 D Inl;nlC1 InlCn1;nlCn ; Mnl;lC1 D Mnl;nlC1 MnlCn1;nlCn :
Then .Mn ; I n / becomes a symbolic matrix system whose presented subshift is the
n-higher power shift .n/ of .
154 K. Matsumoto
Proposition 6.6.19. If symbolic matrix systems .M; I / and .M0 ; I 0 / are shift
equivalent, their presented subshifts and 0 are eventually conjugate.
Proof. Assume .H; K/ W .M; I / .M0 ; I 0 /: For a number K 2 N, put n D

lagN
K C N . Let CN ; DN be the alphabets as in the definition of shift equivalence. Set
C D CN ; D D DN .˙/K . There are natural specifications .˙/n ! C D and
.˙ 0 /n ! D C by using the specifications in the shift equivalence between .M; I /
and .M0 ; I 0 /. Put the matrices
0 0 0
Pl D Hnln InlK;nlKC1 InlKC1;nlKC2 Inl1;nl ;
Ql D Knln MnlK;nlKC1 MnlKC1;nlKC2 Mnl1;nl :
They are an m.nl n/ m0 .nl/ matrix over C and an m0 .nl n/ m.nl/ matrix over
D, respectively. They yield a strong shift equivalence in 1-step between .Mn ; I n /
and .M0 n ; I 0 n / so that their presented subshifts are topologically conjugate. t
u
Properly shift equivalences .M; I / .M0 ; I 0 / are defined in [36, 41]. They
N pr
are slightly stronger than shift equivalence and weaker than properly strong shift
equivalence.
6.7 Nonnegative Matrix Systems
In this section, we introduce the notion of a nonnegative matrix system that is also
a generalization of nonnegative matrices. We then generalize strong shift equivalent
and shift equivalence between nonnegative matrices to between nonnegative matrix
systems. Let .Al;lC1 ; Il;lC1 /; l 2 N be a pair of sequences of rectangular matrices
such that the following conditions for each l 2 N are satisfied:
1. Al;lC1 is an m.l/ m.l C 1/ rectangular matrix with entries in nonnegative
integers.
2. Il;lC1 is an m.l/ m.l C 1/ rectangular matrix with entries in f0; 1g satisfying
the relation:
Il;lC1 AlC1;lC2 D Al;lC1 IlC1;lC2 ; l 2 N: (6.5)
We further assume that both the matrices Al;lC1 and Il;lC1 have no zero columns
and no zero rows. For j , there uniquely exists i such that Il;lC1 .i; j / ¤ 0. The
above conditions imply that m.l/ m.l C1/: The pair .A; I / is called a nonnegative
matrix system. The following is basic.
Lemma 6.7.1. For a symbolic matrix system .M; I /, let Ml;lC1 be the m.l/
m.l C 1/ nonnegative matrix obtained from Ml;lC1 by setting all the symbols equal
to 1. Then the resulting pair .M; I / becomes a nonnegative matrix system.
We write the matrices above as supp.Ml;lC1 / D Ml;lC1 and call Ml;lC1 the support
of Ml;lC1 . The pair .M; I / is also called the support of .M; I / or the nonnegative
matrix system associated with .M; I /.
Definition 6.7.2. Two nonnegative matrix systems .A; I / and .A0 ; I 0 / are said to
be strong shift equivalent in 1-step, written as .A; I / .A0 ; I 0 /; if for each
1st
1 < l 2 N, there exist an m.l 1/ m0 .l/ nonnegative matrix Hl and an
m0 .l 1/ m.l/ nonnegative matrix Kl satisfying the equations:
0
Il1;l Al;lC1 D Hl KlC1 ; Il1;l A0l;lC1 D Kl HlC1
and
0 0
Hl Il;lC1 D Il1;l HlC1 ; Kl Il;lC1 D Il1;l KlC1 :
Two nonnegative matrix systems .A; I / and .A0 ; I 0 / are said to be strong shift equiv-
alent in N-step, written as .A; I / .A0 ; I 0 /; if there exist nonnegative matrix
N st
systems .A.i / ; I .i / /; i D 1; 2; : : : ; N 1 such that
.A; I / .A.1/ ; I .1/ / .A.N 1/ ; I .N 1/ / .A0 ; I 0 /:

1st 1st 1st 1st
We simply call it a strong shift equivalence.
This formulation is also a generalization of Williams’s strong shift equivalent

between nonnegative matrices [52]. Similarly to symbolic matrix systems, strong
shift equivalence is an equivalence relation on nonnegative matrix systems. We di-
rectly have
Proposition 6.7.3. If two symbolic matrix systems are strong shift equivalent (in
N -step), then the associated nonnegative matrix systems are strong shift equivalent
(in N -step).
t
For a nonnegative matrix system .A; I /, the transpose Il;lC1 of the matrix Il;lC1
naturally induces an ordered homomorphism from Z m.l/
to Zm.lC1/ , where the pos-
itive cone Zm.l/
C of the group Zm.l/ is defined by
m.l/
ZC D f.n1 ; n2 ; : : : ; nm.l/ / 2 Zm.l/ jni 0; i D 1; 2 : : : m.l/g:
We put the inductive limits:
ZI t D limfIl;lC1
t
W Zm.l/ ! Zm.lC1/ g;
!
ZC
It
D limfIl;lC1
t
W Zm.l/
C ! Zm.lC1/
C g:
!
156 K. Matsumoto
For each l 2 N, the homomorphism Il;lC1

t
W Zm.l/ ! Zm.lC1/ is injective. Hence
the canonical homomorphism l W Zm.l/ ! ZI t is injective. By the relation (6.5),
the sequence of the transposed matrices Atl;lC1 ; l 2 N of Al;lC1 ; l 2 N yields an
endomorphism of the ordered group ZI t . We write it as .A;I / .
Definition 6.7.4. For nonnegative matrix systems .A; I / and .A0 ; I 0 / and L 2 N, a
homomorphism from the group ZI t to the group ZI 0 t is called a finite homomor-
0
phism of lag L if it satisfies the condition .Zm.l/ / Zm .lCL/ for all l 2 N; where
m0 .l/
Zm.l/
and Z are naturally embedded into ZI t and ZI 0 t , respectively.
Proposition 6.7.5. Two nonnegative matrix systems .A; I / and .A0 ; I 0 / are strong
shift equivalent in 1-step if and only if there exist order-preserving finite homomor-
phisms of lag 1: W ZI t ! ZI 0 t and W ZI 0 t ! ZI t such that
ı D .A;I / ; ı D .A0 ;I 0 / :
For a nonnegative matrix system .A; I /, we set the m.l/ m.l C k/ matrices:
Il;lCk D Il;lC1 IlCk1;lCk ; Al;lCk D Al;lC1 AlCk1;lCk
for each l; k 2 N.
Definition 6.7.6. Two nonnegative matrix systems .A; I / and .A0 ; I 0 / are said to
be shift equivalent of lag N if for each l 2 N, there exist an m.l/ m0 .l C N /
nonnegative matrix Hl and an m0 .l/ m.l C N / nonnegative matrix Kl satisfying
the equations:
Al;lC1 HlC1 D Hl A0lCN;lCN C1 ; A0l;lC1 KlC1 D Kl AlCN;lCN C1 ;

0
Hl KlCN D Il;lCN AlCN;lC2N ; Kl HlCN D Il;lCN A0lCN;lC2N
and
0 0
Il;lC1 HlC1 D Hl IlCN;lCN C1 ; Il;lC1 KlC1 D Kl IlCN;lCN C1 :
We write this situation as
.A; I / .A0 ; I 0 / or .H; K/ W .A; I / .A0 ; I 0 /

lagN lagN
and simply call it a shift equivalence. This formulation is a generalization of

Williams’s shift equivalence between nonnegative matrices ([52], see also [4]).
Shift equivalence is an equivalence relation on nonnegative matrix systems. Sim-
ilarly to symbolic matrix systems, strong shift equivalence in N -step implies shift
equivalence of lag N in nonnegative matrix systems. As in the case of strong shift
equivalence, we may describe shift equivalence on nonnegative matrix systems in
terms of single homomorphisms between inductive limits of Abelian groups.
Proposition 6.7.7. Two nonnegative matrix systems .A; I / and .A0 I 0 / are shift
equivalent of lag N if and only if there exist order-preserving finite homomorphisms
of lag N : W ZI t ! ZI 0 t and W ZI 0 t ! ZI t such that
.A0 ;I 0 / ı D ı .A;I / ; .A;I / ı D ı .A0 ;I 0 / (6.6)
and
ı D N
.A;I / ; ı D N
.A0 ;I 0 / : (6.7)
Let .M; I /; .M0 ; I 0 / be symbolic matrix systems and .M; I /; .M 0 ; I 0 / be their

supports, respectively. The following proposition is direct.
Proposition 6.7.8. 1. .M; I / .M0 ; I 0 / implies .M; I / .M 0 ; I 0 /:

nst nst
2. .M; I / .M0 ; I 0 / implies .M; I / .M 0 ; I 0 /:
lagN lagN
6.8 Dimension Groups, K-Groups, and Bowen–Franks Groups
In this section, we study several shift equivalence invariants of nonnegative matrix

systems. They are the dimension group, K-groups, and Bowen–Franks groups. The
dimension group for a nonnegative matrix system is a generalization of the dimen-
sion group for a nonnegative matrix defined by W. Krieger in [23, 24, 35]. Krieger’s
idea to define dimension groups for nonnegative matrices is based on the K-theory
for C -algebras (cf. [12, 50]). Let .A; I / be a nonnegative matrix system. We set
ZI t .k/ D ZI t and ZC It
.k/ D ZC It
for k 2 N: We define an Abelian group and its
positive cone by the inductive limits:
.A;I / D limf.A;I / W ZI t .k/ ! ZI t .k C 1/g;

!
k
C D limf.A;I / W ZC
It
.k/ ! ZC
It
.k C 1/g:
.A;I / !
k
We call the ordered group ..A;I / ; C .A;I / / the dimension group for .A; I /. Since
the map ı.A;I / W ZI t .k/ ! ZI t .k C 1/ defined by ı.A;I / .ŒX; k/ D .ŒX; k C 1/
for X 2 ZI t yields an automorphism on .A;I / that preserves the positive cone
C .A;I /
. We also denote it by ı.A;I / and call it the dimension automorphism. The
triple ..A;I / ; C
.A;I / ; ı.A;I / / is called the dimension triple for .A; I /.
Proposition 6.8.1. If two nonnegative matrix systems are shift equivalent, their
dimension triples are isomorphic.
158 K. Matsumoto
Proof. Suppose .A; I / .A0 ; I 0 /: By Proposition 6.7.7, there exist order-

lagN
preserving finite homomorphisms W ZI t ! ZI 0 t and W ZI 0 t ! ZI t of
lag N satisfying (6.6) and (6.7). Define the maps ˆ W ZI t .k/ ! ZI 0 t .k/ and
ˆ W ZI 0 t .k/ ! ZI t .k/ by ˆ .ŒX; k/ D .Œ.X /; k/ and ˆ .ŒY; k/ D .Œ .Y /; k/
for X 2 ZI t ; Y 2 ZI 0 t : They induce homomorphisms from .A;I / to .A0 ;I 0 /
and .A0 ;I 0 / to .A;I / , respectively. We still denote them by ˆ and ˆ , respec-
tively. Since the homomorphisms ; are order preserving, the maps ˆ ; ˆ also
preserve order structures of the dimension groups. It then follows that ı.A;I / ı ˆ D
N N
ˆ ı ı.A0 I 0 / ; ı.A0 ;I 0 / ı ˆ D ˆ ı ı.A;I / , and ˆ ı ˆ D ı.A;I / ; ˆ ı ˆ D ı.A0 ;I 0 / :
Both the maps ˆ and ˆ are isomorphisms and the corresponding dimension
triples are isomorphic. t
u
We define the dimension triple ..M;I / ; C.M;I / ; ı.M;I / / for a symbolic matrix sys-
tem .M; I / as the dimension triple ..M;I / ; C ;ı
.M;I / .M;I /
/ for its support .M; I /.
C
We may also define the dimension triple . ; ; ı / for subshift as the dimen-
sion triple for its canonical symbolic matrix system.
Proposition 6.8.2. The dimension triples for subshifts are topological conjugacy
invariants.
For an n n nonnegative matrix A, the Bowen–Franks group BF .A/ is defined
by the group Zn =.1 A/Zn [3]. This group was discovered in a study of suspen-
sion flows of topological Markov shifts by Bowen and Franks ([3, 15], cf. [49]).
They showed that the groups are not only an invariant under shift equivalence but
also an almost complete invariant under flow equivalence of topological Markov
shifts. We introduce and study the notion of Bowen–Franks groups for nonnegative
matrix systems as a generalization of the original Bowen–Franks groups for nonneg-
ative matrices. Our Bowen–Franks groups for a nonnegative matrix system consist
of a pair of Abelian groups. One corresponds to a generalization of the original
Bowen–Franks group, called the Bowen–Franks group of degree zero, and the other
one corresponds to its suspension, called the Bowen–Franks group of degree one.
For matrices, the latter group is the torsion-free part of the original Bowen–Franks
group. For a nonnegative matrix system, the group of degree one is not necessarily
the torsion-free part of the group of degree zero (see Sect. 6.10).
We introduce two Abelian groups for nonnegative matrix systems, called
K-groups, that are invariant under shift equivalence. Let .A; I / be a nonnegative
matrix system. For l 2 N, we set the Abelian groups
K0l .A; I / D Zm.lC1/ =.Il;lC1

t
Atl;lC1 /Zm.l/ ;
K1l .A; I / D Ker.Il;lC1
t
Atl;lC1 / in Zm.l/ :
t
By the relation (6.5), the map Il;lC1 W Zm.l/ ! Zm.lC1/ naturally induces homo-
morphisms: il W Kl .A; I / ! KlC1 .A; I / for
D 0; 1:
Definition 6.8.3. The K-groups for .A; I / are defined as the inductive limits of the
Abelian groups:
K0 .A; I / D limfi0l W K0l .A; I / ! K0lC1 .A; I /g;

!
l
K1 .A; I / D limfi1l W K1l .A; I / ! K1lC1 .A; I /g:

!
l
For a symbolic matrix system .M; I /, its K-groups K0 .M; I /; K1 .M; I / are de-
fined to be the K-groups for its support. The groups K .A; I / are also represented
in the following way.
Proposition 6.8.4.
1. K0 .A; I / D ZI t =.id .A;I / /ZI t D .A;I / =.id ı.A;I / / .A;I / ;
2. K1 .A; I / D Ker.id .A;I / / in ZI t D Ker.id ı.A;I / / in .A;I / :
Since the dimension triple ..A;I / ; C
.A;I / ; ı.A;I / / is invariant under shift equiv-
alence of nonnegative matrix systems, we thus have
Proposition 6.8.5. The groups Ki .A; I /; i D 0; 1 are invariant under shift equiv-
alence of nonnegative matrix systems.
Set the Abelian group
ZI D limfIl;lC1 W Zm.lC1/ ! Zm.l/ g;

l
the projective limit of the system: Il;lC1 W Zm.lC1/ ! Zm.l/ ; l 2 N: The sequence
Al;lC1 ; l 2 N naturally acts on ZI as an endomorphism, denoted by A. The identity
on ZI is denoted by I .
Definition 6.8.6. For a nonnegative matrix system .A; I /, set
BF 0 .A; I / D ZI =.I A/ZI ; BF 1 .A; I / D Ker.I A/ in ZI :
We call BF 0 .A; I / the Bowen–Franks group for .A; I / of degree zero and
BF 1 .A; I / the Bowen–Franks group for .A; I / of degree one.
Theorem 6.8.7. The Bowen–Franks groups BF i .A; I /; i D 0; 1 are invariant un-

der shift equivalence of nonnegative matrix systems.
Proof. Suppose .H; K/ W .A; I / .A0 ; I 0 /: Put ˆK ..xi /i 2N / D .Ki .xN Ci /i 2N /

lagN
for .xi /i 2N 2 ZI . The map ˆK yields a homomorphism from ZI to ZI 0 . By the
0 0
equality: Ki ı .IN Ci;N Ci C1 AN Ci;N Ci C1/ D .Ii;i C1 Ai;i C1 / ı Ki C1 ; the homo-
morphism induces a homomorphism from BF 0 .A; I / to BF 0 .A0 ; I 0 /: We denote it
by N̂ K . We similarly have a homomorphism N̂ H from BF 0 .A0 ; I 0 / to BF 0 .A; I /.
Since we have ˆH ı ˆK D AN on ZI and ˆK ı ˆH D A0 N on ZI 0 , the homomor-
phisms N̂ H and N̂ K are inverses of each other. The homomorphisms ˆH and ˆK
also induce isomorphisms between BF 1 .A; I / and BF 1 .A0 ; I 0 /: t
u
160 K. Matsumoto
We see the following universal coefficient theorem by using elementary homological

algebra. It says that the Bowen–Franks groups are determined by the K-groups.
Theorem 6.8.8. 1. There exists a short exact sequence
ı
0 ! Ext1Z .K0 .A; I /; Z/ ! BF 0 .A; I / ! HomZ .K1 .A; I /; Z/ ! 0
that splits unnaturally.

2. BF 1 .A; I / Š HomZ .K0 .A; I /; Z/:
In the above theorem, Ext1Z is the derived functor of the Hom-functor in homological
algebra. The formulations above come from the universal coefficient theorem for
K-theory of the C -algebra OL associated with the -graph system L ([40],
cf. [6]).
Remark 1. As Ext1Z .K1 .A; I /; Z/ D 0; the following short exact sequence clearly
holds by Theorem 6.8.8(2).
ı
0 ! Ext1Z .K1 .A; I /; Z/ ! BF 1 .A; I / ! HomZ .K0 .A; I /; Z/ ! 0:
Example. Let M be an n n nonnegative matrix. Put for each l 2 N
Al;lC1 D M; Il;lC1 D the n n identity matrix:
Then .A; I / is a nonnegative matrix system that satisfies
K0 .A; I / D Zn =.1 M t /Zn ; K1 .A; I / D Ker.1 M t / in Zn ;

BF 0 .A; I / D Zn =.1 M /Zn ; BF 1 .A; I / D Ker.1 M / in Zn :
Hence we have
K0 .A; I / Š BF 0 .A; I / D BF .M / W the original Bowen–Franks group for M;

K1 .A; I / Š BF 1 .A; I / D the torsion-free part of BF .M /:
Let .A ; I / be the canonical nonnegative matrix system for a subshift . Define
Ki ./ D Ki .A ; I /; i D 0; 1; : the K-groups for ;

BF ./ D BF .A ; I /; i D 0; 1;
i i
: the Bowen–Franks groups for :
Theorem 6.8.9. The K-groups Ki ./ and the Bowen–Franks groups BF i ./
for subshift are Abelian groups that are topological conjugacy invariants of
subshifts.
Suppose that is a sofic shift. We denote by m./ the cardinality of the vertices
of the left Krieger cover graph for and A its adjacency matrix. Then
BF 0 ./ D Zm./ =.1 A /Zm./ ; BF 1 ./ D Ker.1 A / in Zm./ :
The Bowen–Franks group for the nonnegative matrix was first invented for use as
an invariant of flow equivalence of the associated topological Markov shift rather
than topological conjugacy [3, 15, 49]. For a general subshift, we have
Theorem 6.8.10. The K-groups K ./ and hence the Bowen–Franks groups
BF ./ for subshifts are also invariant under flow equivalence of subshifts.
The proof is seen in [38, 39] by using a result of Parry–Sullivan [49].
6.9 Spectrum, -Entropy, and Volume Entropy
It is well known that the set of all nonzero eigenvalues of a nonnegative matrix M is
a shift equivalence invariant. The set of M is called the nonzero spectrum of M and
plays an important rôle for studying dynamical properties of the associated topolog-
ical Markov shift (cf. [21, 33]). In this section, we introduce the notion of spectrum
of nonnegative matrix system .A; I /. It is an eigenvalue of .A; I / in the sense stated
below. We denote by Sp.A; I / the set of all eigenvalues of .A; I /: As the sequence
of the sizes of matrices Al;lC1 ; Il;lC1 ; l 2 N is increasing, it seems to be natural to
deal with eigenvalues of .A; I / with a certain boundedness condition defined below
on the corresponding eigenvectors. We fix a nonnegative matrix system .A; I / for a
while. A sequence fvl gl2N of vectors vl D .vl1 ; : : : ; vlm.l/ / 2 Cm.l/ ; l 2 N is called
an I -compatible vector if it satisfies the conditions:
vl D Il;lC1 vlC1 for all l 2 N: (6.8)
An I -compatible vector fvl gl2N is said to be nonzero if vl is a nonzero vector for

some l. If vli 0 for all i D 1; : : : ; m.l/ and l 2 N, fvl gl2N is said to be nonneg-
Pm.l/
ative. If there exists a number M such that i D1 jvli j M for all l 2 N; fvl gl2N
is said to be bounded. We remark that, for an I -compatible vector fvl gl2N , vN ¤ 0
for some N implies vl ¤ 0 for all l N .
Definition 6.9.1. For a complex number ˇ, a nonzero I -compatible vector fvl gl2N
is called an eigenvector of .A; I / for eigenvalue ˇ if it satisfies the conditions:
Al;lC1 vlC1 D ˇvl for all l 2 N: (6.9)
An eigenvalue ˇ is said to be bounded if it is an eigenvalue for a bounded eigen-

vector. We denote by Sp .A; I / the set of all nonzero eigenvalues of .A; I / and
162 K. Matsumoto
by Spb .A; I / the set of all nonzero bounded eigenvalues of .A; I /, respectively.
We call them the nonzero spectrum of .A; I / and the nonzero bounded spectrum of
.A; I /, respectively.
Theorem 6.9.2. If two nonnegative matrix systems are shift equivalent, their non-
zero spectra coincide.
Proof. Suppose .H; K/ W .A; I / .A0 ; I 0 /: We show Sp .A; I / Sp

lagN
.A0 ; I 0 /. For ˇ 2 Sp .A; I / with nonzero eigenvector vl , we set ul D Kl vlCN
for l 2 N. It is direct to see that
0
ul D Il;lC1 ulC1 ; A0l;lC1 ulC1 D ˇul :
Now if the vectors ul are zero for all l l0 for some l0 , by the equality
Hl KlCN vlC2N D Il;lCN AlCN;lC2N vlC2N , we see
0 D Al;lCN IlCN;lC2N vlC2N D Al;lCN vlCN D ˇvl :
Thus vl D 0 for all l l0 and hence for all l 2 N, a contradiction. Therefore ˇ is a

nonzero eigenvalue of .A0 ; I 0 /. t
u
We next show that the nonzero bounded spectrum of .A; I / is also invariant under
shift equivalence. Put
X
m.l/
NA D max Al;lC1 .i; j /
j
i D1
Pm.l/
for l 2 N: By the relation (6.5), the right-hand side maxj i D1 Al;lC1 .i; j / does
not depend on the choice of l 2 N. For an I -compatible vector fvl gl2N , we put
Pm.l/
kvl k D i D1 jvli j. The sequence fkvl kgl2N is increasing. If fvl gl2N is nonnegative,
fkvl kgl2N is constant and hence fvl gl2N is bounded. We set
kvk1 D lim sup kvl k:

l!1
Proposition 6.9.3. Spb .A; I / fz 2 Cjjzj NA g:
Proof. For ˇ 2 Sp.A; I / with a bounded eigenvector fvl gl2N , we have

0 1
X
m.l/ X
m.lC1/ X
m.l/
ˇ jvli j @max Al;lC1 .i; j /A jvlC1 j:
j
j
i D1 j D1 i D1
Hence the inequality ˇkvl k NA kvlC1 k holds. As fvl gl2N is bounded,

liml!1 kvl k D kvk1 exists so that we have a desired assertion. t
u
We denote by BI the set of all bounded I -compatible vectors. It is a complex

Banach space with norm k k1 . A nonnegative I -compatible vector v D fvl gl2N
is called a state if kvk1 D 1. Let SI be the set of all states. It is a convex subset of
BI . Any bounded I -compatible vector v 2 BI can be expressed as a finite linear
combinations of states. For v 2 BI , we put
X
m.lC1/
.LA v/li D Al;lC1 .i; j /vlC1
j for i D 1; : : : ; m.l/; l 2 N:
j D1
Then LA gives rise to a bounded linear operator on the Banach space BI that sat-
isfies kLA k D NA ; where the norm of LA is given by kLA k D supv¤0 kLkvk A vk1
1
.
Therefore we have
Proposition 6.9.4. For a complex number ˇ, it belongs to Spb .A; I / if and only if
it satisfies LA v D ˇv for some nonzero v 2 BI . That is, the bounded spectra of
.A; I / are nothing but the eigenvalues of the bounded linear operator LA on the
Banach space BI .
By a similar manner to the proof of Theorem 6.9.2, we have
Theorem 6.9.5. If two nonnegative matrix systems are shift equivalent, their
nonzero bounded spectra coincide.
Let .LA / be the set of all spectra of LA as a bounded linear operator on the Banach
space BI . The general theory of bounded linear operators tells us that the set .LA /
is not empty. Let rA be the spectral radius of the operator LA on BI ; that is, rA D
supfjrj W r 2 .LA /g: By a proof similar to [46, Lemma 4.1], we have
Proposition 6.9.6. There exists a state v 2 SI such that LA v D rA v. Hence we
have rA 2 Spb .A; I /.
It is well known that the topological entropy htop ./ for subshift is given by
1
htop ./ D lim log ]Bk ./
k!1 k
where ]Bk ./ denotes the cardinality of the set Bk ./ of all admissible words of
length k in the subshift (cf. [21, 33]). We say a symbolic matrix system .M; I /
is left-resolving if a symbol appearing in M.i; j / cannot appear in M.i 0 ; j / for
other i 0 ¤ i ; equivalently, its -graph system is left-resolving. As in Sect. 6.5, the
canonical symbolic matrix system is left-resolving.
Proposition 6.9.7. Let .M; I / be a left-resolving symbolic matrix system and
.M; I / its support. For any ˇ 2 Spb .M; I /, we have the inequalities:
log jˇj log rM htop ./
where rM is the spectral radius of the operator LM on BI and is the presented

subshift by .M; I /.
164 K. Matsumoto
Proof. The inequality log jˇj log rM is clear. Take v 2 SI such that LM v D
rM v. We have for k 2 N,
X
m.kC1/
rM vi D
k 1
M1;kC1 .i; j /vkC1
j :
j D1
Pm.1/
As i D1 v1i D 1, it follows that
0 1
X
m.1/ X
m.kC1/
k
rM @max M1;kC1 .i; j /A vkC1
j D kLkM k:
j
i D1 j D1
Pm.1/
We may find j0 such that kLkM k D i D1 M1;kC1 .i; j0 /. Since .M; I / is left-
Pm.1/
resolving, the number i D1 M1;kC1 .i; j0 / is majorized by ]Bk ./. Thus we
obtain the inequalities
k
rM kLkM k ]Bk ./:
1
As kLkM k k ! rM for k ! 1, we have the desired inequalities. t
u
For a subshift , define the nonzero spectrum Sp ./ and the nonzero bounded
spectrum Spb ./ of by the nonzero spectrum and the nonzero bounded spectrum
of the canonical nonnegative matrix systems .M; I / for , respectively. We thus
have
Theorem 6.9.8. Both the sets Sp ./ and Spb ./ are not empty and topological
conjugacy invariants of subshifts. In particular, Spb ./ is bounded by the topolog-
ical entropy of the subshift .
Other entropic quantities for a -graph system L have been introduced in [30,42];
the first one is called -entropy, written as h .L/, which measures a growth rate of
the cardinalities of the vertex sets fVl gl2N . The second one is called the volume
entropy, written as hvol .L/; which measures a growth rate of the cardinalities of the
sets of labeled paths. Their definitions are as follows:
1
h .L/ D lim sup log ]Vl :
l!1 l
We denote by Pl .L/ the set of all labeled paths starting at a vertex in V1 and termi-
nating at a vertex in Vl ; and by ] Pl .L/ its cardinality. The volume entropy is defined
by the formula:
1
hvol .L/ D lim sup log ]Pl .L/:
l!1 l
Theorem 6.9.9. Both h .L/ and hvol .L/ are invariant under shift equivalence of
-graph systems.
This implies that they yield topological conjugacy invariants of subshifts. We see
that hvol .L/ is given by the topological entropy of a topological dynamical system
.L ; XL / associated with the -graph system L [42].
6.10 Example
We give examples of the K-groups and the Bowen–Franks groups for a class of
certain nonsofic subshifts that include the synchronizing counter shift C defined in
Sect. 6.4. Let ˙N be the set of symbols fa1 ; : : : ; aN ; b; cg for a fixed N 2 N. The
nonsofic subshift CN is the coded shift over ˙N whose forbidden words are
FCN D fai b m c k aj j i; j D 1; : : : ; N with m ¤ kg;
m
‚…„ƒ ‚…„ƒ k
where the word ai b c aj means ai b b c c aj : In [45], the C -algebra OCN
m k
associated with the subshift CN has been studied so that its K-groups and Bowen–
Franks groups that are those of the canonical symbolic matrix system for CN have
been calculated. We have
Proposition 6.10.1.
K0 .CN / D Z=N Z ˚ Z; K1 .CN / D 0 and

BF 0 .CN / D Z=N Z; BF 1 .CN / D Z:
These types of Bowen–Franks groups cannot be realized in sofic shifts because

BF 1 .CN / is not the torsion-free part of BF 0 .CN / (cf. [34]).
In [18, 29, 43], the K-groups and the Bowen–Franks groups for ˇ-shifts and the
Dyck shifts are calculated.
6.11 Remark: Relation to K-Theory for C -Algebras
The author has constructed a C -algebra OL from the -graph system L ([40],
cf. [10, 37]). The C -algebra OL has a canonical action ˛ of the one-dimensional
torus group T, called gauge action. The fixed point algebra FL of OL under ˛ is an
AF-algebra which is stably isomorphic to the cross product OL ˛ T. Let .M; I /
be the nonnegative matrix system for L. The invariants studied in this chapter are
described in terms of the K-theory for the C -algebra in the following way:
..M;I / ; C
.M;I / ; ı.M;I / / D .K0 .FL /; K0 .FL /C ; ˛
O /;
Ki .M; I / D Ki .OL /; i D 0; 1;
i C1
BF .M; I / D Ext
i
.OL /; i D 0; 1
166 K. Matsumoto
where ˛O denotes the dual action of ˛ and Ext1 .OL / D Ext.OL /; Ext0 .OL / D
Ext.OL ˝ C0 .R//. The normalized nonnegative eigenvectors of .M; I / exactly cor-
respond to the KMS-states for ˛ on the C -algebra OL . Hence the set of all bounded
spectra with nonnegative eigenvectors is the set of all inverse temperatures for the
admitted KMS states [46], cf. [13].
6.12 Conclusions and Further Work
As a consequence, we see that infinite labeled graphs called -graph systems yield
presentations of symbolic dynamical systems so that several kinds of computable
topological conjugacy invariants of symbolic dynamical systems are defined. The
invariants are related to invariants of the associated C -algebras.
Computations of these invariants for other kinds of symbolic dynamical systems
are seen, for example, in [7, 8, 31]. Related works to C -algebras are, for example,
[1, 32, 44].
Acknowledgments The author would like to deeply thank Matthias Dehmer and Jun Ichi Fu-
jii for their invitation to the author to write this chapter and for their helpful suggestions in the
presentation of this paper.
References
1. Bates T, Pask D (2007) C -algebras of labelled graphs. J Oper Theory 57:207–226

2. Blanchard F, Hansel G (1986) Systems codés. Theor Comput Sci 44:17–49
3. Bowen R, Franks J (1977) Homology for zero-dimensional nonwandering sets. Ann Math
106:73–92
4. Boyle M, Krieger W (1988) Almost Markov and shift equivalent sofic systems. In: Proceedings
of Maryland special year in dynamics 1986–1987. Lecture Notes in Mathematics, vol 1342.
Springer, pp 33–93
5. Bratteli O (1972) Inductive limits of finite-dimensional C -algebras. Trans Am Math Soc
171:195–234
6. Brown LG (1983) The universal coefficient theorem for Ext and quasidiagonality. Operator
Algebras and Group Representation, vol 17. Pitmann Press, Boston, pp 60–64
7. Carlsen TM, Eilers S (2004) Matsumoto K-groups associated to certain shift spaces. Doc Math
9:639–671
8. Carlsen TM, Eilers S (2006) K-groups associated to substitutional dynamics. J Funct Anal
238:99–117
9. Chomsky N, Schützenberger MP (1963) The algebraic theory of context-free languages.
In: Braffort P, Hirschberg D (eds) Computer programing and formal systems. North-Holland,
Amsterdam, pp 118–161
10. Cuntz J, Krieger W (1980) A class of C -algebras and topological Markov chains. Invent Math
56:251–268
11. Denker M, Grillenberger C, Sigmund K (1976) Ergodic theory on compact spaces. Springer,
Berlin, Heidelberg and New York
12. Effros EG (1981) Dimensions and C -algebras. In: AMS-CBMS Reg Conf Ser Math, vol 46.
American Mathematical Society, Providence, RI
13. Enomoto M, Fujii M, Watatani Y (1984) KMS states for gauge action on OA . Math Japon
29:607–619
14. Fischer R (1975) Sofic systems and graphs. Monats für Math 80:179–186
15. Franks J (1984) Flow equivalence of subshifts of finite type. Ergod Theory Dyn Syst 4:53–66
16. Hamachi T, Nasu M (1988) Topological conjugacy for 1-block factor maps of subshifts and
sofic covers. In: Proceedings of Maryland special year in dynamics 1986–1987. Lecture Notes
in Mathematics, vol 1342. Springer, pp 251–260
17. Hopcroft JE, Ullman JD (2001) Introduction to automata theory, languages, and computation.
Addison-Wesley, Reading, MA
18. Katayama Y, Matsumoto K, Watatani Y (1998) Simple C -algebras arising from ˇ-expansion
of real numbers. Ergod Theory Dyn Syst 18:937–962
19. Kim KH, Roush FW (1979) Some results on decidability of shift equivalence. J Combin Inf
Syst Sci 4:123–146
20. Kim KH, Roush FW (1999) Williams conjecture is false for irreducible subshifts. Ann Math
149:545–558
21. Kitchens BP (1998) Symbolic dynamics. Springer, Berlin
22. Krieger W (1974) On the uniqueness of the equilibrium state. Math Syst Theory 8:97–104
23. Krieger W (1980) On dimension for a class of homeomorphism groups. Math Ann 252:87–95
24. Krieger W (1980) On dimension functions and topological Markov chains. Invent Math
56:239–250
25. Krieger W (1984) On sofic systems I. Isr J Math 48:305–330
26. Krieger W (1987) On sofic systems II. Isr J Math 60:167–176
27. Krieger W (2000) On subshifts and topological Markov chains. Numbers, Information and
Complexity (Bielefeld 1998). Kluwer, Boston, MA, pp 453–472
28. Krieger W, Matsumoto K (2002) Shannon graphs, subshifts and lambda-graph systems. J Math
Soc Jpn 54:877–900
29. Krieger W, Matsumoto K (2003) A lambda-graph system for the Dyck shift and its K-groups.
Doc Math 8:79–96
30. Krieger W, Matsumoto K (2004) A class of topological conjugacy of subshifts. Ergod Theory
Dyn Syst 24:1155–1172
31. Krieger W, Matsumoto K (2010) Subshifts and C -algebras from one-counter codes. Contem-
porary Math 503(2009):93–120 AMS
32. Kumjian A, Pask D, Raeburn I, Renault J (1997) Graphs, groupoids and Cuntz–Krieger alge-
bras. J Funct Anal 144:505–541
33. Lind D, Marcus B (1995) An introduction to symbolic dynamics and coding. Cambridge
34. Matsumoto K (1999) A simple C -algebra arising from certain subshift. J Oper Theory
42:351–370
35. Matsumoto K (1999) Dimension groups for subshifts and simplicity of the associated
C -algebras. J Math Soc Jpn 51:679–698
36. Matsumoto K (1999) Presentations of subshifts and their topological conjugacy invariants. Doc
Math 4:285–340
37. Matsumoto K (2000) Stabilized C -algebras constructed from symbolic dynamical systems.
Ergod Theor Dyn Syst 20:821–841
38. Matsumoto K (2001) Bowen–Franks groups for subshifts and Ext-groups for C -algebras.
K Theor 23:67–104
39. Matsumoto K (2001) Bowen–Franks groups as an invariant for flow equivalence of subshifts.
Ergod Theory Dyn Syst 21:1831–1842
40. Matsumoto K (2002) C -algebras associated with presentations of subshifts. Doc Math 7:1–30
41. Matsumoto K (2003) On strong shift equivalence of symbolic matrix systems. Ergod Theory
Dyn Syst 23:1551–1574
42. Matsumoto K (2005) Topological entropy in C -algebras associated with -graph systems.
Ergod Theor Dyn Syst 25:1935–1951
43. Matsumoto K (2005) K-theoretic invariants and conformal measures on the Dyck shifts. Int
J Math 16:213–248
168 K. Matsumoto
44. Matsumoto K (2007) Actions of symbolic dynamical systems on C -algebras. J Reine Angew
Math 605:23–49
45. Matsumoto K A class of simple C -algebras arising from certain nonsofic subshifts, to appear
in Ergod Theory Dyn Syst, arxiv:0805.2767
46. Matsumoto K, Watatani Y, Yoshida M (1998) KMS-states for gauge actions on C -algebras
associated with subshifts. Math Z 228:489–509
47. Nasu M (1986) Topological conjugacy for sofic shifts. Ergod Theory Dyn Syst 6:265–280
48. Nasu M (1995) Textile systems for endomorphisms and automorphisms of the shift. Mem Am
Math Soc 114:546
49. Parry W, Sullivan D (1975) A topological invariant for flows on one-dimensional spaces. Topol-
ogy 14:297–299
50. Tuncel S (1983) A dimension, dimension modules, and Markov chains. Proc Lond Math Soc
46:100–116
51. Weiss B (1973) Subshifts of finite type and sofic systems. Monatsh Math 77:462–474
52. Williams RF (1973) Classification of subshifts of finite type. Ann Math 98:120–153. Erratum
(1974) Ann Math 99:380–381
Chapter 7
Decompositions and Factorizations
of Complete Graphs
Petr Kovář
Abstract Graph decompositions into isomorphic copies of a given graph are a

well-established topic studied in both graph theory and design theory. Although
spanning tree factorizations may seem to be just a special case of this concept, not
many general results are known. We investigate necessary and sufficient conditions
for a graph factorization into isomorphic spanning trees to exist.
Keywords Graph decomposition Graph factorization Graph labeling
In this chapter we investigate factorization of complete graphs into isomorphic span-

ning trees. The main goal is to present a recursive method that generalizes several
previously introduced concepts. We start with a detailed overview of known meth-
ods. A brief summary of known results on spanning tree factorization of complete
graphs follows. In the last part we describe a construction that unifies most of the
presented methods in one general labeling called recursive labeling.
7.1 About Graph Decompositions and Factorizations
There are several real-life problems that lead to graph decompositions or con-
structing block designs. One of them – the design of ad hoc wireless networks –
is described in Sect. 7.1.1. We proceed by giving a detailed overview of methods
used for decompositions and spanning tree factorizations of complete graphs and
in later sections we try to generalize them. Thus, this chapter provides a survey of
techniques as well as a new result in this area.
P. Kovář ()
Department of Applied Mathematics, Technical University Ostrava, 17. listopadu,
708 33 Ostrava–Poruba, Czech Republic

170 P. Kovář
7.1.1 Ad Hoc Wireless Network Design
Various difficulties have to be resolved while designing ad hoc networks. After the
network structure is changed locally (due to some failure) it can take a long time
until this change is absorbed by the network, in particular, by the routing tables.
Resolving such a failure by reconnecting nodes within the network may lead to huge
diameter or high load for certain nodes in the network structure. Let us concentrate
on wireless networks of mobile units of a firefighter department. The firefighters
in action communicate with each other and headquarters broadcasts orders to all
units. Their wireless networks consist of several mobile units, usually about two
dozen with rather low traffic (compared with an Internet network) and with a limited
number of stationary units. Each unit can communicate with every other unit but
some pairs may temporarily lose connection since the firefighters are moving in the
terrain. It is crucial to restore connections quickly, since blackouts can jeopardize
the operation and firefighters’ lives. We want both to quickly restore connectivity
and keep appropriate network parameters: a low number of hops (small diameter,
usually 3–10) and balance (low highest degree, up to 20). Each unit has its unique ID
and responds only to this particular ID. Every unit operates as receiver, transmitter,
and router to receive messages from one unit and forward it to another unit. Routing
is maintained by the units itself.
Reformulating this problem as a graph theory problem we require network
designs that are connected and do not contain circuits. The set of all possible con-
nections forms a complete graph. Each particular network forms a spanning tree in
this complete graph.
We present a method of decomposing a complete graph into spanning trees that
are all isomorphic to the same structure. We obtain a collection of isomorphic factors
(network structures), forming a pool of networks, all with the same diameter and the
same highest degree. Moreover, all pairs of networks are edge disjoint, thus if one
particular connection fails, no other factor from the pool will be affected by this
failure. Instead of repairing one broken connection we swap to an entirely alternate
network.
The list of networks can be hard-coded with the software on the units. In case of
lost connection a broadcast message from the two separated units can resolve the
problem immediately by switching to one of the backup networks. Once removed,
a network structure can be put back into the list. We expect the missing connection
to restore in time.
7.1.2 Description of the Graph Theory Problem
We are given a graph representing a network or a set of relations on n ele-

ments. Performing an operation on this net, one may want to parallelize or simply
split one complex task into several smaller tasks. This immediately translates into
decomposing the given graph into subgraphs. Each edge of the original graph is to
appear in exactly one subgraph.
7 Decompositions and Factorizations of Complete Graphs 171
There may be further requirements put on the decomposition. It is natural to as-

sume that all smaller graphs are not “too big,” that they have the same number of
vertices and edges, or that the diameter is bounded, or that they are all isomorphic.
Further, one may require that all smaller subgraphs are spanning; i.e., each of them
is connected is contains all vertices of the original graph. The main scope of this
chapter is decompositions of complete graphs into small acyclic isomorphic span-
ning graphs: isomorphic spanning trees.
Decompositions of complete graphs are the subject of studies in both design the-
ory and graph theory. Since design theory methods are suitable mainly for problems
of decomposition into highly symmetric graphs (e.g., vertex transitive graphs such
as complete graph, cycles or multipartite graphs [1, 6]) and we examine decomposi-
tion into trees (nonregular graphs) the methods discussed further in this chapter are
based almost exclusively on graph theory.
We use standard terminology that can be found in any textbook (see [35] or [7]).
All graphs are finite and simple (without loops or multiple edges). A graph G is
a pair .V; E/, where the set of vertices V (often denoted by V .G/) is nonempty
and the set of edges E (or E.G/) is a subset of P2 .V /, the set of all two-element
subsets of V .
Definition 1. Let H be a graph on n vertices. A decomposition of the graph H is

a set of pairwise edge disjoint subgraphs G1 ; G2 ; : : : ; Gs of H such that every edge
of H belongs to exactly one of the subgraphs Gr . If each subgraph Gr is isomorphic
to a graph G we speak about a G-decomposition of H . If G is a connected factor of
H , then we call the G-decomposition a G-factorization.
7.1.3 Necessary Conditions for Decompositions
There are some obvious and some less obvious necessary conditions for a
G-decomposition of a given graph H .
It is easy to see that the number of edges jE.G/j has to divide the number of
edges jE.H /j since each edge of the graph H belongs to one copy of G. Moreover
there are restrictions on the degree sequence of G. If k D jE.H /j=jE.G/j is the
number of copies of G in H , then the multiset D in which the degree of every
vertex of G appears exactly k times has to be decomposable into multisets Di ,
i D 1; 2; : : : ; jV .G/j, such that the sum of degrees in each Di corresponds to the
degree of a vertex wi 2 V .H /. If H is r-regular this condition is simpler, the sum
of elements in each Di has to be r. In particular, if H is a complete graph Kn , then
the sum of elements in each Di has to be n 1.
Example 1. We show that the graph H ' Kr can be decomposed into G ' K4
only if r 1 .mod 12/. The number of edges r.r 1/=2 has to be divisible by 6,
172 P. Kovář
thus r 0; 1 .mod 12/. Moreover the degree 3 of every vertex in K4 has to divide
r 1, thus r 1 .mod 3/. Combining these conditions, the claim follows.
Example 2. Let t be an integer. The complete graph K2t cannot be decomposed

into cycles nor any even regular graphs, since it is odd-regular.
On the other hand there are also structural limitations that apply to the exis-
tence of a G-decomposition of H . A caterpillar is a tree such that by removing
all leaves we obtain a path. Although the graphs R1 and R2 in Fig. 7.1 have the
same number of edges and the same degree sequence, the caterpillar R1 does and
the caterpillar R2 does not decompose the complete graph K6 (for a small graph a
brute force search can be performed; a general nonexistence result addressing cer-
tain caterpillars with diameter four is presented in [14]). The structural restrictions
depend strongly on the particular class of graphs and are difficult to explore in gen-
eral. Therefore such structural necessary conditions are known almost exclusively
for highly symmetric graphs, such as vertex transitive graphs, and only sparsely for
trees. Some results are presented in Sect. 7.3.
Definition 2. We say a G-decomposition of a graph H on 2n C 1 vertices into

G0 ; G1 ; : : : ; G2n is cyclic if there exists an ordering .x0 ; x1 ; : : : ; x2n / of vertices of
H and isomorphisms i W G1 ! Gi ; i D 0; 1; : : : ; 2n such that i .xj / D xi Cj for
every j D 0; 1; : : : ; 2n, where the subscripts are taken modulo 2n C 1.
Example 3. In Fig. 7.2 is shown the factor G1 of a cyclic C3 -decomposition of K7 .

The next six subgraphs are obtained by isomorphisms “rotating” the graph G1
clockwise.
If we have a graph G with m edges and we are looking for a cyclic G-

decomposition of some Kn there have to be n copies of G in Kn . The number
of edges in nG (n copies of G) has to divide jE.Kn /j,
nmjn.n 1/=2 thus n D mk C 1
for some positive integer k.
Fig. 7.1 Caterpillars R1

and R2
7x
Fig. 7.2 Cyclic

C3 -decomposition of K7
7.1.4 Sufficient Conditions for Decompositions
There is no necessary and sufficient condition known for a graph G to decompose

a graph H in general, not even in the case when H is a complete graph and G is
arbitrary. Only for some classes of graph G was the sufficiency settled.
Now let us restrict only to the problem when H ' Kn for some integer n. There
are only a few sufficient conditions for a G-decomposition of a complete graph to
exist. They include both design theory and graph theory techniques. Here we focus
on the latter ones since only these also apply to the factorizations in Sect. 7.1.6. The
problem of the existence of a G-decomposition of a complete graph is transformed
into the existence of a certain labeling of a given graph G. To describe the methods
of decompositions using a graph labeling we have to introduce some terms.
We denote the vertices of the complete graph Kn by v1 ; v2 ; : : : ; vn . The length
of an edge vi vj is the smaller “distance” between vi and vj along the cycle
v1 ; v2 ; : : : ; vn . It can be counted by taking the smaller value of jj i j and njj i j.
This notion can also be extended to graphs that are labeled by the first n positive
integers. In general, a graph labeling is a mapping that assigns integers (usually
positive) to graph elements: vertices, edges, or both. Hence the following definition.
Definition 3. Let G be a graph with m edges and the vertex set V .G/ and let be an
injection W V .G/ ! S where S is a subset of the set f0; 1; 2; : : : ; 2mg. The length
of an edge xy is defined as `.x; y/ D minfj.x/ .y/j; 2m C 1 j.x/ .y/jg.
The set of vertex labels is denoted by .V .G//.
Additional requirements are put on the labelings to guarantee that in a G-

decomposition of Kn each edge appears in precisely one copy of G. In 1967 Rosa
(see [31]) defined the ˛-, ˇ-, -, and -valuations depending on which of the fol-
lowing conditions of a vertex labeling of a graph G with m edges are satisfied:
(a) the set of vertex labels .V .G// f0; 1; : : : ; mg
(b) the set of vertex labels .V .G// f0; 1; : : : ; 2mg
(c) the set fj.x/ .y/jW xy 2 E.G/g D f1; 2; : : : ; mg
(d) the set of edge lengths f`.x; y/W xy 2 E.G/g D f1; 2; : : : ; mg
(e) there exists a 2 f0; 1; : : : ; mg, such that for all xy 2 E.G/ either .x/ a <
.y/ or .x/ > a .y/
If the labeling satisfies
(a), (c), (e), then it is an ˛-valuation
(a), (d), then it is a ˇ-valuation
(b), (c), then it is a -valuation
(b), (d), then it is a -valuation
The hierarchy of the valuations is ˛-, ˇ-, -, and -valuation which means that if
G allows a certain valuation in the list, it also allows any latter one. Since 1967
hundreds of papers have been published extending the list of graphs known to allow
some of these valuations. See Gallian [17] for an excellent survey updated every
174 P. Kovář
year. Through the years the names ˛-labeling, -labeling, and graceful labeling for
the ˇ-valuation (see Golomb [18]) became more popular. The importance of the
valuations for decompositions is apparent from the following paragraphs.
In the next paragraphs several other labelings are defined. There are plenty of
definitions, some of them rather technical, that are used for spanning tree factoriza-
tions of complete graphs. Later, in Sect. 7.4 we try to find a general labeling that
extends features of most of the labelings described here. Therefore the techniques
are explained in detail.
˛-Labeling
It is easy to observe that when a graph G allows an ˛-labeling then it has to be

bipartite. In [31] Rosa proved the following sufficient condition for the existence of
cyclic decompositions.
Theorem 1. If a graph G with m edges has an ˛-labeling, then there exists a cyclic
G-decomposition of the complete graph K2kmC1 , where k is any natural number.
We accept the following convention: if convenient the vertex name is unified

with its label. For example, instead of saying “the vertex x labeled i ” we say “the
vertex i ” and vice versa.
Example 4. In Fig. 7.3 is shown an example of an ˛-labeling. Notice that evaluating

the edge lengths we get all consecutive integers 1; 2; : : : ; 5. Moreover, taking a D 3
for every edge xy is either x 3 and y > 3 or x > 3 and y 3.
It should be pointed out that not all decompositions are necessarily cyclic as
shown by the next example.
Example 5. K9 can be decomposed into triangles C3 (a Steiner triple system), but

since there are 12 of them, this decomposition cannot be cyclic. Moreover, for K2t
no cyclic spanning tree decomposition into trees with t edges can exist, since there
would have to be 2t 1 of the copies, not 2t.
On the other hand, there are trees that have no ˛-labeling (see [2]), hence the
property of being bipartite is not a sufficient condition for an ˛-labeling to exist.
1 5
4 3 a
5 3
Fig. 7.3 ˛-Labeling of 1

a graph G and a bipartite
drawing of G 2 2
Fig. 7.4 -Labeling of R1 0

and its drawing as a subgraph 10 1
in K11 2
9
9 8 3
7 4
0 5 1 3 2 6 5
ˇ-, -, and -Labelings
Surprisingly most attention was devoted to graceful labelings (ˇ-valuation) although

it is the -labeling that is the most general labeling sufficient for the existence of a
G-decomposition of a complete graph. In [31] Rosa proved the following necessary
and sufficient condition
Theorem 2. Let G be a graph with m edges. A cyclic G-decomposition of the com-
plete graph K2mC1 exists if and only if G has a -labeling.
The research in graceful labelings has been intensive during the past four
decades; see [17].
Example 6. There is an example of a -labeling of R1 given in Fig. 7.4. Notice that
evaluating the edge lengths we get all consecutive integers 1; 2; : : : ; 5. This is easy
to check in the same figure where R1 is drawn as a subgraph G1 in K11 .
7.1.5 Necessary Conditions for Factorizations
Recall that the main scope of this chapter is factorization of complete graphs. Since
G-factorizations are a special case of G-decompositions, then besides the necessary
conditions given in Sect. 7.1.3 more restrictions apply. For a G-factorization of Kn
to exist, all the multisets Di (defined on page 171) have to be of the same size,
namely k where k is the number of factors isomorphic to G in Kn . Moreover, since
the degree of every vertex x in each factor Gi has to be at least one, the largest
degree .G/ has to be at most n k. We call this the degree condition.
Let T be a spanning tree of Kn . Thus T is a tree on n vertices (and m D n 1
edges) and since !
n 1
jE.Kn /j D D n.n 1/
2 2
it follows that n has to be even, say n D 2t, and there have to be exactly n=2 D t
factors in a T -factorization of K2t and the largest degree .T / D nk D 2t t D t.
Example 7. No star K1;n1 can factorize the complete graph Kn due to the degree
condition. A double-star is a tree with only two vertices of degree t greater than 1
176 P. Kovář
Fig. 7.5 A double-star

3
+
factorizing K6
(called nonleaves). A double-star satisfies the degree condition for factorizing K2t
and it can easily be observed that it actually does decompose K2t for every t 2.
See Fig. 7.5.
Let G be a graph with m edges and m C 1 vertices, with possibly some of them
isolated. Since we are factorizing the complete graph (on m C 1 vertices) into iso-
morphic copies of G it follows that the order of the complete graph has to be even.
7.1.6 Sufficient Conditions for Factorizations
In comparison to decompositions, factorizations remained fairly unexplored. All

methods known for spanning tree factorizations are based on graph labelings, save
for the trivial Hamiltonian path or double-star factorizations. The methods include
-symmetric labeling, blended -labeling, swapping labeling, 2n-cyclic blended
labeling, and fixing labeling. We describe these in the following paragraphs. To
present clearly the idea of our main result in Sect. 7.4 we try to keep a general point
of view by stressing the important facts and skipping some details. Then in Sect. 7.4
we combine these methods.
We start with a definition.
Definition 4. A G-decomposition of a graph H on 2n vertices into G1 ; G2 ; : : : ; Gs
is bicyclic if there exists an ordering .x0 ; x1 ; : : : ; xn1 ; y0 ; y1 ; : : : ; yn1 / of vertices
of H and isomorphisms i W G1 ! Gi ; i D 1; 2; : : : ; s such that i .xj / D xj Ci 1
and i .yj / D yj Ci 1 for every j D 0; 1; : : : ; n 1, where the subscripts are taken
modulo n.
Factorizing Regular Complete Bipartite Graphs
For factorization of regular complete bipartite graphs Kn;n Fronček introduced the
bipartite -labeling; see [12]. Although we are factorizing complete graphs, the
notion of a, bipartite -labeling is used in most of the subsequent labelings and
plays an important role in Sect. 7.4. We give the definition here.
Definition 5. Let G be a bipartite graph with n edges and the vertex set V .G/ D
V0 [ V1 . Let be an injection W Vi ! Si , where Si is a subset of the set
f0i ; 1i ; : : : ; .n 1/i g, i D 0; 1. The length of an edge .x0 ; y1 / for x0 2 V0 and
y1 2 V1 with .x0 / D a0 and .y1 / D b1 is defined as `01 .x0 ; y1 / D b a

.mod n/. If the set of all lengths of n edges is equal to f0; 1; 2; : : : ; n 1g, then is
a bipartite -labeling.
It was shown in [12] that the existence of a bipartite -labeling of a graph G implies
a bicyclic decomposition of the complete graph Kn;n .
Theorem 3. Let a bipartite graph G with n edges have a bipartite -labeling. Then
there exists a bicyclic decomposition of Kn;n into n copies of G.
This idea plays an important role for all the blended, swapping, 2n-cyclic blended,
and fixing labelings.
-Symmetric Labeling
A connected graph G with an edge .x; y/ (called a bridge) is symmetric if there

is an automorphism of G such that .x/ D y and .y/ D x. The isomorphic
components of G .x; y/ are called banks and denoted by H; H 0 , respectively.
See Fig. 7.6.
Definition 6. A labeling of a symmetric graph G with 2n 1 edges and banks H ,

H 0 is -symmetric graceful if H has a -labeling and .i / D i C n .mod 2n/ for
each vertex i in H . A graph that admits a -symmetric graceful labeling is called
-symmetric graceful.
This concept was introduced by Eldergill in [8]. The following theorem (proven
in [8]) shows how this applies to spanning tree factorizations.
Theorem 4. Let G be a symmetric graph with 2n 1 edges. Then there exists a

cyclic G-decomposition of K2n if and only if G is -symmetric graceful.
If G is an acyclic graph, it is a spanning tree of K2n . Thus a symmetric tree on 2n

vertices that allows a -symmetric graceful labeling factorizes the complete graph
K2n . The requirement for a tree to be symmetric is too restrictive as we show in the
next paragraph.
Example 8. In Fig. 7.6 is a symmetric graph with a -symmetric graceful labeling

drawn as a subgraph of K10 .
0
9 1
8 2
7 3
Fig. 7.6 Symmetric graph
with a -symmetric graceful 6 4
labeling 5
178 P. Kovář
Blended -Labeling
Blended -labeling (or blended labeling for short) was introduced by Fronček [12]
as a generalization of the -symmetric graceful labeling.
Definition 7. Let G be a graph with V .G/ D V0 [ V1 , V0 \ V1 D ;, and jV0 j D
jV1 j D r. Let be an injection, W Vi ! f0i ; 1i ; : : : ; .r 1/i g, i D 0; 1.
The pure length of an edge .xi ; yi / with xi ; yi 2 Vi , where i 2 f0; 1g, for
.xi / D pi and .yi / D qi is defined as
ì i .xi ; yi / D minfp q .mod r/; q p .mod r/g:
The mixed length of an edge .x0 ; y1 / with x0 2 V0 , y1 2 V1 , for .x0 / D p0

and .y1 / D q1 , is defined as
`01 .x0 ; y1 / D q p .mod r/;
where p; q 2 f0; 1; : : : ; r 1g are the vertex labels without subscripts. The edges
.xi ; yi / for i D 0; 1 with the pure length ì i are called pure edges and the edges
.x0 ; y1 / with the mixed length `01 are called mixed edges.
This concept of lengths can be extended to any equal-sized partite set

V 0 ; V1 ; : : : ; Vk .
Definition 8. Let G be a graph with 4n C 1 edges, V .G/ D V0 [ V1 , V0 \ V1 D ;,
and jV0 j D jV1 j D 2n C 1. Let be an injection, W Vi ! f0i ; 1i ; : : : ; .2n/i g,
i D 0; 1 and let the lengths be as defined in Definition 7.
We say G has a blended -labeling if
(1) fì i .xi ; yi /W .xi ; yi / 2 E.G/g D f1; 2; : : : ; ng for i D 0; 1
(2) f`01 .x0 ; y1 /W .x0 ; y1 / 2 E.G/g D f0; 1; : : : ; 2ng
Notice that in comparison to Definition 6 the requirement for T to be symmetric

is lifted. However, there is a restriction on the order of G to be 2 modulo 4.
The vertex set of the graph G with a blended labeling is decomposed into two
equal-sized partite sets V0 , V1 and G can be split into three subgraphs as follows:
two subgraphs H0 , H1 induced on the vertices of V0 , V1 , respectively, and a bipartite
graph H01 with partite sets V0 , V1 . The blended labeling restricted to the subgraphs
H0 , H1 can be viewed as a -labeling (after having omitted the subscripts). Each
of them guarantees a cyclic decomposition of a graph K2nC1 into n copies of H0
or H1 , respectively. The labeling of the subgraph H01 is then a bipartite -labeling
that allows a bicyclic decomposition of K2nC1;2nC1 into 2n C 1 isomorphic copies
of H01 . Hence the following theorem (for a proof see [12]).
Theorem 5. Let G with 4n C 1 edges have a blended -labeling. Then there exists
a bicyclic decomposition of K4nC2 into 2n C 1 copies of G.
Example 9. An example of a blended labeling of R1 is shown in Fig. 7.7.
Fig. 7.7 Blended labeling 00 01

of caterpillar R1
10 11
20 21
In a blended labeling all vertices in the “left” partite set V0 are always 00 ; 10 ; : : : ;
.2n 1/0 and in the “right” partite set V1 always 01 ; 11 ; : : : ; .2n 1/1 . Therefore
we can omit the labels in the figures.
Swapping Labeling
Swapping labeling was introduced by Kovářová in her Ph.D. thesis [22]. Unlike
blended labeling this labeling guarantees the factorization of complete graphs of
order 0 modulo 4. For a proof see [22].
Definition 9. A graph G with 4n1 edges has a swapping blended labeling (briefly
swapping labeling) if the following is satisfied. The vertex set V .G/ D V0 [ V1 ,
V0 \ V1 D ;, and jV0 j D jV1 j D 2n. Let be an injection, W Vi ! f0i ; 1i ; : : : ;
.2n 1/i g for i D 0; 1. Suppose the lengths are defined as in Definition 7, then
(1) fì i .xi ; yi /W .xi ; yi / 2 E.G/g D f1; 2; : : : ; ng, for i D 0; 1,
(2) there exists an isomorphism ' such that G is isomorphic to G 0 , where
V .G 0 / D V .G/ and E.G 0 / D E.G/ n f.k0 ; .k C n/0 /; .l1 ; .l C n/1 /g[
f.k0 ; .l C n/1 /; ..k C n/0 ; l1 /g,
(3) f`01 .x0 ; y1 /W .x0 ; y1 / 2 E.G/g D f0; 1; : : : ; 2n 1g n f`01 .k0 ; .l C n/1 /g.
Again the vertex set of G with a swapping labeling can be split into three sub-
graphs: H0 and H1 induced on V0 and V1 , respectively, and a bipartite subgraph
H01 with the partite sets V0 and V1 . The labelings of H0 and H1 induced by
have all different pure lengths (Condition (1)). The labeling of H01 induced
by gives edges of almost all different mixed lengths. Edges of mixed length
`01 .k0 ; .l C n/1 / D l C n k .mod 2n/ are missing (Condition (3)) among the
first n=2 factors. In the next n=2 factors the longest pure edges are removed from
the graphs H0 , H1 and edges of mixed length `01 .k0 ; .l C n/1 / are added to the
bipartite graph H01 .
Theorem 6. Let G be a graph on 4n vertices with 4n1 edges that has a swapping
blended labeling. Then there exists a G-decomposition of K4n into 2n isomorphic
copies of G.
If G is a spanning tree in K4n with a swapping labeling then by Theorem 6 it

factorizes K4n .
180 P. Kovář
Fig. 7.8 Caterpillar R3 and

a swapping labeling of R3
Fig. 7.9 R3 -factorization of K8 based on the swapping labeling
Example 10. The caterpillar R3 in Fig. 7.8 allows a swapping labeling. Figure 7.9
shows the four factors of K8 given by this labeling. Again we omit the vertex labels,
since they are implied by the drawing.
The switching labeling defined by Fronček and Kubesa in [16] also allows factor-
izations of K4n into isomorphic spanning trees. In comparison to swapping labeling
switching labeling is more restrictive since it requires certain strong automorphisms
that exist only for very special classes of trees.
2 n-Cyclic Labeling
So far the vertex set of G (as well as K2n ) was decomposed into two sets of size n.
For -symmetric labeling there is a strong automorphism required and for blended
labeling n has to be odd, for the swapping labeling n has to be even. Kovářová
in [22] approached the problem of factorizations of complete graphs into trees with
a given diameter by decomposing the vertex set into 2n partite sets Vi of size k.
This technique is designed for factorizations into “less dense” graphs with higher
diameter. Hence the following definitions.
Definition 10. A tree T is called an underlying tree of U if the graph U arises from
the tree T by blowing up two vertices r, s of T by Kk and all the remaining vertices
by K k D kK1 . Every edge of the tree is replaced by the edges of Kk;k .
Definition 11. Let G beSa graph with 2nk 1 edges, for k odd and k; n > 1, and
the vertex set V .G/ D i2n1D0 Vi , where jVi j D k and Vi \ Vj D ; for i 6D j .
Let be an injection, W Vi ! f0i ; 1i ; 2i ; : : : ; .k 1/i g, for i D 0; 1; : : : ; 2n 1.
By Hij we denote the bipartite subgraph of G induced on the vertices of the partite
sets Vi and Vj with edges of mixed length ìj , and by Hi we denote the subgraph
of G induced on the vertices of Vi with edges of pure length ì i .
We say that G has a 2n-cyclic blended labeling (2n-cyclic labeling for short)
if there exists an underlying tree T on 2n vertices with a -symmetric graceful
labeling such that the following hold:
(1) For some vertex s 2 T and its symmetric image t D s C n .mod 2n/ we have
f`ss .xs ; ys /W .xs ; ys / 2 E.Hs /g D f1; 2; : : : ; .k 1/=2g; and

f`t t .xt ; yt /W .xt ; yt / 2 E.Ht /g D f1; 2; : : : ; .k 1/=2g;
(2) and for each edge .i; j / 2 E.T / we have
fìj .xi ; yj /W .xi ; yj / 2 E.Hij /g D f0; 1; 2; : : : ; k 1g:
Notice that after omitting subscripts the labelings induced on Hs and Ht are
-labelings and the labelings induced on all bipartite graphs Hij are bipartite -
labelings. In [13] the following theorem is proven.
Theorem 7. Let G with 2nk 1 edges be a graph that allows a 2n-cyclic blended
labeling for k odd and k; n > 1. Then there exists a G-decomposition of K2nk into
nk copies of G.
Fixing Labeling
By relaxing the condition of having a bipartite -labeling in each Hij (as introduced
in the previous paragraph) and requiring that all vertices in one of the partite sets,
say Vi , are always of degree one, we obtain fixing labeling as it was introduced
by Kovářová in [21]; see Fig. 7.10. Therefore fixing labeling is more general than
2n-cyclic labeling.
G be a graph with 2nk 1 edges, for k odd and k; n > 1, and
Definition 12. Let S
vertex set V .G/ D i2n1
D0 Vi , where jVi j D k and Vi \ Vj D ; for i 6D j . Let be
rotated vertex
fixed vertex
Fig. 7.10 Factorizing K5;5

by fixing labeling
182 P. Kovář
an injection, W Vi ! f0i ; 1i ; 2i ; : : : ; .k 1/i g, for i D 0; 1; : : : ; 2n 1. By Hij

we denote the bipartite subgraph of G induced on the vertices of the partite sets Vi
and Vj with edges of the mixed length ìj , and by Hi we denote the subgraph of G
induced on the vertices of Vi with edges of the pure length ì i . We say that G has a
fixing labeling if there exists an underlying tree T on 2n vertices with a -symmetric
graceful labeling such that the following hold:
(1) For some vertex s 2 T and its symmetric image t D s C n .mod 2n/ we have
f`ss .xs ; ys /W .xs ; ys / 2 E.Hs /g D f1; 2; : : : ; .k 1/=2g; and

f`t t .xt ; yt /W .xt ; yt / 2 E.Ht /g D f1; 2; : : : ; .k 1/=2g:
(2) Let F D fi 2 T W i 6D s; i 6D s C n I deg.xi / D 1 for each xi 2 Hij and

j 2 N.i /g, then F is the set of fixable vertices in T for given G, and each
vertex i in F is called fixable. Let VF be any independent set of fixable vertices
in T called the fixed set. A vertex i 2 VF is called a fixed vertex.
Then for every edge .i; j / 2 E.T / i or j is one of the fixed end-vertices or
fìj .xi ; yj /W .xi ; yj / 2 E.Hij /g D f0; 1; 2; : : : ; k 1g:
Notice that if neither i nor j is a fixed vertex then the labeling of Hij induced
by is a bipartite -labeling. Fixing labeling has been used in several papers (see
Sect. 7.3) for spanning tree factorizations of complete graphs based on the next the-
orem proved in [21].
Theorem 8. Let a graph G with 2nk 1 edges, for k odd and k; n > 1, have a
fixing blended labeling. Then there exists a G-decomposition of K2nk into nk
copies of G.
Example 11. In Fig. 7.11 is shown a symmetric tree T on 10 vertices with a

symmetric -labeling (T factorizes K10 ). Fixable vertices and fixed vertices are
highlighted in Fig. 7.12.
In Fig. 7.13 is a tree on 30 vertices that allows a fixing labeling. By adopting the
convention, that the “level” i , 0 i 2, stands for the vertex label and the partite
set subscript stands for the label subscript, the labeling is implied by the drawing
in Fig. 7.13.
Both 2n-cyclic labeling and fixing labeling require the underlying tree to be sym-
metric and the number of vertices in each partite set Vi to be equal to the same odd
number. The second restriction can be relaxed; see Sect. 7.2.
4 1 6 9
5 0
Fig. 7.11 Underlying tree T 2 3 8 7
with a symmetric -labeling
Fig. 7.12 Fixable and fixed

vertices in T fixable vertex
fixed vertex
Fig. 7.13 Example of a

fixing labeling of a tree
on 30 vertices
7.2 Advanced Methods
There is no necessary and sufficient condition for a T -factorization of a complete

graph. Besides constructing additional classes of trees that factorize a complete
graph it is natural to give a necessary condition for certain classes of trees. We say
that a class of trees is classified if for each tree Tn in this class we know whether
it factorizes the corresponding complete graph Kn (by labeling the tree) or it is
shown that it cannot factorize Kn (such as paths or symmetric trees mentioned
in Sect. 7.1.6). To achieve this classification more elaborate techniques are often
needed. We present them here.
7.2.1 N-Z Construction
In [14] a recursive construction was used to obtain a classification of all caterpillars

of diameter 5. This technique is based on factorizing K2n into highly regular graphs
and each of them further factorizing into a tree T . Here we give a short introduction
to the method.
Definition 13. Let G1 ; G2 ; : : : ; Gn be a G-factorization of K2n induced by the iso-
morphisms j ; Gj D j .G/ for j D 1; 2; : : : ; n. We call a vertex v semisurjective
if there exists a partition V0 , V1 , jV0 j D jV1 j D n, of the vertex set V .K2n / such
that either fj .v/W j D 1; 2; : : : ; ng D V0 or V1 . We call the G-factorization of K2n
semisurjective if every vertex of G is semisurjective and the G-factorization is called
weakly semisurjective if every nonleaf vertex of G is semisurjective.
Observe that if G has a blended labeling, then the G-factorization is semisurjec-
tive. This follows from the fact that the factorization is bicyclic. Fixing labeling of
G gives in general a weakly semisurjective G-factorization. None of the above is
184 P. Kovář
true in general for swapping labeling, but for certain graphs it is possible to obtain
swapping labelings that give weakly semisurjective factorizations.
The main idea is to reduce the graph G 0 (a caterpillar or a lobster; see [14,15]) on
2n C 2m vertices into two smaller graphs, one on 2n vertices and the second on 2m
vertices, usually both with the same diameter. Let us focus on the first possibility
reducing G 0 to G on 2n vertices; the second is done analogously. In the reduction
we remove 2m leaves v1 ; v2 ; : : : ; vm and u1 ; u2 ; : : : ; um to obtain a graph on 2n ver-
tices. Suppose we have a semisurjective (or weakly semisurjective) G-factorization
of K2n with vertex partition V0 ; V1 , both Vi of size n. Having all the vertices
v1 ; v2 ; : : : ; vm in G 0 adjacent to vertices of V0 and all the vertices u1 ; u2 ; : : : ; um
adjacent to vertices in V1 we have reduced G 0 to G.
To achieve this reduction in general, we define the following.
Definition 14. Let N be the graph obtained from P4 with vertices y0 ; x0 ; x1 ; y1
and edges y0 x0 ; x0 x1 ; x1 y1 by blowing up the inner vertices x0 ; x1 by Kn the end-
vertices y0 ; y1 by K m D mK1 . The edge x0 x1 of P4 is replaced by Kn;n and the
edges y0 x0 ; x1 y1 of P4 are replaced by the edges of Km;n and Kn;m , respectively.
The vertex set of N is then V .N / D Y0 [ X0 [ X1 [ Y1 , where jX0 j D jX1 j D n,
jY0 j D jY1 j D m, and jV .N /j D 2n C 2m.
Similarly let Z be the graph obtained from P40 with vertices x0 ; y1 ; y0 ; x1 and
edges x0 y1 ; y1 y0 ; y0 x1 by blowing up the inner vertices y0 ; y1 of P40 by Km and
the end-vertices x0 ; x1 by K n D nK1 . The edge y1 y0 of P40 is replaced by Km;m
and the edges x0 y1 ; y0 x1 of P40 are replaced by the edges of Kn;m and Km;n ,
respectively.
The vertex set of Z is then the same as the vertex set of N , V .Z/ D V .N /.
It is easy to observe that the graphs N and Z factorize the complete graph
K2nC2m into factors N and Z which may or may not be isomorphic (depending
on whether m D n); see Fig. 7.14. We omit the proof.
Lemma 1. If a graph G decomposes both graphs N and Z then G decomposes the
complete graph K2nC2m .
Each of the graphs N and Z can be further factorized into isomorphic factors.
The reduction is indeed the key step in a recursive method described in detail in [14].
The inductive step is based on m, therefore we try to keep m as small as possible. To
prove the base for the induction a long list of graphs, called starting cases, of
relatively small size up to a certain value had to be shown to factorize (weakly)
semisurjectively the corresponding complete graph. This required a rather elaborate
approach; see [14, 15].
7.2.2 Limitations
The use of the method for a G-factorization of complete graphs described in

Sect. 7.2.1 is limited. The inductive step goes either by m or by n and naturally
N
X0 X1
Y0 Y1
P4
x0 y1
y0 x1
X0 X1
Z
Y1 Y0
P⬘4
x0 y1
y0 x1
Fig. 7.14 Graphs N and Z for n D 5 and m D 3
we choose the smaller value, say m. Depending on the examined class of graphs the
list of starting cases can already be, for m D 3 or m D 5, considerably long. For
each of these graphs a labeling that guarantees factorization has to be found. Various
labelings have to be used for various base graphs; the choice of labeling depends on
the parity of n. In Sect. 7.4 we try to propose a unified and a more general approach.
Moreover, the recursion described in Sect. 7.2.1 strongly depends on the structure
of the graphs N and Z. They are both of diameter 3; this may be a restriction on the
structure of G.
7.3 Overview of Known Results
Among all graph factorizations we focus on spanning tree factorizations of complete

graphs. For other classes of graphs we refer to [3, 6].
7.3.1 Trees
The decomposition of complete graphs has attracted attention for more than four
decades. This research was definitely inspired by the famous conjecture by Ringel
in 1963 saying that every tree with m edges decomposes the complete graph K2mC1 .
Kotzig extended this conjecture saying that all trees are graceful; see, e.g., [35]. For
an up-to-date survey of results on graceful and -labelings see [17].
186 P. Kovář
In this chapter we focus not on tree-decompositions in general, but on the special

case of tree-factorizations. Decompositions into smaller trees or spanning trees of
small diameters but not necessarily isomorphic were examined in [4, 5, 30].
In contrary to the search for graceful labelings of graphs the area of span-
ning tree factorization remained fairly unexplored, save the well-known Hamilto-
nian path factorization and the factorization into symmetric double-stars. In 1997,
Eldergill [8] in his masters thesis, gave a necessary and sufficient condition for the
existence of a cyclic factorization of K2n into symmetric spanning trees (for a defi-
nition see page 177). He introduced -symmetric graceful labelings and symmetric
graceful labelings and classified all trees of order 10.
Another step was made by Fronček [10,12], who introduced blended -labelings.
By the method of blended -labelings he found a wider class of trees on 4n C 2 ver-
tices that factorize the corresponding complete graph. In [16] the switching blended
labeling was introduced for factorizations of complete graphs on 4n vertices by
Fronček and Kubesa. Both switching blended labeling and -symmetric graceful la-
beling require strong types of automorphisms of the factorizing graph. This narrows
down the class of permissible trees.
More special classes of spanning trees were shown to factorize K4nC2 in [10,25]
using the methods mentioned above. A spanning tree of any diameter that factorizes
K4nC2 was found by Fronček in [12]. This result was completed in 2004 for K4n
by Kovářová in [20]. Among the most general results so far is the classification of
caterpillars with diameter 4 (in a series of papers by Fronček [11], Kubesa [24, 25])
that was completed later by Kovářová [21, 22]. The classification of caterpillars
of diameter 5 was proved through the years in a series of papers by Kubesa [23,
24, 26–28] and finally completed in [14] by Fronček et al. The constructions of
labelings of caterpillars with diameter 5 become technical; many subclasses need to
be considered separately.
During the years 2002–2004 the methods (graph labelings) evolved. Fronček and
Kovářová defined the 2n-cyclic labeling (in [13]), then Kovářová defined fixing
labeling (in [21]) and swapping labeling (in [22]) to cover the various cases.
The classification of all trees with at most four nonleaf vertices was completed
in [15]. Vetrı́k in [34] found some caterpillars of diameter 6 that factorize the corre-
sponding complete graph. The classification of caterpillars for diameters 3, 4, 5 and
lobsters with four nonleaf vertices is complete since structural necessary conditions
were proven by Fronček in [11] and by Fronček et al. in [15]. For example, for the
trees with at most four nonleaf the following was shown in [15].
Theorem 9. Let T be any tree with exactly four nonleaf vertices v1 , v2 , v3 and v4
such that deg.v1 / deg.v2 / deg.v3 / deg.v4 / 2. If T factorizes K2n then
(i) either deg.v1 / D n and deg.v2 / C deg.v3 / C deg.v4 / D n C 2,
(ii) or deg.v1 / C deg.v4 / D deg.v2 / C deg.v3 / D n C 1.
The problem of spanning tree factorization of complete bipartite graphs Km;n

was positively answered by Shibata and Seki in [32] and independently by El-Zanati
and Vanden Eynden in [9]. For all positive integers m; n, where m C n 1 divides
mn, there exists a spanning tree factorization of Km;n .
The general problem of finding a factorization for a given spanning tree remains
far from being solved.
7.3.2 Disproof of Kubesa’s Conjecture
Suppose there exists a T -factorization of K2n . The observation that for symmet-
ric graceful labeling, blended labeling, swapping labeling, and fixing labeling in
general and for any known example it was always possible to split the vertex set
of T into two equal-sized partite sets so that the sum of degrees was the same in
each partite set led Kubesa to the conjecture that this is a necessary condition for a
T -factorization. This conjecture was disproven by Meszka [29] who found an infi-
nite class of trees factorizing a complete graph but not allowing such a partitioning
of the vertex set. The smallest counterexample has 56 vertices.
On the other hand Tan [33] showed that the conjecture holds for trees such that:
(1) the tree T has at most three different degrees or (2) the maximum degree .T /
is at most 4 or at least n 3.
7.3.3 Packings, Coverings, and Orthogonal Double Covers
Both G-decompositions and G-factorizations require every edge of the decomposed

complete graph to appear in precisely one copy of G. This restriction can be relaxed
in two ways. Requiring every edge of K2n to appear in at most one G results in a
packing of G into K2n . For a survey of results we refer to [36]. On the other hand
if every edge of G has to appear in at least one copy of G we talk about covering
K2n by G. Moreover if every edge of Kn is covered by precisely two subgraphs
and any two subgraphs share exactly one edge we talk about an orthogonal double
cover; see [19]. Usually there are additional requirements on both the coverings or
packings. There are a number of results; we refer the reader to [6].
7.4 Recursive Construction
In this section we describe a method that generalizes all of the methods for a
G-factorization of K2n presented in Sect. 7.1. We start by defining/redefining some
terms. Later in this section the method of recursive labeling is presented and in the
last part examples are given.
188 P. Kovář
7.4.1 About the Method
First we introduce a few terms to simplify the description. A permutation of a set

A is a bijection W A ! A. By we denote the identity permutation and by ˛k the
cyclic permutation of the set Vi D f0i ; 1i ; 2i ; : : : ; .k1/i g given by ˛k .ai / D .aC1
.mod k//i for any ai 2 Vi , where i is an integer and 0 a k 1.
Definition 15. Given an (underlying) tree T on 2n vertices, two vertices r, s in

T , and a positive integer k we can construct the blown-up graph U ŒT I kI r; s . We
replace the vertices r, s by Kk , and each vertex i 2 V .T /, i ¤ r; s by K k . Such
a blown-up vertex i we denote by Hi . Every edge ij 2 E.T / is replaced by a
complete graph Kk;k denoted by Hij .
Example 12. In Fig. 7.15 is shown the caterpillar T ' R1 with two vertices r, s
chosen. Below is a blown-up graph U ŒT I kI r; s for k D 3.
The vertices r, s in the definition cannot be chosen arbitrarily. If T factorizes

K2n we require r, s to be mapped to each vertex of K2n throughout the factors. In
a bicyclic factorization such pairs of vertices always exist.
Definition 16. Let G1 ; G2 ; : : : ; Gn be a G-factorization of K2n induced by the iso-

morphisms j ; Gj D j .G/ for j D 1; 2; : : : ; n. A pair of vertices x; y 2 G is
called a semisurjective pair if fj .x/W j D 1; 2; : : : ; ng D Vx , fj .y/W j D
1; 2; : : : ; ng D Vy , where Vx \ Vy D ;, and Vx [ Vy D V .K2n /.
If is a vertex labeling of U ŒT I kI r; s , it will be useful to work with a restriction

of to the vertex set of Hi or Hij , respectively.
Definition 17. Let be a vertex labeling of U ŒT I kI r; s . We say the labeling i W

Hi ! f0i ; 1i ; : : : ; .k 1/i g is induced by if i .v/ D .v/ for all v 2 V .Hi /.
Similarly the labeling ij W Hij ! f0i ; 1i ; : : : ; .k 1/i ; 0j ; 1j ; : : : ; .k 1/j g is
induced by if ij .v/ D .v/ for all v 2 V .Hij /.
r s
b
Fig. 7.15 (a) An underlying tree T ; (b) a blown-up graph U ŒT I kI r; s

The labeling introduced below extends features of the fixing labeling described
in Sect. 7.1.6. We rewrite the definition of fixable and fixed vertices of T . By N.v/
we denote the set of vertices adjacent to v.
Definition 18. Let T be a tree on 2n vertices; let r; s be distinct vertices in T and
k a positive integer. Let G be a subgraph in U ŒT I kI r; s . If F is a set of vertices in
T such that
˚
F D i 2 V .T /W i ¤ r; s where degG .xi / D 1 8xi 2 V .Hij / and 8j 2 N.i / ;
then F is called a set of fixable vertices in T for a given G. All vertices in F are
called fixable. Let VF F be any set of vertices that are independent in T . We call
VF a fixed set and all vertices i 2 VF we call fixed vertices.
We point out that in comparison to the previous Definition 12, in Definition 18,
the requirement of T being symmetric has been lifted. For an example see Fig. 7.16.
Now we can define a new labeling that we will use to factorize complete graphs
into spanning trees.
Definition 19. Suppose T factorizes the complete graph K2n and r, s form a
semisurjective pair of vertices in T . Let G be a graph with 2nk 1 edges, n; k > 0,
and the vertex set
V .G/ D [i2n1
D0 Vi ; where jVi j D k and Vi \ Vj D ; for i ¤ j :
Let VF be a set of fixed vertices in T for the graph G; VF may be empty.
fixing
r r
a
bip. r bip. r fixing fixing
r s
bip. r
b
fixing swapping bip. r fixing
r s
Fig. 7.16 The idea of recursive labeling: (a) for k odd; (b) for k even
190 P. Kovář
We say G has a recursive labeling if there exists an injection W Vi !

f0i ; 1i ; : : : ; .k 1/i g for all i D 0; 1; : : : ; 2n 1 such that the induced labelings
have the following property.
For k odd
(1) the labeling ij induced on Hij , for all ij 2 E.T /, is either a bipartite
labeling or one of the vertices i , j is a fixed vertex in T (for a nonempty
VF ),
(2) the labelings r and s induced on Hr and Hs are -labelings.
For k even
(1) the labeling ij induced on Hij ; for all ij 2 E.T /, ij ¤ rs, is either a
bipartite labeling or one of the vertices i; j is a fixed vertex in T (for a
nonempty VF ),
(2) the edge rs 2 E.T / and the labeling rs induced on Hrs along with the
edges of Hr and Hs is a swapping labeling.
For short we denote the graph Hrs along with the edges of Hr and Hs by Hrs [
Hr [ Hs .
7.4.2 The Method of Recursive Labeling
To avoid technical details in the proof of the following theorem we use properties of
known labelings. First we prove two lemmas. Why we split the proof into lemmas
becomes apparent in the last subsection.
Lemma 2. Let G be a graph with 2nk 1 edges, n; k > 1, that allows a recursive
labeling. Then there exists a G-decomposition of U ŒT I kI r; s into k copies of G.
Proof. We have to show that we can find k factors G1 ; G2 ; : : : ; Gk that factorize

the graph U ŒT I kI r; s and that they are all isomorphic.
Suppose G is a graph with 2nk 1 edges that allows a recursive labeling . Let
VF be the set of fixed vertices of T for the recursive labeling . We can construct the
graphs G1 ; G2 ; : : : ; Gk in the following way. Take V .Gt / D V .G/, t D 1; 2; : : : ; k,
and
E.Gt / D fit .xi /jt .yj /W xi 2 Vi and yj 2 Vj and xi yj 2 E.G/g
where each i is a bijection on the set f0i ; 1;i ; : : : ; .k 1/i g defined by

(
.x C 1 .mod k//i if i 62 VF
i .xi / D
xi if i 2 VF
for all i D 0; 1; : : : ; 2n1. Notice that if i 2 VF then i D . The power it denotes
the t-th composition i ı i ı : : : ı i . Obviously all graphs Gt for t D 1; 2; : : : ; k
are isomorphic to G since it .xi /jt .yj / 2 E.Gt / , xi yj 2 E.G/.
To show that G1 ; G2 ; : : : ; Gk form a G-factorization of U ŒT I kI r; s it is enough
to show that every edge of U ŒT I kI r; s appears in some copy Gt . By the definition
of recursive labeling each ij (the restriction of to a Hij if ij 2 T ) is for k odd
either a bipartite labeling if i; j 62 VF or a fixing labeling of a bipartite graph if
i 2 VF and j 62 VF . The restrictions r to Hr and s to Hs give a -labeling. The
factors are obtained by i ; j as shown in the proofs of Theorems 3, 2, and 8. For k
even the reasoning similar is. All edges of Hrs , Hr , and Hs appear in some Gt by
Theorem 6. t
u
We require k > 1 otherwise G ' T and the task is trivial and n > 1 since there
have to be at least two partite sets in U ŒT I kI r; s .
Lemma 3. Let T be a tree that factorizes K2n and let r; s be a semisurjective pair
of vertices in T . Then U ŒT I kI r; s factorizes K2nk into k isomorphic copies of
U ŒT I kI r; s .
Proof. Let T1 ; T2 ; : : : ; Tn be a T -factorization of K2n . Obviously since T factor-

izes K2n , the blown-up graph T ŒK k factorizes the complete multipartite graph
K2n ŒK k ' Kk;k;:::;k . Now each U ŒTi I kI r; s , i D 1; 2; : : : ; n, contains besides the

edges of Ti ŒK k also 2 k2 edges of two Kk in the partite sets Vr and Vs . Since ver-
tices r; s are a semisurjective pair, each partite set Vi for i D 0; 1; : : : ; 2n 1 will be
blown up by Kk in exactly one copy of U ŒT I kI r; s . This completes the proof. u t
Theorem 10. Let a graph G with 2nk 1 edges, n; k > 1, allow a recursive
labeling. Then there exists a G-decomposition of K2nk into nk copies of G such
that if x; y is a semisurjective pair of vertices in T with a fixed set VF , then all
pairs ix ; jy , ix 2 Vx , jy 2 Vy for i; j D 0; 1; : : : ; k 1 form a semisurjective pair
in G for k odd if x; y 62 VF and for k even if x; y 62 .VF [ fr; sg/.
Proof. By Lemma 2 the graph G decomposes U ŒT I kI r; s . Let T be the underlying

tree of U ŒT I kI r; s . Since T factorizes K2n (by the definition of U ŒT I kI r; s ) then
U ŒT I kI r; s factorizes K2nk into k isomorphic copies as shown in Lemma 3. Thus
G decomposes K2nk into nk isomorphic copies.
Now it remains to examine the semisurjective pairs. Since vertices x; y are a
semisurjective pair in T , then by definition Vx D fi .x/W i D 0; 1; : : : ; n 1g,
Vy D fi .y/W i D 0; 1; : : : ; n 1g, Vx \ Vy D ;, and jVx j D jVy j D n.
Now each vertex x of T , x 62 VF is taken by the permutation x through exactly
k vertices 0x ; 1x ; : : : ; .k 1/x in Vx . Thus x is semisurjective and having a semisur-
jective pair x; y in T , the pairs ix ; jy are semisurjective for all i; j D 0; 1; : : : ; k 1.
However, this is not true in general for all vertices in Vr ; Vs for k even when rs
induced on Hrs is a swapping labeling. The proof is complete. t
u
192 P. Kovář
Notice that for k even some vertices of G such that rs is a swapping labeling of
Hrs [ Hr [ Hs may also be a semisurjective pair.
Corollary 1. If the graph G with 2nk 1 edges is a tree, then the G-decomposition
becomes a G-factorization of K2nk .
Now it should be clear why we call such labeling recursive. If G is a tree it can
become an underlying tree T 0 ' G of a larger graph U ŒT 0 I k 0 I r 0 ; s 0 for some inte-
ger k 0 and a semisurjective pair r 0 ; s 0 in T 0 . The vertices r 0 ; s 0 exist by Theorem 10.
7.4.3 Examples
Example 13. In [14] it was shown that the caterpillar R4 in Fig. 7.17 factorizes
the complete graph K8 . R4 has a symmetric -labeling, but it does not have a
swapping labeling. A recursive labeling of R4 is given in Fig. 7.18. Both factors
of U ŒP4 I 2I r; s are given below. The underlying graph is P4 , which factorizes K4
so that the two nonleaf vertices form a semisurjective pair; see Fig. 7.14. The vertex
labels are implied by the drawing by adopting the convention from Example 11 and
choosing a fixed set VF containing both leaves of P4 .
Example 14. It may seem that the lobster in Fig. 7.19 has a recursive labeling.
Indeed the labeling induced on H01 [ H0 [ H1 is a swapping labeling, the labeling
induced on H12 is a bipartite -labeling, and we are fixing the vertices in V3 . Also
the underlying graph P4 factorizes K4 as in the previous example. But the pair of
vertices r (a leaf) and s (nonleaf) of P4 is not a semisurjective pair in P4 . In fact it
was shown in [15] that this lobster does not factorize K8 at all. The proof is rather
technical and is based on a careful examination of adjacent nonleaf vertices and
counting edges among these vertices and adjacent leaves.
Fig. 7.17 Caterpillar R4 and r s

the underlying tree P4
a V0 V1 V2 V3
Fig. 7.18 Caterpillar R4 : (a) recursive labeling; (b) two factors

Fig. 7.19 A lobster that r s

does not factorize K8 and its
underlying tree
V0 V1 V2 V3
Notice that if T with m edges either decomposes or factorizes K2n then in

general it does not necessarily decompose K2nk , since there are m edges in T and
m divides n.2n 1/, but there are nk.2nk 1/ edges in K2nk and m does not
necessarily divide nk.2nk 1/.
7.4.4 Comparison to Previously Defined Labelings
The recursive labeling from Sect. 7.4.1 extends both of the most general methods
(fixing and swapping labelings) known so far for spanning tree factorizations of
complete graphs. In comparison to fixing labeling the underlying graph T does not
have to be symmetric. Taking a symmetric underlying graph and restraining k to odd
values the recursive labeling becomes a fixing labeling. Taking n D 1 (two partite
set V0 and V1 ) the recursive labeling becomes for k even a swapping labeling and
for k odd a blended labeling.
Moreover, the pairs of semisurjective vertices are specified. Thus by finding a
recursive labeling of some tree G (not a general graph G if we require connectivity)
we can easily proceed by blowing it up again and searching for recursive labeling of
the blown-up graph as well. Or we can use such a method similarly as in Sect. 7.2
and in certain cases “reduce” a given tree G to smaller trees and search for recursive
labeling of the smaller graph. Then G will also have a recursive labeling by the
second part of Theorem 10.
7.5 Conclusion
The problem of spanning tree factorization of complete graphs has been studied
for more than 10 years. No necessary and sufficient condition is known for a tree
to allow such factorization and no such easy condition is expected to exist. There
are several methods used to find factorizations; in this chapter we gave a more gen-
eral approach combining most of the previously introduced concepts. Yet a complete
classification of all trees whether they do or do not factorize the corresponding com-
plete graph is far from being solved. On the other hand the presented techniques can
be used not only for trees, but also for general graphs.
194 P. Kovář
7.5.1 Further Possible Generalizations
There were several assumptions made during the description of recursive labeling,
that in some cases can be lifted and still a decomposition or a factorization of the
complete graph K2nk will be obtained. We list them here.
The permutations i used for cyclic decompositions do not have to be cyclic.
This would lead to a more general statement in Lemma 2 whereas Lemma 3 and
Theorem 10 would remain unchanged.
The underlying graph T does not have to be a tree. However if T is not spanning,
we cannot obtain a G-factorization of K2nk . On the other hand, if T is spanning
and contains more then 2n1 edges, then more than two vertices of T have to be
replaced by Kk in the process of blowing up. This would result in modification
of Lemma 3. Hence also the definition of U ŒT I kI r; s has to be modified and
the notion of a semisurjective set has to be introduced. This would lead only to a
slight modification of Theorem 10.
For carefully picked underlying trees and their copies one can use this method
not only for decomposition of complete graphs but also of other graphs. On the
other hand, one should not expect this method to give general results.
7.5.2 Further Extensions
The firefighters network is usually overdesigned. In idle time we can perform net-
work measuring for each possible connection between two units, and compute and
broadcast reliabilities for each connection. Based on this a weighted complete graph
can be constructed. The zero weight stands for a connection loss between a pair of
units. Now the reliability for each of the precomputed factors can be obtained and
among all the factors in the list we can instantly pick the “best.” We can expect that
this network will have the longest operational time.
Another enhancement may lay in permuting the vertex set prior choos-
ing a particular factor. If it is apparent from the measured data that one unit
has a weak connection to many units (this unit may have strained from the
group), we can reorder the IDs of the vertices so that this particular vertex
forms a leaf in the most reliable factors. Hereby we enforce a more stable
network.
The proposed method can be used also for large-scale networks, both locally and
globally. We can also use various factors on subnets of a larger net, e.g., on a set
of relatively close vertices. The main advantage is to control the diameter and a
bounded maximal degree. This can be subject to further research.
Acknowledgments Supported by the Ministry of Education of the Czech Republic Grant

No. MSM6198910027. The author wants to thank the anonymous referees, whose comments
helped in improving the quality of this chapter.
References
1. Alspach B, Gavlas H (2001) Cycle decompositions of Kn and Kn I . J Combin Theory B

81:77–99
2. Bloom GS (1979) A chronology of the Ringel-Kotzig conjecture and the continuing quest to
call all trees graceful. In: Topics in graph theory. The New York Academy of Sciences
3. Bosák J (1986) Decompositions of graphs. VEDA, Bratislava
4. Bosák J, Erdös P, Rosa A (1972) Decompositions of complete graphs into factors with diameter
two. Mat časopis Slov akad vied 22:14–28
5. Bosák J, Rosa A, Znám Š (1968) On decompositions of complete graphs into factors with given
diameters. In: Theory of Graphs (Proc Colloq Tihany 1966), Akademiai Kiadó, Budapest,
pp 37–56
6. Colbourn CJ, Dinitz JH (eds) (2007) The CRC handbook of combinatorial designs, 2nd edn.
Discrete mathematics and its applications. CRC press, Boca Raton
7. Diestel R (2006) Graph theory, 3rd edn. Springer, Berlin Heidelberg
8. Eldergill P (1997) Decompositions of the complete graph with an even number of vertices.
M.Sc. thesis, McMaster University, Hamilton
9. El-Zanati S, Vanden Eynden C (1999) Factorizations of Km;n into spanning trees. Graph Com-
binator 15:287–293
10. Fronček D (2004) Cyclic decompositions of complete graphs into spanning trees. Discuss Math
Graph Theory 24(2):345–353
11. Fronček D (2006) Note on factorizations of complete graphs into caterpillars with small diam-
eters. JCMCC 57:179–186
12. Fronček D (2007) Bi-cyclic decompositions of complete graphs into spanning trees. Discrete
Math 307:1317–1322
13. Fronček D, Kovářová T (2007) 2n-cyclic blended labeling of graphs. Ars Combinatoria
83:129–144
14. Fronček D, Kovář P, Kovářová T, Kubesa M (2010) Factorizations of complete graphs into
caterpillars of diameter 5. Discrete Math 310:537–556
15. Fronček D, Kovář P, Kubesa M Factorizations of complete graphs into trees with at most four
non-leave vertices, (submitted)
16. Fronček D, Kubesa M (2002) Factorizations of complete graphs into spanning trees. Congr
Numer 154:125–134
17. Gallian JA (2003) A dynamic survey of graph labeling. Electron J Combinator DS6
18. Golomb SW (1972) How to number a graph, in graph theory and computing. In: Read RC (ed)
Academic, New York, pp 23–37
19. Gronau H-DOF, Grütmüller M, Hartman S, Leck U, Leck V (2002) On orthogonal double
covers of graphs. Design Code Cryptogr 27:49–91
20. Kovářová T (2005) Decompositions of complete graphs into isomorphic spanning trees with
given diameters. JCMCC 54:67–81
21. Kovářová T (2004) Fixing labelings and factorizations of complete graphs into caterpillars with
diameter four. Congr Numer 168:33–48
22. Kovářová T (2004) Spanning tree factorizations of complete graphs. Ph.D. thesis, VŠB –
Technical University of Ostrava
23. Kubesa M (2004) Factorizations of complete graphs into [n,r,s,2]-caterpillars of diameter 5
with maximum center. AKCE Int J Graph Combinator 1(2):135–147
24. Kubesa M (2004) Factorizations of complete graphs into caterpillars of diameter four and five.
Ph.D. thesis, VŠB – Technical University of Ostrava
25. Kubesa M (2005) Spanning tree factorizations of complete graphs. JCMCC 52:33–49
26. Kubesa M (2005) Factorizations of complete graphs into [r,s,2,2]-caterpillars of diameter 5.
JCMCC 54:187–193
27. Kubesa M (2006) Factorizations of complete graphs into [n,r,s,2]-caterpillars of diameter 5
with maximum end. AKCE Int J Graph Combinator 3(2):151–161
196 P. Kovář
28. Kubesa M (2007) Factorizations of complete graphs into [r,s,t,2]-caterpillars of diameter 5.

JCMCC 60:181–201
29. Meszka M (2008) Solution to the problem of Kubesa. Discuss Math Graph Theory 28:375–378
30. Palumbı́ny D (1973) On decompositions of complete graphs into factors with equal diameters.
Boll Un Mat Ital 7:420–428
31. Rosa A (1967) On certain valuations of the vertices of a graph. In: Theory of graphs (Intl Symp
Rome 1966), Gordon and Breach, Dunod, Paris, pp 349–355
32. Shibata Y, Seki Y (1992) The isomorphic factorization of complete bipartite graphs into trees.
Ars Combinatoria 33:3–25
33. Tan ND (2008) On a problem of Fronček and Kubesa. Australas J Combinator 40:237–245
34. Vetrı́k T (2006) On factorization of complete graphs into isomorphic caterpillars of diameter
6. Magia 22:17–21
35. West DB (2001) Introduction to graph theory, 2nd edn. Prentice-Hall, Upper Saddle River, NJ
36. Yap HP (1988) Packing of graphs – a survey. Discrete Math 72:395–404
Chapter 8
Geodetic Sets in Graphs
Boštjan Brešar, Matjaž Kovše, and Aleksandra Tepeh
Abstract Geodetic sets in graphs are briefly surveyed. After an overview of earlier
results, we concentrate on recent studies of the geodetic number and related invari-
ants in graphs. Geodetic sets in Cartesian products of graphs and in median graphs
are considered in more detail. Algorithmic issues and relations with several other
concepts, arising from various convex and interval structures in graphs, are also
presented.
Keywords Geodetic number Geodetic set Cartesian product Median graph

Boundary set
MSC2000: Primary 05C12; Secondary 05C99
8.1 Introduction
In this chapter by the notion of a graph we usually mean an undirected graph with-
out loops or multiple edges. The only exception is in Sect. 8.6 where directed graphs
are also briefly considered. As usual, V .G/ and E.G/ denote the vertex and the
edge sets of a graph G, respectively. Unless stated differently n and m denote the
number of vertices and number of edges of a graph, respectively. We start by for-
mally defining the most basic concepts.
The length of a path is the number of its edges. Let u and v be vertices of a
connected graph G. A shortest u; v-path is also called a u; v-geodesic. The (shortest
path) distance is defined as the length of a u; v-geodesic in G and is denoted by
dG .u; v/, or d.u; v/ for short if the graph is clear from the context. The correspond-
ing metric space is also called graphic metric space, associated with the graph G; see
[40]. The eccentricity of a vertex v of a graph G is the maximum distance between v
and any other vertex of G. The diameter of G, denoted by diam.G/, is the maximum
A. Tepeh ()
University of Maribor, FEECS, Smetanova 17, 2000 Maribor, Slovenia

198 B. Brešar et al.
eccentricity of vertices in G, and the radius is the minimum such eccentricity. The
(geodesic) interval I.u; v/ between u and v is the set of all vertices on all shortest
u; v-paths. Given a set S V .G/, its geodetic closure I ŒS is the set of all vertices
lying on some shortest path joining two vertices of S I that is,
[
I ŒS D fv 2 V .G/ W v 2 I.x; y/; x; y 2 S g D I.x; y/:
x;y2S
A set S V .G/ is called a geodetic set in G if I ŒS D V .G/; that is, every vertex in
G lies on some geodesic between two vertices from S . The geodetic number g.G/
of a graph G is the minimum cardinality of a geodetic set in G.
See [14] for many aspects of distances in graphs and the Encyclopedia of
Distances [40] for a comprehensive collection of different appearances of distances
in a variety of areas.
The problem of determining the geodetic number of a graph was initiated by
Harary, Loukakis, and Tsouros in 1986 and their result appeared as a published
paper in 1993, see [52]. It is shown there that finding the geodetic number of a graph
is an NP-hard problem with its decision version being the NP-complete problem.
They also determined geodetic numbers in some graph classes. Results about the
geodetic number appeared in the literature before the publication of the article [52];
see [14, 15]. Even before that closely related two-person games on graphs, called
achievement and avoidance games, were introduced and examined in [13]; see [50,
53, 75] for more on this topic.
Chartrand et al. [31] proved that for any integer k between 2 and n there ex-
ists a graph on n vertices with geodetic number k. Moreover, for positive integers
r; d; k 2 with r d 2r, there exists a connected graph G with rad.G/ D r,
diam(G/ D d , and g.G/ D k.
Several lower and upper bounds for the geodetic number involving different
graph parameters have been found. Obviously 2 g.G/ n for any connected
graph G. Among graphs on n vertices only complete graphs attain the upper bound,
while the family of graphs that attain the lower bound is much richer (see Sects. 8.3
and 8.4 for a discussion on median graphs with g.G/ D 2). In [15] it is shown that
g.G/ D 2 if and only if there exist two vertices u and v with d.u; v/ D diam.G/ and
every vertex of G lies on a geodesic between vertices u and v. It is also shown there
that g.G/ D n1 if and only if G D .Kn1 [Kn2 [ [Knr /˚K1 , where r 2 and
n1 ; n2 ; : : : ; nr are positive integers satisfying the equality n1 Cn2 C Cnr D n1
and ˚ denotes the join of graphs (the only vertex not needed in a geodetic set is the
cut vertex of G). Chartrand et al. [31] obtained the following general upper bound:
g.G/ n diam.G/ C 1. It is attained, for instance, by complete graphs and paths.
A vertex is simplicial (also extreme or complete) if its neighborhood induces
a complete graph. A simplicial vertex obviously belongs to any geodetic set
of a graph, hence, the number of simplicial vertices is a lower bound on the
geodetic number [31]. A graph G is an extreme geodesic graph if all simpli-
cial vertices of G already form a geodetic set (which is therefore also unique).
Extreme geodesic graphs are therefore those graphs in which every vertex lies on
8 Geodetic Sets in Graphs 199
a geodesic between two simplicial vertices; see [29]. Trees and complete graphs
provide typical examples of such graphs, and this implies that the following state-
ment is true: for every pair a; n of integers with 2 a n, there exists a connected
extreme geodesic graph G on n vertices with g.G/ D a. Moreover, in [29] it is also
shown that for every pair a; b of integers with 0 a b and b > 2, there exists a
connected graph G with a simplicial vertices and g.G/ D b. On the other hand, all
cut-vertices are clearly excluded from any minimum geodetic set. In addition, for
any graph G containing k end-blocks, g.G/ k, see [28], where an end-block of
graph G is a block containing only one cut-vertex.
Atici and Vince [2] provided a lower bound for the edge geodetic number, de-
noted by ge .G/. Its definition differs from the definition of the usual geodetic
number in that also all edges of a graph G must be included in some geodesic
between two vertices from the geodetic set. Clearly ge .G/ g.G/. In [2] the fol-
lowing lower bound is shown: ge .G/ d3 log3 !.G/e, where !.G/ denotes the
clique number of graph G. Moreover, for any k there exists a graph G with
!.G/ D k that contains an edge geodetic set with d3 log3 ke C vertices, where
2 f0; 1g.
Using the probabilistic method together with a random greedy algorithm for ob-
taining geodetic sets, Chae et al. [23] determined the asymptotic behavior of the
geodetic number of random graphs with fixed edge probability. Starting with an
empty set S the so-called random greedy algorithm simply adds two nonadjacent
vertices at every step and checks whether S is a geodetic set. In [23] it is shown
that given a random graph Gn;p on n vertices with a fixed edge probability p, the
random greedy geodetic covering algorithm almost surely finds a geodetic set on
O.log.n// vertices. A more detailed analysis shows that almost surely g.Gn;p / D
1
.1 C o.1// logb n, where b D 1p .
One can also study geodetic sets that are extremal in some way other than having
the smallest cardinality. A geodetic set S is called a minimal geodetic set if no
proper subset of S is a geodetic set. Of course, every minimum geodetic set is a
minimal geodetic set, but the converse is not true as the example in Fig. 8.1 shows.
Namely, fu; v; wg is a minimal geodetic set of K2;3 but not its minimum geodetic
set (the unique minimum geodetic set is fx; yg). The upper geodetic number of a
graph G, denoted by g C .G/, is defined as the maximum cardinality of a minimal
geodetic set of G. It is shown in [30] that for a connected graph G on n vertices and
gC .G/ D n 1 it follows that g C .G/ D g.G/. Moreover, for every pair a; b of
integers with 2 a < b there exists a graph G with g.G/ D a and g C .G/ D b.
Fig. 8.1 A minimal geodetic

set of K2;3
A graph G is called a minimum geodetic subgraph if there exists a graph H , such

that G is an induced subgraph of H and vertices of G form a minimum geodetic
set. It is shown in [31] that a nontrivial graph G is a minimum geodetic subgraph if
and only if every vertex of G has eccentricity 1 or no vertex of G has eccentricity 1.
The subgraph of G induced by the vertices of maximum eccentricity is called the
periphery of a graph G, denoted Per.G/. Together with the result by Bielak and
Sysło [7] it follows that a nontrivial graph G is a minimum geodetic subgraph if and
only if G is the periphery of some connected graph K.
Concepts related to geodesics also appear in the social sciences [81]. When
members of a social group are represented by vertices, and particular relationships
between members by edges of a graph, then the geodetic number can be consid-
ered as the smallest number n such that every member of a group is contained in
a minimal chain of relationships between chosen n members. Beside this rather
straightforward application, there are also related studies [8] where different mod-
els of (also social) networks and their properties are based on graph distance.
For more results on geodetic number and related concepts that have appeared
before 2002 see the survey [32]. The emphasis of this chapter is to present some
results about the geodetic number and related concepts that have appeared after [32]
was published. They are often connected to graph classes arising in metric graph
theory which is not surprising since the geodesic interval is one of the basic no-
tions of this theory. A typical example of an operation suitable for studying graph
metrics is the Cartesian product of graphs. The results on geodetic sets concerning
this product are presented in Sect. 8.2. In Sect. 8.3 we present relevant results on
median graphs which are one of the most important classes in metric graph theory.
In Sect. 8.4 we follow with algorithmic issues concerning the geodetic number. In
particular we present an efficient algorithm for recognizing median graphs with
geodetic number 2. Next, several types of boundary sets have been defined on
graphs and were studied with respect to convex properties and geodecity; see
Sect. 8.5. In Sect. 8.6 we briefly overview several variations of geodetic sets and
geodetic number that were studied intensively in the last 10 years.
8.2 Cartesian Products
The Cartesian product is a widely useful operation on graphs that appears in various
settings. It is one of the four standard graph products [61], and the most impor-
tant one in metric graph theory. Several well-known classes of graphs are Cartesian
products: square-grids, hypercubes, Hamming graphs, prisms, etc.
The Cartesian product G H of graphs G and H is the graph with the vertex
set V .G/ V .H / in which vertices .g; h/ and .g 0 ; h0 / are adjacent whenever gg 0 2
E.G/ and h D h0 , or g D g 0 and hh0 2 E.H /. The most basic metric property of
the Cartesian product operation is that for any graphs G and H ,
dG H ..g; h/; .g 0 ; h0 // D dG .g; g 0 / C dH .h; h0 /:

Fig. 8.2 Cartesian products: K2 K2 K2 , K3 K2 K2 and K2 .K4 e/
In addition it is also easy to find the following useful observation about intervals in
Cartesian products which is already a part of the folklore.
Lemma 1. Let X D G H be the Cartesian product of (connected) graphs G and

H and let .g; h/ and .g 0 ; h0 / be vertices of X . Then IX Œ.g; h/; .g 0 ; h0 / D IG Œg; g 0
IH Œh; h0 . Moreover, IX Œ.g; h/; .g 0 ; h0 / D IX Œ.g 0 ; h/; .g; h0 /.
The Cartesian product is associative and commutative, and K1 is the unit. Hence,
one can define the Cartesian power in a natural way. The simplest nontrivial exam-
ples are powers of edge-graphs .K2 /k that are known as k-cubes Qk or hypercubes.
Using Lemma 1 and induction on k one quickly finds that g.Qk / D 2; see also
[15]. In Fig. 8.2 three examples of Cartesian products are depicted, namely the
3-cube, the Hamming graph K3 K2 K2 , and the product of K2 and the diamond
K4 e.
We start with general bounds on the geodetic number of the Cartesian product of
two graphs, that are expressed in terms of geodetic numbers of factor graphs.
Theorem 1. [63] Let G and H be graphs with g.G/ D p g.H / D q 2. Then
p g.G H / pq q:
These bounds were proved for the first time by Jiang et al. [63], who also con-
structed infinite families of graphs attaining each of the bounds. We present several
classes of graphs that attain the lower bound in Theorem 1. For the upper bound, the
following construction was given in [63]. First, graphs Dpt are defined on vertices
.ij / .ij /
x1 ; : : : ; xp ; z and y1 ; : : : ; yt for all i; j , 1 i < j p (altogether pC1Ct p2
vertices); where each of the vertices y1.ij / ; : : : ; yt.ij / is adjacent exactly to xi ; xj and
z, z is adjacent to all vertices in Dpt z, and there are no edges between any xi and
xj . It is easy to see that x1 ; : : : ; xp is a geodetic set in Dpt , and in fact g.Dpt / D p.
The following result shows that the upper bound in Theorem 1 is attained by prod-
ucts of graphs Dpt with complete graphs.
Proposition 1. [63] Let p; q; t be positive integers such that t > pq q. Then

g.Dpt Kq / D pq q.
The bounds in Theorem 1 are rather far apart and may not be very useful, but
they cannot be improved in general. By applying Lemma 1, Brešar et al. [12] found
a simple proof of the upper bound in Theorem 1. They also looked for better bounds
when a graph has a minimum geodetic set with some special structure.
Let G be a graph and let S D fx1 ; : : : ; xk g be a geodetic set of G. Then S is a
linear geodetic set if for any x 2 V .G/ there exists an index i , 1 i < k, such that
x 2 I Œxi ; xi C1 .
Theorem 2. [12] Let G and H be graphs on at least two vertices with g.G/ D p
and g.H / D q. Suppose that both G and H contain linear minimum geodetic sets.
Then j pq k
g.G H / :
2
Many graphs admit linear minimum geodetic sets; complete graphs and graphs G
with g.G/ D 2 are obvious instances of such graphs. For another example consider
complete bipartite graphs Kn;m with n; m 4. It is known [31] and easy to see
that g.Kn;m / D 4. Moreover, selecting the first two vertices of a minimum geodetic
set from one bipartition set and the last two vertices from the other yields a linear
geodetic set.
Combining Theorem 2 with the lower bound from Theorem 1 we infer
Corollary 1. [12] Let G be a graph on at least two vertices that admits a linear
minimum geodetic set and let H be a graph with g.H / D 2. Then g.G H / D
g.G/.
The above result also implies that the geodetic number of the product of two
graphs with geodetic number 2 is also 2. For example, the Cartesian product of an
arbitrary finite number of paths has geodetic number 2. In particular, this applies to
hypercubes and square-grid graphs.
For another class of graphs attaining the lower bound in Theorem 1 the following
property of geodetic sets was introduced in [12]. Let G be a graph. If S is a geodetic
set of G such that
8u 2 V .G/ n S; 8v; w 2 S W u 2 I Œv; w; (8.1)
we say that S is a complete geodetic set of G. (Clearly any complete geodetic set is
also a linear geodetic set.)
Proposition 2. [12] Let G and H be nontrivial graphs both having a complete min-
imum geodetic set. Then g.G H / D maxfg.G/; g.H /g.
Examples of graphs having a complete minimum geodetic set include complete

graphs, stars, and graphs with geodetic number 2. Odd cycles are examples of graphs
that admit a linear minimum geodetic set but not a complete minimum geodetic set.
In several examples that achieve the lower bound in Theorem 1, the class of trees
is involved. Note that the unique minimum geodetic set of a tree is the set of its
leaves [31]; hence, the geodetic number of a tree is the number of its leaves.
Proposition 3. (i) [12] For any trees T1 and T2 with `1 and `2 leaves,
g.T1 T2 / D maxf`1 ; `2 g:
(ii) [84] For any tree T with ` leaves and a complete graph Km ,
g.T Km / D maxf`; mg:

Cartesian products of even cycles and complete graphs also attain the best possi-
ble lower bound, as follows from Corollary 1. The complete answer for products of
complete graphs and cycles was given by Ye et al. [84]: for m 2,

m; n even, or n odd and m n
g.Cn Km / D
m C 1; n odd and m < n.
The Cartesian product of the form GK2 is called the prism over G. Geodetic
sets of prisms were considered in [31], where the authors observed the inequality
g.GK2 / g.G/; and provided a sufficient condition for the appearance of equal-
ity. A necessary and sufficient condition for the equality was obtained by Lu [68],
and independently also in [10]. To present it, we need the following notation. For
S1 ; S2 V .G/, and S1 \ S2 D ;, let
I ŒS1 ; S2 D fv 2 V .G/ W v 2 I.x; y/; x 2 S1 ; y 2 S2 g;
i.e., the set of vertices that lie on some geodesic between a vertex of S1 and a vertex
of S2 .
Theorem 3. [10, 68] Let G be a nontrivial connected graph. Then g.GK2 / D
g.G/ if and only if G possesses a geodetic set S that can be partitioned into
nonempty subsets S1 and S2 such that .I ŒS1 \ I ŒS2 / [ I ŒS1 ; S2 D V .G/.
A characterization of the graph G that enjoys g.GK3 / D g.G/ was obtained
recently in [84]. It is more complex than the above, and involves a partition of a
geodetic set of G into three nonempty subsets enjoying several conditions. These
conditions are not in an optimal form, and we present a more brief formulation.
In addition, our approach can be applied to Cartesian products with arbitrary com-
plete graphs.
Note that the condition in Theorem 3 is equivalent to the conjunction of condi-
tions I ŒS1 [ I ŒS1 ; S2 D V .G/ and I ŒS2 [ I ŒS1 ; S2 D V .G/. We generalize it
as follows (for notational convenience I ŒSi ; Si stands for I ŒSi ).
Theorem 4. Let G be a nontrivial connected graph. Then g.GKk / D g.G/ if
and only if G possesses a geodetic set S that can be partitioned into nonempty
subsets S1 ; : : : ; Sk such that for all i D 1; : : : ; k:
k
[
I ŒSi ; Sj D V .G/:
j D1
Proof. Note that vertices of GKk can be written as follows: for any x 2 V .G/,
and i 2 f1; : : : ; kg, let xi D .x; i /. Then xi is adjacent to xj for j ¤ i , and also to
yi whenever xy 2 E.G/.
Suppose that G possesses a geodetic set S that can be partitioned into nonempty
S
subsets S1 ; : : : ; Sk such that for all i D 1; : : : ; k, kj D1 I ŒSi ; Sj D V .G/: Then
let S 0 be the set of vertices in GKk defined as
k
[
Si fi g:
i D1
Let xi D .x; i / be an arbitrary vertex in GKk . Then by the condition of the theo-
rem, x lies in the interval between two vertices y and z from Si (in which case, xi
clearly lies in the interval between yi and zi ), or it lies in I.y; w/, where y 2 Si
and w 2 Sj for some j ¤ i . In the latter case we infer by Lemma 1 that xi lies in
I.yi ; wj /, where clearly yi ; wj 2 S 0 . Hence, I ŒS 0 D V .GKk /, and obviously
jS 0 j D jS j D g.G/.
For the converse, let S 0 be a minimum geodetic set of GKk with jS 0 j D g.G/.
Let Si0 D S 0 \ .V .G/ fi g/, and note that Si0 ¤ ; for all i D 1; : : : ; k, since S 0 is
a geodetic set. Fix i and consider an arbitrary vertex xi . Take any two vertices in S 0
for which xi lies in the interval between them. Clearly, at least one of these vertices
ui is in Si0 . Hence, xi 2 I.ui ; vj /, where vj is the other vertex. Let St be the natural
projection of St0 on G for all t D 1; : : : ; k. Now, if vj 2 Si , then x 2 I.u; v/ where
both u; v 2 Si . Otherwise, x 2 I.u; v/, where u 2 Si ,v 2 Sj . Hence, x 2 I ŒSi or
S
x 2 I ŒSi ; Sj . Since x was arbitrarily chosen, we infer kj D1 I ŒSi ; Sj D V .G/,
and we have proved this for an arbitrary i . The proof is complete.
8.3 Median Graphs
One of the most important classes of graphs derived from related metric structures
is that of median graphs. They are defined as the graphs in which for every triple of
vertices u; v; w 2 V .G/ the intersection I.u; v/ \ I.u; w/ \ I.v; w/ consists of pre-
cisely one vertex (which is called the median of the triple u; v; w). Median graphs
have been rediscovered several times, and a rich structure theory has been devel-
oped, cf. the survey [64] and the book [61]. Applications of median graphs can
be found in computer science, phylogenetics, social choice theory, etc.; see, for
example, [6, 25, 82]. Geodetic sets and the geodetic number in median graphs were
first investigated in [10] and later also in [3, 11].
Brešar and Tepeh [10] studied minimum geodetic sets in median graphs with
respect to the procedure that involves so-called peripheral subgraphs of a median
graph. For a connected graph and an edge xy of G we denote
Wxy D fw 2 V .G/ j d.x; w/ < d.y; w/g:

Fig. 8.3 Peripheral expansion G of a graph H
For an edge xy of G let Uxy denote the set of vertices u that are in Wxy and have a
neighbor in Wyx . If for some edge xy, Wxy D Uxy , we call the set Uxy a peripheral
set and a subgraph induced by a peripheral set is a peripheral subgraph (note that
this is different from the concept of periphery as defined in Sect. 8.1).
A subset S of the vertex set of a graph G is convex if for any two vertices u; v 2 S ,
I.u; v/ is a subset of S . Bandelt et al. [5] characterized median graphs as connected
bipartite graphs in which for every edge ab of G, the sets Uab and Uba are convex.
Another very useful characterization of median graphs due to Mulder is based on a
special expansion procedure [70, 72]. Let H be a connected graph and P its convex
subgraph, meaning the subgraph, induced by a convex subset V .P / of V .H /. Then
the peripheral expansion of H along P is the graph G obtained as follows. Take
the disjoint union of a copy of H and a copy of P (denoted by P 0 in Fig. 8.3). Join
each vertex u in the copy of P with the vertex that corresponds to u in the copy of
H (actually in the subgraph P of H ). We say that the resulting graph G is obtained
by a (peripheral) expansion from H along P , and denote this operation in symbols
by G D pe.H; P /. Mulder [73] characterized median graphs as graphs that can be
obtained from K1 by a sequence of peripheral expansions; see also [9]. In [10] the
following relation between geodetic numbers of a median graph and its peripheral
expansion was obtained.
Theorem 5. [10] Let H be a median graph, P its convex subgraph, and G D

pe.H; P /. Then g.H / g.G/ g.H / C g.P /.
Moreover, it was shown that both bounds are sharp. In fact, by using the structure
of minimum geodetic sets in H , situations when g.G/ D g.H / were character-
ized. Let S and T be two disjoint subsets of V .G/. Then a u; v-geodesic is called a
geodesic on S if u; v 2 S and a u; v-geodesic is called a geodesic between S and T
if u 2 S and v 2 T .
Theorem 6. [10] Let H be a median graph, P its convex subgraph, and G D

pe.H; P /. Then g.H / D g.G/ if and only if there exists a minimum geodetic set
S of H and its partition S D S1 [ S2 such that S1 ; S2 6D ;, S2 V .P / and for
every v 2 V .P /
v lies on some geodesic between S1 and S2 , or
v lies on some geodesic on S1 and on some geodesic on S2 .
Fig. 8.4 A median graph

with geodetic number 4
The upper bound in Theorem 5 is attained for an infinite family of median graphs
(see [10] for the construction), which also gives the answer to the question of how
large the difference can be between g.pe.H; P // and g.H /.
Proposition 4. [10] For every k 2 N there exists a median graph G that can
be obtained by the peripheral expansion from a median graph H such that
g.G/ D g.H / C k.
Trees are median graphs in which peripheral subgraphs are precisely the one-
vertex subgraphs induced by each leaf and the minimum geodetic set of a tree
consists of all leaves [31]. But unlike in trees, it may happen that in a median
graph a minimum geodetic set contains vertices that are not in a peripheral sub-
graph; see Fig. 8.4. On the other hand, it was shown in [10] that given a geodetic
set S of a median graph, every periphery contains a vertex from S . This was
the motivation for introducing the concept of the periphery transversal number
pt.G/ as the smallest number of vertices that meet all peripheral subgraphs [3, 11].
Clearly, pt.G/ g.G/ and it turns out that median graphs with geodetic number
2 and those with periphery transversal number 2 coincide. As already mentioned
in Sect. 8.1, general graphs with g.G/ D 2 were characterized in [15]. Cagaanan
et al. [22] proved that the geodetic number of a join of two connected noncom-
plete graphs is 2 if and only if both the diameter and the geodetic number of one of
the graphs is 2. However, much more is known about median graphs with geodetic
number 2. Before we give the complete list of thus far known characterizations of
such graphs we need some preliminary notions.
A subgraph H of a graph G is isometrically embeddable in G if dH .u; v/ D
dG .u; v/ for every u; v 2 V .H /. Edges e D xy and f D uv of a graph G are in the
Djoković–Winkler relation if dG .x; u/CdG .y; v/ 6D dG .x; v/CdG .y; u/ [41,83].
Relation is reflexive and symmetric. Winkler [83] proved that it is also transitive
in partial cubes (i.e., isometric subgraphs of hypercubes), and so it is an equiva-
lence relation on the edge set of any median graph, since median graphs are partial
cubes [71]. By the result of Eppstein [45] every partial cube G can be isometrically
embedded into the n-dimensional grid Zn for sufficiently large n. Denote by pi the
projection from Zn to a copy of Z, denoted by Zi . Clearly pi .G/ is a discrete interval
Œai ; bi Zi of length di D bi ai . We say that vertices u and v of a graph G which

is isometrically embedded in Zn are antipodal if d.u; v/ D d1 C d2 C C dn .
A profile D .x1 ; : : : ; xk / on a graph G is a finite sequence of vertices of G.
Given a profile on G and a vertex u of G, the remoteness D.u; / see [67] is
X
D.u; / D d.u; x/:
x2
Theorem 7. Let G be a median graph. Then the following assertions are

equivalent:
(i) g.G/ D 2.
(ii) G can be obtained by a sequence of peripheral expansions from K1 such that
in each peripheral expansion step the convex subgraph with respect to which
the expansion is performed has a nonempty intersection with some minimum
geodetic set [10].
(iii) There exist vertices a; b in V .G/ and an a; b-geodesic ˘ such that every
-class in G has an edge on ˘ [10].
(iv) G can be isometrically embedded in Zn in such a way that there exist antipo-
dal vertices a and b [10].
(v) pt.G/ D 2 [3].
(vi) D.x; / is constant on G for some profile [3].
Characterizations (iii) and (iv) hold also in the more general case of partial
cubes. A geometric interpretation of characterization (iv) is that a partial cube G
n
has a geodetic set fa;
Qnbg if and only if G can be isometrically embedded into Z
in such a way that i D1 Œai ; bi contains V .G/. The characterization (vi) answers
the following question from location theory: for which median graphs G is their
vertex-set the (anti)median set of some profile on G; see [3] for more details. The
fifth characterization leads to the question of whether there is a general connection
between the geodetic number of a median graph and the structure that is derived
from intersecting peripheral subgraphs. For this purpose the periphery graph P .G/
of a median graph G was introduced in [11] as the graph whose vertices are pe-
ripheral subgraphs in G and two vertices are adjacent in P .G/ if and only if the
peripheral subgraphs intersect. It was proved that there are median graphs whose
periphery graph has independence number 2, and have arbitrarily large geodetic
number; see also [4].
8.4 Algorithms and Complexity
Harary et al. [52] observed that finding the geodetic number of a graph is an NP-
hard problem with its decision variation being NP-complete. Douthat and Kong
showed that the decision problem regarding the geodetic number of a graph remains
NP-complete when restricted to the class of chordal graphs [43], and when restricted
to the class of bipartite graphs [42]. They also noted that the problem becomes poly-
nomially solvable in the class of split graphs. Atici later showed that the following
more general decision problem is NP-complete: given a graph G and an integer
k jV .G/j, is there a set S V .G/ with jS j D k such that I ŒS D V .G/ [1].
In [52] an algorithm for finding the geodetic number is also proposed. However,
Hansen and van Omme [51] observed that the approach from [52] has a serious
mistake and presented an example for which the algorithm fails and does not pro-
duce a geodetic set. They proposed another approach by developing a 0–1 integer
programming model to find the geodetic number of a graph. We present it next.
For each vertex vk 2 V .G/ consider all geodesics passing through vk . This can
be easily done once the distance matrix of G is known, by finding pairs of vertices
forming the following set
Pk D f.vi ; vj / j d.vi ; vk / C d.vk C vj / D d.vi ; vj /; i < j g:
Let S denote a minimum geodetic set of G. The idea is then to define binary
variables of two types: xk , 1 k jV .G/j, and yij , where .vi ; vj / 2 Pk and it
holds that
(
1; if vk 2 S
xk D
0; if vk … S
and
(
1; if vi ; vj 2 S
yi;j D
0; otherwise
The following model then constructs a minimum geodetic set:
n
X
Minimize xk
kD1
subject to
X
1 xk yij ; vk 2 V .G/; (8.2)
.vi ;vj /2Pk
yij xi ; i D 1; : : : ; n; (8.3)
yij xj ; j D 1; : : : ; n; (8.4)
xi C xj 1 yij ; i; j D 1; : : : ; n; (8.5)
and all variables are either 0 or 1.

In the objective function we want to minimize the size of a geodetic set. The first
inequality ensures that I ŒS D V .G/, and inequalities (8.3)–(8.5) force all variables
yij to be 0 or 1, depending on whether vi and vj belong to a minimum geodetic set

or not. Finally, we note that in [52] results of some computational experiments were
also given.
Nonetheless graphs with geodetic number 2 can be recognized in polynomial
time. One needs to determine all diametrical vertices and check whether every dia-
metrical vertex has a unique vertex realizing its eccentricity. For all such diametrical
pairs, then check whether every other vertex lies on the interval between the pair.
Clearly this can be done in polynomial time by using a distance matrix. Median
graphs with g.G/ D 2 can be recognized even more efficiently. The fastest recog-
nition algorithm for median graphs is of complexity O..m log n/1:41 / and is due to
Imrich and Klavžar [61]. The exponent 1:41 stands for 2!=.! C 1/, where ! de-
notes the exponent of matrix multiplication with its current value 2.376; see [39].
By the result of Imrich et al. [60] the recognition complexity of median graphs
is closely related to the recognition complexity of triangle-free graphs. Therefore
improving the recognition complexity of median graphs is believed to be very diffi-
cult. Some classes of median graphs can be recognized faster. For example, planar
median graphs can be recognized in linear time [60] and graphs of acyclic cubical
complexes can be recognized in O.m log n/ time; see [59].
We follow with the result from [3] about the recognition of median graphs with
g.G/ D 2 in O.m log n/ time. This is possible because of the upper bound on
the maximum degree of a median graph with geodetic number two and the fact that
every peripheral subgraph meets any geodetic set; see Theorem 7(ii). The mentioned
upper bound reads as follows.
Lemma 2. [3] If G is a median graph with g.G/ D 2, then .G/ 2 log2 n.
Moreover, if .G/ 2 log2 n one can check in O.m log n/ time whether G
is a median graph, and determine all -classes and all Uab sets. The next lemma
describes all geodetic sets of G D pe.H I P / with regard to H .
Lemma 3. [3] Let G D pe.H I P / be a median graph and fx; yg a geodetic set
of H , where y 2 P . Then the set fx; zg, where z is the neighbor of y in GnH , is a
geodetic set in G. Moreover, all minimum geodetic sets of G are of this form.
If fx; yg is a geodetic set in G then this is the only minimum geodetic set contain-
ing x, since, by Lemma 3, x is uniquely determined by y and vice versa. Moreover,
it also follows that for a median graph G D pe.H I P / with g.G/ D 2, all minimum
geodetic sets of G can be obtained from the minimum geodetic sets of H in O.jP j/
time. Therefore if the representation of G as a sequence of peripheral expansions,
starting from K1 , is known, then all minimum geodetic sets of G can be obtained in
O.n/ time. It remains then to find efficiently the representation of G by a sequence
of peripheral expansions starting from K1 .
Theorem 8. [3] Let G be a median graph with .G/ 2 log2 n. Then a represen-
tation of G by a sequence of peripheral expansions can be found in O.m log n/ time.
In the proof of Theorem 8 the following idea is used: the peripheral Uab -sets are
characterized by the fact that @Uab consists of jUab j independent edges that meet
every vertex of a Uab -set, where @Uab is the set of edges with one endvertex in Uab
and the other in G n Uab . In other words, Uab is peripheral if
degG .v/ D degUab .v/ C 1;
for every v 2 Uab . Clearly degUab .v/ C 1 degG .v/ for v 2 G. Thus, setting
exUab .v/ D degG .v/ degUab .v/ 1
it is clear that Uab is peripheral if and only if

X
ex.Uab / D exUab .v/ D 0:
v2Uab
If fx; yg is a geodetic set then a pair x and y is called a geodetic pair. Using
the ideas described above an algorithm is presented in [3] that recognizes whether
a given graph G is a median graph with g.G/ D 2, and can be implemented to run
within the time complexity O.m log n/. In the case where G is a median graph with
g.G/ D 2 the algorithm also gives the list of all geodetic pairs of G.
The algorithm does the following. First it checks whether the maximum degree
of G is bounded by 2 log2 n. If the answer is positive, it checks whether G is also a
median graph, and in which case it determines all -classes and all Uab sets. Next
it computes the value of ex.Uab / for all Uab sets and then determines a peripheral
Uab set and removes it. Until one gets K1 , this dismantling procedure is repeated
(at each step a peripheral Uab set is determined and removed). Next we construct
G back again starting from K1 by a sequence of peripheral expansions, taking care
of all geodetic pairs using Lemma 3. If at any step there are no such pairs, then
g.G/ > 2. Otherwise the algorithm also lists all geodetic pairs. As observed above,
it can be implemented to run in O.m log n/ time.
8.5 Boundary and Geodetic Sets
The study of abstract convexity spread in the early 1950s, and resulted in a purely
axiomatic definition of convex sets that generalizes the classical concept of con-
vexity in Euclidean spaces (see a survey on this topic [80], or [17] for a brief
introduction to the abstract convexity in graphs). In this section we present results
in which problems arising in convexity theory relate to geodetic sets.
Recall that a subset W of the vertex set of a graph G is convex if for any two
vertices u; v 2 S , I.u; v/ is a subset of S . The smallest convex set containing S is
called the convex hull of S and is denoted by CH.S /. The operation of geodetic
closure is somewhat similar to the convex hull operation. In fact, the concept of
the geodetic set can be regarded as a variation of the following concept introduced
by Everett and Seidman [47]. The set S for which CH.S / D V .G/ is called the
hull set of a graph G, and the size of a minimum hull set of G is called the hull
number of G, denoted h.G/. Given a set S of vertices in a graph G, it is clear that
I ŒS CH.S /. Hence, if S is a geodetic set of G then also CH.S / D V .G/,
and so for any graph G, h.G/ g.G/. Much work concerning the hull number of
graphs was done by Chartrand and Zhang, see [32] for some additional references
on these studies. The hull number of median graphs was considered by Mulder [73],
showing that h.G/ D pt.G/ for any median graph G. The hull number of Cartesian
products of graphs was studied in Cagaanan and Canoy [20,21], where it was shown
that h.GH / D maxfh.G/; h.H /g. Canoy et al. [22] considered the hull and the
geodetic number of joins of two graphs.
Given a graph G and a convex set S V .G/, a vertex v 2 S is called an ex-
treme vertex of S if S n fvg is also convex. A graph G is called a convex geometry
if every convex set of G is the convex hull of its extreme vertices (this property
is also called the Minkowski–Krein–Milman property [48, 62, 65]). Graphs with
this property are properly contained in the class of distance hereditary graphs [17].
A connected graph G is distance hereditary if for every connected induced sub-
graph H of G and every two vertices u; v 2 H , dH .u; v/ D dG .u; v/ [57]. A graph
is chordal if it contains no induced cycle of length greater than 3 and a chordal graph
is called Ptolemaic if it is distance hereditary. Farber and Jamison [48] proved that a
graph G is a convex geometry if and only if G is Ptolemaic. Hence, if S is a convex
set in a Ptolemaic graph G, then we can rebuild the set S from its extreme vertices
using the convex hull operation. This cannot be done with every graph, however,
Cáceres et al. [17] extended the set of extreme vertices of S to the contour set,
C t.G/, that enables one to rebuild S using the vertices in C t.G/ and the convex
hull operation. The contour set C t.G/ of a graph G is defined by
Ct.G/ D fv 2 V .G/ j ecc.u/ ecc.v/ ; 8u 2 NG .v/g:
Theorem 9. [17] Let G be a graph and S a convex subset of vertices. Then

S D CH.C t.S //.
In order to find the convex hull of a set S one can start by taking the union of
intervals over all pairs of vertices of S . Hence, one may ask whether the geodetic
closure of the contour of S equals S . More specifically, when the contour set of a
graph is also its geodetic set, we have the following (partial) result.
Theorem 10. [17] Let G be a distance hereditary graph. Then C t.G/ is a geodetic
set for G.
The geodeticity of the contour C t.G/ and other related sets was also studied in
[18, 19, 33, 36]. The vertex v is said to be a boundary vertex of u if no neighbor of
v is farther away from u than v. By @.u/ we denote the set of all boundary vertices
of u. Hernando et al. [55] proved that fug [ @.u/ is a geodetic set for an arbitrary
vertex u 2 V .G/. The boundary @.G/ of a graph G is the set of all of its boundary
vertices [33].
Theorem 11. [18] The boundary @.G/ of any connected graph G is a geodetic set.
In fact this result follows from the stronger result that the so-called expanded
contour ˝.G/ D C t.G/ [ Ecc.C t.G// of every connected graph G is geodetic
[18]. (Recall that eccentricity Ecc.G/ is the set of eccentric vertices of a graph,
where a vertex v is called an eccentric vertex of G if no vertex in V .G/ is farther
away from some vertex u 2 V .G/ than v.)
In [19] the geodeticity of significant subsets of the boundary (periphery, contour
set, and eccentricity) was studied for the class of perfect graphs. There are exam-
ples of perfect graphs for which neither Per.G/, Ecc.G/, nor Ct.G/ are geodetic
sets [16]. However, the contour set of a graph is also geodetic in several perfect
graph classes (we have already mentioned that distance hereditary graphs possess
this property). In particular, this is true for chordal graphs
Theorem 12. [19] The contour set of every chordal graph is a geodetic set.
The state of the art on this topic is presented in [19]. The main open problem is
still the case of bipartite graphs (namely, whether the contour set of any bipartite
graph is a geodetic set). In particular this was conjectured for median graphs [10].
In [18] the question was posed whether the geodetic closure of the contour
set I ŒC t.G/ is always a geodetic set. The authors approached this question by
trying to prove that for every graph G its expanded contour ˝.G/ is contained in
I ŒC t.G/ but this still remains an open problem. However, they obtained a number
of conditions under which the contour set of a graph is a geodetic set or at least the
geodetic closure of the contour set is geodetic. The following partial results were
proved in [18].
Theorem 13. [18] Let G be a connected graph. Then C t.G/ is a geodetic set if
one of the following is true:
(i) jC t.G/j D 2.
(ii) C t.G/ D Per.G/.
Theorem 14. [18] For a connected graph G the geodetic closure of C t.G/ is a
geodetic set if one of the following conditions is fulfilled:
(i) Ecc.C t.G// I ŒC t.G/.

(ii) C t.G/ n Per.G/ D fy1 ; : : : ; yk g and ecc.yi / D ecc.yj /, for each i; j D
1; : : : ; k.
(iii) jC t.G/j D jPer.G/j C 1.
(iv) jC t.G/j D 3.
8.6 Related Concepts
Several concepts can be found in the literature that in various ways relate to geodetic
sets and the geodetic number. We briefly present some of them without an ambition
to give deeper insights, yet an interested reader is directed to appropriate references.

Note that the ideas from convexity theory that are related to geodeticity were pre-
sented in Sect. 8.5.
The first group of related concepts pertains to variations of intervals that arise
from betweenness structures (for the notion of betweenness we refer to [69, 74]),
different from the shortest paths. Typical instances of such intervals come from the
so-called monophonic (i.e., induced) paths and detour (i.e., longest) paths between
two vertices, which also yield the corresponding monophonic convexity [44, 69] and
the detour distance in graphs [38]. A set S of vertices in a graph G is called mono-
phonic if for every vertex x 2 V .G/ there exist u; v 2 S such that x lies on an induced
(i.e., chordless) path between u and v. It was shown in [56] that the contour set in
any connected graph is a monophonic set (as we know from Sect. 8.5 it is not always
a geodetic set). Similarly, a set S of vertices in a graph G is called a detour set if for
every vertex x 2 V .G/ there exist u; v 2 S such that x lies on a detour (i.e., longest)
path between u and v. The size of a minimum detour set in a graph G is called the
detour number of G. These concepts were investigated in two papers by Chartrand
et al. [35, 37].
Another interval variation (the Steiner interval) is of different flavor since it may
apply to more than two vertices. Given a graph G and a set of vertices W V .G/,
the Steiner tree of W is a minimum (with respect to the number of edges) connected
subgraph that contains all vertices of W (it follows easily from the definition that
this subgraph is a tree). The Steiner interval S ŒW of a set W consists of all vertices
in G that lie on some Steiner tree of W ; see [66]. A set W V .G/ is called a Steiner
set of a graph G, if S ŒW D V .G/, and the Steiner number sn.G/ of G is the size
of a smallest Steiner set of G. The first general results about the Steiner number in
graphs were obtained by Chartrand and Zhang [28]. For instance, they proved that
for any positive integers r, d , and k 2, where r d 2r there exists a graph G
with diam.G/ D d , rad.G/ D r, and sn.G/ D k. They also observed that for every
pair of integers k and n with 2 k n there exists a graph of order n whose Steiner
number is k. Unfortunately, as noted by Pelayo [77], it was erroneously stated (and
“proved”) in [28] that every Steiner set in a connected graph is a geodetic set.
(In addition, Pelayo [77] constructed a graph G for which g.G/ is greater than
sn.G/ [77].) This motivated Hernando et al. [54] to address the problem of charac-
terizing the graphs in which every Steiner set is also a geodetic set. They obtained
some partial results on this problem, namely that all connected interval graphs have
this property, but not all connected chordal graphs. In addition they investigated
relations among geodetic, monophonic, Steiner, and hull sets, and proved that every
Steiner set in a connected graph is a monophonic set [54]. In particular this implies
that in distance hereditary graphs every Steiner set is a geodetic set [54]. The latter
result was independently obtained by Oellermann and Puertas [76] who also showed
that g.G/=sn.G/ can be arbitrarily large if G is not a distance hereditary graph [76].
It was recently proved by Eroh and Oellermann that every Steiner set is a geodetic
set in the class of 3-Steiner distance hereditary graphs [46]. However, in general this
problem remains open.
Geodetic sets can be studied in directed graphs as well. Chartrand and Zhang
[27] introduced the geodetic number of an oriented graph as follows. Let D be an
oriented graph, and S V .D/. Then I ŒS is the set of all vertices that lie on some
shortest (directed) u; v-path for u; v 2 S . The minimum size of a set S such that
I ŒS D V .D/ is called the geodetic number of an oriented graph D. Recall that
given a graph G, an orientation of G is an oriented graph obtained from G by
orienting all of its edges to one of the two directions. Now, if G is a graph, then the
lower orientable geodetic number g .G/ of G is the minimum geodetic number
among all orientations of G, and the upper orientable geodetic number g C .G/ of G
is the maximum such geodetic number [27]. It was proved that for every connected
C
graph G of order at least g .G/ < g .G/, and for every two integers n and m
n3,
with 1 n 1 m 2 , there exists a connected graph G with n vertices and m
edges such that gC .G/ D n [27]. These concepts together with oriented variations
of hull numbers were studied in Chartrand et al. [34], developed further by Farrugia
[49], and in turn by Hung et al. [58]. Chang et al. [24] considered the concept of
a geodetic spectrum of a graph G, which is defined as the set of geodetic numbers
of all orientations of G, and determined it for several classes of graphs (the concept
of a strong geodetic spectrum concerning only strongly connected orientations was
also studied [24]).
Forcing concepts have been considered for various graph invariants, including
the geodetic number. The forcing geodetic number was introduced by Chartrand
and Zhang [26] as follows. Let G be (an undirected) graph, and let S be a minimum
geodetic set of a graph G. A subset T of S is called a forcing subset of S , if S is
the unique minimum geodetic set that contains T . The minimum size of a forcing
subset of a minimum geodetic set in G is called the forcing geodetic number f .G/
of a graph G. Clearly f .G/ g.G/ in any graph G, and it was shown that any pair
of integers is realizable as the forcing geodetic and the geodetic number of some
graph, with only two exceptions (both parameters cannot be 1 (resp. 2) at the same
time). An analogous theorem was proved by Zhang [85] for the so-called upper
forcing geodetic number. Given a minimum geodetic set S a forcing subset T is
called critical if no subset of T is a forcing subset of S . The maximum size of a
critical forcing subset of a minimum geodetic set in G is called the upper forcing
geodetic number f C .G/. Clearly, f .G/ f C .G/ g.G/, and, solving a problem
of Zhang [85], Tong proved [78] that for any nonnegative integers a, b, and c with
1 a b c 2 or 4 a C 2 b c, there exists a connected graph G
with f .G/ D a, f C .G/ D b, and g.G/ D c. See also [79] for some recent
developments in this area.
8.7 Summary and Conclusion
The concept of geodetic number was introduced roughly two decades ago, while
most of the corresponding papers were published in the last 10 years. In this chapter
we tried to present a concise survey of known results and a state of the art of recent
developments. Although to our knowledge we incorporated a great majority of the

papers that were published on this subject, emphasis is given to the classes of graphs
related to metric graph theory. This in part reveals our subjective preferences, but
on the other hand reflects the focus of recent studies. As presented in Sects. 8.5 and
8.6, a lot of attention was given to relations with other concepts from (metric) graph
theory, and we believe that this research will continue to develop. An abundance of
open problems, some of which we also mentioned in this work, guarantees further
interest in these concepts. Natural connections with some other concepts in graph
theory (such as Steiner, hull, and several boundary sets) suggest that the geodeticity
concepts could be applicable also in other areas.
References
1. Atici M (2002) Computational complexity of geodetic set. Int J Comput Math 79:587–591
2. Atici M, Vince A (2002) Geodesics in graphs, an extremal set problem, and perfect hash fami-
lies. Graph Combinator 18:403–413
3. Balakrishnan K, Brešar B, Changat M, Imrich W, Klavžar S, Kovše M, Subhamathi AR (2009)
On the remoteness function in median graphs. Discrete Appl Math 157(18):3679–3688
4. Bandelt H-J, Chepoi V (1996) Graphs of acyclic cubical complexes. Eur J Combinator 17:
113–120
5. Bandelt H-J, Mulder HM, Wilkeit E (1994) Quasi-median graphs and algebras. J Graph Theory
18:681–703
6. Bandelt H-J, Forster P, Sykes BC, Richards MB (1995) Mitochondrial portraits of human pop-
ulations using median networks. Genetics 14:743–753
7. Bielak H, Sysło M (1983) Peripheral vertices in graphs. Studia Sci Math Hungar 18:269–275
8. Brandes U (2005) Network analysis. Methodological foundations. Lecture Notes in Computer
Science, vol 3418. Springer, Berlin, pp 62–82
9. Brešar B (2003) Arboreal structure and regular graphs of median-like classes. Discuss Math
10. Brešar B, Tepeh Horvat A (2008) On the geodetic number of median graphs. Discrete Math
308:4044–4051
11. Brešar B, Changat M, Subhamathi AR, Tepeh Horvat A (2010) The periphery graph of a me-
dian graph. Discuss Math Graph Theory 30:17–32
12. Brešar B, Klavžar S, Tepeh Horvat A (2008) On the geodetic number and related metric sets in
Cartesian product graphs. Discrete Math 308:5555–5561
13. Buckley F, Harary F (1986) Geodetic games for graphs. Quaest Math 8:321–334
14. Buckley F, Harary F (1990) Distance in graphs. Addison-Wesley, Redwood City
15. Buckley F, Harary F, Quintas LV (1988) Extremal results on the geodetic number of a graph.
Scientia 2A:17–26
16. Cáceres J, Hernando C, Mora M, Pelayo IM, Puertas ML, Seara C (2005) Searching for geode-
tic boundary vertex sets. Electron Notes Discrete Math 19:25–31
17. Cáceres J, Márquez A, Oellermann OR, Puertas ML (2005) Rebuilding convex sets in graphs.
18. Cáceres J, Hernando C, Mora M, Pelayo IM, Puertas ML, Seara C (2006) On geodetic sets
formed by boundary vertices. Discrete Math 306:188–198
19. Cáceres J, Hernando C, Mora M, Pelayo IM, Puertas ML, Seara C (2008) Geodecity of the
contour of chordal graphs. Discrete Appl Math 156:1132–1142
20. Cagaanan GB, Canoy SR (2004) On the hull sets and hull number of the Cartesian product of
21. Cagaanan GB, Canoy SR (2006) On the geodetic covers and geodetic bases of the composition
GŒKm . Ars Combinatoria 79:33–45
22. Cagaanan GB, Canoy SR, Gervacio SV (2006) Convexity, geodetic, and hull numbers of the
join of graphs. Utilitas Math 71:143–159
23. Chae G, Palmer EM, Siu W (2002) Geodetic number of random graphs of diameter 2. Australas
J Combinator 26:11–20
24. Chang GJ, Tong L, Wang H (2004) Geodetic spectra of graphs. Eur J Combinator 25:383–391
25. Chung FRK, Graham RL, Saks ME (1987) Dynamic search in graphs. In: Wilf H (ed) Discrete
algorithms and complexity. Perspectives in Computing (Kyoto, 1986), vol 15. Academic, New
York, pp 351–387
26. Chartrand G, Zhang P (1999) The forcing geodetic number of a graph. Discuss Math Graph
Theory 19:45–58
27. Chartrand G, Zhang P (2000) The geodetic number of an oriented graph. Eur J Combinator
21:181–189
28. Chartrand G, Zhang P (2002) The Steiner number of a graph. Discrete Math 242:41–54
29. Chartrand G, Zhang P (2002) Extreme geodesic graphs. Czech Math J 52:771–780
30. Chartrand G, Harary F, Zhang P (2000) Geodetic sets in graphs. Discuss Math Graph Theory
20:129–138
31. Chartrand G, Harary F, Zhang P (2002) On the geodetic number of a graph. Networks 39:1–6
32. Chartrand G, Palmer EM, Zhang P (2002) The geodetic number of a graph: a survey. Congr
Numer 156:37–58
33. Chartrand G, Erwin D, Johns GL, Zhang P (2003) Boundary vertices in graphs. Discrete Math
263:25–34
34. Chartrand G, Fink JF, Zhang P (2003) The hull number of an oriented graph. Int J Math Math
Sci 36:2265–2275
35. Chartrand G, Johns G, Zhang P (2003) The detour number of a graph. Utilitas Math 64:97–113
36. Chartrand G, Erwin D, Johns GL, Zhang P (2004) On boundary vertices in graphs. J Combin
37. Chartrand G, Johns GL, Zhang P (2004) On the detour number and geodetic number of a graph.
Ars Combinator 72:3–15
38. Chartrand G, Escuadro H, Zhang P (2005) Detour distance in graphs. J Combin Math Combin
Comput 53:75–94
39. Coppersmith D, Winograd S (1990) Matrix multiplication via arithmetic progressions. J Sym-
bolic Comput 9:251–280
40. Deza M, Deza E (2009) Encyclopedia of distances. Springer, Berlin Heidelberg
41. Djoković D (1973) Distance preserving subgraphs of hypercubes. J Combin Theory B 14:
263–267
42. Douthat AL, Kong MC (1995) Computing the geodetic number of bipartite graphs. Congr
Numer 107:113–119
43. Douthat AL, Kong MC (1996) Computing geodetic bases of chordal and split graphs. J Combin
44. Duchet P (1988) Convex sets in graphs II. Minimal path convexity. J Combin Theory B 44:
307–316
45. Eppstein D (2005) The lattice dimension of a graph. Eur J Combinator 26:585–592
46. Eroh L, Oellermann OR (2008) Geodetic and Steiner geodetic sets in 3-Steiner distance hered-
itary graphs. Discrete Math 308:4212–4220
47. Everett MG, Seidman SB (1985) The hull number of a graph. Discrete Math 57:217–223
48. Farber M, Jamison RE (1986) Convexity in graphs and hypergraphs. SIAM J Algebraic Dis-
49. Farrugia A (2005) Orientable convexity, geodetic and hull numbers in graphs. Discrete Appl
Math 148:256–262
50. Fraenkel AS, Harary F (1989) Geodetic contraction games on graphs. Int J Game Theory
18:327–338
51. Hansen P, van Omme N (2007) On pitfalls in computing the geodetic number of a graph. Opt
Lett 1:299–307
52. Harary F, Loukakis E, Tsouros C (1993) The geodetic number of a graph. Math Comput Model
17:89–95
53. Haynes TW, Henning MA, Tiller C (2003) Geodetic achievement and avoidance games for
graphs. Quaest Math 26:389–397
54. Hernando C, Jiang T, Mora M, Pelayo I, Seara C (2005) On the Steiner, geodetic and hull
numbers of graphs. Discrete Math 293:139–154
55. Hernando C, Mora M, Pelayo I, Seara C (2006) Some structural, metric and convex properties
on the boundary of a graph. Electron Notes Discrete Math 24:203–209
56. Hernando C, Mora M, Pelayo I, Seara C On monophonic sets in graphs. Manuscript
57. Howorka E (1977) A characterization of distance hereditary graphs. Q J Math Oxford, 28:
417–420
58. Hung J, Tong L, Wang H (2009) The hull and geodetic numbers of orientations of graphs.
59. Imrich W, Klavžar S (1999) Recognizing graphs of acyclic cubical complexes. Discrete Appl
Math 95:321–330
60. Imrich W, Klavžar S, Mulder HM (1999) Median graphs and triangle-free graphs. SIAM J
61. Imrich W, Klavžar S (2000) Product graphs: structure and recognition. Wiley, NY
62. Jamison RE (1980) Copoints in antimatroids. Congr Numer 29:535–544
63. Jiang T, Pelayo I, Pritikin D (2004) Geodesic convexity and Cartesian products in graphs.
Manuscript
64. Klavžar S, Mulder HM (1999) Median graphs: characterizations, location theory and related
structures. J Combin Math Combin Comp 30:103–127
65. Korte B, Lovász L (1986) Homomorphisms and Ramsey properties of antimatroids. Discrete
Appl Math 15:283–290
66. Kubicka E, Kubicki G, Oellermann OR (1998) Steiner intervals in graphs. Discrete Math
81:181–190
67. Leclerc B (2003) The median procedure in the semilattice of orders. Discrete Appl Math
127:285–302
68. Lu C (2007) The geodetic numbers of graphs and digraphs. Sci China Ser A 50:1163–1172
69. Morgana MA, Mulder HM (2002) The induced path convexity, betweenness and svelte graphs.
70. Mulder HM (1978) The structure of median graphs. Discrete Math 24:197–204
71. Mulder HM (1980) n-Cubes and median graphs. J Graph Theory 4:107–110
72. Mulder HM (1980) The interval function of a graph. Mathematical Centre Tracts 132. Mathe-
matisch Centrum, Amsterdam
73. Mulder HM (1990) The expansion procedure for graphs. In: Bodendiek R (ed) Contemporary
methods in graph theory. Manhaim/Wien/Zürich: B.I. Wissenschaftsverlag
74. Mulder HM (2008) Transit functions on graphs (and posets). In: Changat M, Klavžar S, Mulder
HM, Vijayakumar A (eds) Convexity in discrete structures. Lecture Notes Ser. 5, Ramanujan
Math Soc, pp 117–130
75. Necásková M (1988) A note on the achievement geodetic games. Quaest Math 12:115–119
76. Oellermann OR, Puertas ML (2007) Steiner intervals and Steiner geodetic numbers in distance-
hereditary graphs. Discrete Math 307:88–96
77. Pelayo I (2004) Comment on: “The Steiner number of a graph” by Chartrand G, Zhang P
[Discrete Math 242:1–3, 41–54 (2002)]. Discrete Math 280:259–263
78. Tong L (2009) The (a,b)-forcing geodetic graphs. Discrete Math 309:1623–1628
79. Tong L (2009) The forcing hull and forcing geodetic numbers of graphs. Discrete Appl Math
157:1159–1163
80. van de Vel MLJ (1993) Theory of convex structures. North Holland, Amsterdam
81. Wang F, Wang Y, Chang J (2006) The lower and upper forcing geodetic numbers of block-
cactus graphs. Eur J Oper Res 175:238–245
82. William HE, McMorris FR (2003) Axiomatic concensus theory in group choice and bioinfor-
matics. J Soc Ind Appl Math 29:91–94
83. Winkler P (1984) Isometric embeddings in products of complete graphs. Discrete Appl Math
7:221–225
84. Ye Y, Lu C, Liu Q (2007) The geodetic numbers of Cartesian products of graphs. Math Appl
(Wuhan) 20:158–163
85. Zhang P (2002) The upper forcing geodetic number of a graph. Ars Combinatoria 62:3–15
Chapter 9
Graph Polynomials and Their Applications I:
The Tutte Polynomial
Abstract In this survey of graph polynomials, we emphasize the Tutte polynomial

and a selection of closely related graph polynomials such as the chromatic, flow, re-
liability, and shelling polynomials. We explore some of the Tutte polynomial’s many
properties and applications and we use the Tutte polynomial to showcase a variety
of principles and techniques for graph polynomials in general. These include sev-
eral ways in which a graph polynomial may be defined and methods for extracting
combinatorial information and algebraic properties from a graph polynomial. We
also use the Tutte polynomial to demonstrate how graph polynomials may be both
specialized and generalized, and how they can encode information relevant to phys-
ical applications. We conclude with a brief discussion of computational complexity
considerations.
Keywords Tutte polynomial Graph polynomial Chromatic polynomial Flow

polynomial Reliability polynomial Shelling polynomial Abelian sandpile model
Spanning tree Beta invariant
MSC2000: Primary 05-02; Secondary 05C15, 05A15, 05C99
9.1 Introduction
We begin our exploration of graph polynomials and their applications with

the Tutte polynomial, a renowned tool for analyzing properties of graphs and
networks. This two-variable graph polynomial, due to Tutte [101, 103, 104],
J.A. Ellis-Monaghan ()

Department of Mathematics, Saint Michael’s College, One Winooski Park, Colchester,
VT 05439, USA
and
Department of Mathematics and Statistics, University of Vermont, 16 Colchester Avenue,
Burlington, VT 05405, USA

220 J.A. Ellis-Monaghan and C. Merino
has the important universal property that essentially any multiplicative graph
invariant with a deletion/contraction reduction must be an evaluation of it. These
deletion/contraction operations are natural reductions for many network models
arising from a wide range of problems at the heart of computer science, engineer-
ing, optimization, physics, and biology.
In addition to surveying a selection of the Tutte polynomial’s many properties
and applications, we use the Tutte polynomial to showcase a variety of principles
and techniques for graph polynomials in general. These include several ways in
which a graph polynomial may be defined and methods for extracting combinatorial
information and algebraic properties from a graph polynomial. We also use the Tutte
polynomial to demonstrate how graph polynomials may be both specialized and
generalized, and how they can encode information relevant to physical applications.
We begin with the Tutte polynomial because it has a rich and well-developed
theory, and thus it serves as an ideal model for exploring other graph polynomials
in Chap. 10. Furthermore, because of the Tutte polynomial’s long history, extensive
study, and its universality property, it is often a “point of contact” for research
into other graph polynomials in that their study frequently includes exploring their
relations to the Tutte polynomial. These interrelationships are a central theme of the
Chap. 10.
In this chapter we give both recursive and generating function formulations of the
Tutte polynomial, and state its universality in the form of a recipe theorem. We give
a number of properties and combinatorial interpretations for various evaluations of
the Tutte polynomial. We recover colorings, flows, orientations, network reliability,
etc., and related polynomials as specializations of the Tutte polynomial. We discuss
the coefficients, zeros, and derivatives of the Tutte polynomial, and conclude with a
brief discussion of computational complexity.
9.2 Preliminary Notions
The graph terminology that we use is standard and generally follows Diestel [26].
Graphs may have loops and multiple edges. For a graph G we denote by V .G/ its
E also called a
set of vertices and by E.G/ its set of edges. An oriented graph, G,
digraph, has a direction assigned to each edge.
9.2.1 Basic Concepts
We first recall some of the notions of graph theory most used in this chapter. Two
graphs G1 and G2 are isomorphic, denoted G1 ' G2 , if there exists a bijection
W V .G1 / ! V .G2 / with xy 2 E.G1 / if and only if .x/.y/ 2 E.G2 /. We
denote by .G/ the number of connected components of a graph G, and by c.G/
the number of nontrivial connected components, that is, the number of connected
9 The Tutte Polynomial 221
components not counting isolated vertices. A graph is k-connected if at least k

vertices must be removed to disconnect the graph.
A cycle in a graph G is a set of edges e1 ; : : : ; ek such that, if ei D vi wi for
1 i k, then wi D vi C1 for 1 i k 1; also wk D v1 and vi ¤ vj for
i ¤ j . A trail is a path that may revisit a vertex, but not retrace an edge. A circuit
is a closed trail, and thus a cycle is just a circuit that does not revisit any vertices. In
the case of a digraph, the edges of a trail or circuit must be consistently oriented.
The dual notion of a cycle is that of cut or cocycle. If fV1 ; V2 g is a partition of the
vertex set, and the set C , consisting of those edges with one end in V1 and one end
in V2 , is not empty, then C is called a cut. A cycle with one edge is called a loop
and a cocycle with one edge is called a cut-edge or bridge. We refer to an edge that
is neither a loop nor a bridge as ordinary.
A tree is a connected graph without cycles. A forest is a graph whose connected
components are all trees. A subgraph H of a graph G is spanning if V .H / D V .G/.
Spanning trees in connected graphs play a fundamental role in the theory of the
Tutte polynomial. Observe that a loop in a connected graph can be characterized
as an edge that is in no spanning tree, while a bridge is an edge that is in every
spanning tree.
If V 0 V .G/, then the induced subgraph on V 0 has vertex set V 0 and edge
set those edges of G with both endpoints in V 0 . If E 0 E.G/, then the spanning
subgraph induced by E 0 has vertex set V .G/ and edge set E 0 .
9.2.2 Deletion and Contraction
The operations of deletion and contraction of an edge are essential to the study of
the Tutte polynomial. The graph obtained by deleting an edge e 2 E.G/ is just
Gne WD .V; Ene/. The graph obtained by contracting an edge e in G results from
identifying the endpoints of e followed by removing e, and is denoted G=e. When
e is a loop, G=e is the same as Gne. It is not difficult to check that both deletion
and contraction are commutative, and thus, for a subset of edges A, both GnA and
G=A are well defined. Also, if e ¤ f , then Gne=f and G=f ne are isomorphic;
thus for disjoint subsets A; A0 E.G/, the graph GnA=A0 is well defined. A graph
H isomorphic to GnA=A0 for some choice of disjoint edge sets A and A0 is called
a minor of G. A class G of graphs is minor closed if whenever G is in G then any
minor of G is also in the class.
A graph invariant is a function f on the class of all graphs such that
f .G1 / D f .G2 / whenever G1 ' G2 :
A graph polynomial is a graph invariant where the image lies in some polynomial
ring.
9.2.3 The Rank and Nullity Functions for Graphs
To simplify notation, we typically identify a subset of edges A of a graph G with

the spanning subgraph of G that A induces. Thus, for a fixed graph G we have the
following rank and nullity functions on the lattice of subsets of E.G/.
Definition 9.2.1. For A E.G/, the rank and nullity of A, denoted r.A/ and n.A/
respectively, are defined as
r.A/ WD jV .G/j .A/ and n.A/ WD jAj r.A/:
Three special graphs are important. One is the rank 0 graph L consisting of a
single vertex with one loop edge, another is the rank 1 graph B consisting of two
vertices with one bridge edge between them, and the third one is the edgeless graph
E1 on one vertex.
9.2.4 Planar Graphs and Duality
A graph is planar if it can be drawn in the plane without edges crossing, and it
is called a plane graph if it is so drawn in the plane. A drawing of a graph in the
plane separates the plane into regions called faces. Every plane graph G has a dual
graph, G , formed by assigning a vertex of G to each face of G and joining two
vertices of G by k edges if and only if the corresponding faces of G share k edges
in their boundaries. Notice that G is always connected. If G is connected, then
.G / D G. If G is planar, in principle it may have many plane duals, but when G is
3-connected, all its plane duals are isomorphic. This is not the case when G is only
2-connected.
There is a natural bijection between the edge set of a planar graph G and the
edge set of G , any one of its plane duals, so we can assume that G and G have
the same edge set E. It is easy to check that A E is a spanning tree of G if and
only if E n A is a spanning tree of G . Thus, a planar graph and any of its plane
duals have the same number of spanning trees. Furthermore, if G is a planar graph
with rank function r, and G is any of its plane duals, then the rank function of G ,
denoted r , can be expressed as
r .A/ D jAj r.E/ C r.E n A/: (9.1)
These observations reflect a deeper relation between G and G that we will see
captured by the Tutte polynomial at the end of Sect. 9.3.2.
9.3 Defining the Tutte Polynomial
Here we present several very different, but nevertheless equivalent, definitions of

the Tutte polynomial. The interplay among these different formulations is a source
of many powerful tools developed to analyze the Tutte polynomial. Furthermore,
each formulation lends itself to different proof techniques, for example, induction
with the linear recursion form and Möbius inversion with the generating function
form. These different formulations also are representative of some of the most com-
mon ways of defining any graph polynomial, although we also demonstrate other
methods in Chap. 10.
While space prohibits including full proofs of the equivalence of these various
expressions for the Tutte polynomial, we note that there are several approaches.
One direct way is to specify the linear recursion form as the definition of the Tutte
polynomial and then use induction on the number of edges to show that it is equiv-
alent to either the rank-nullity generating function or the spanning trees expansion.
Showing that the linear recursion form is equivalent to the rank generating function
form also establishes the essential fact that it is well defined, that is, independent of
the order in which the edges are deleted and contracted. Another common approach
is to establish some definition of the Tutte polynomial, then prove from it that the
Tutte polynomial has the universality property discussed in Sect. 9.4. This univer-
sality property may then be applied to show that some other function is equivalent
to, or an evaluation of, the Tutte polynomial.
The spanning trees expansion formulation in Sect. 9.3.3 was the approach orig-
inally used by Tutte to develop versions of this and similar polynomials. See
Tutte [101, 103, 104]. A particularly lucid proof of the equivalence between the
rank-nullity generating function definition of Definition 9.3.3 and the spanning trees
expansion definition of Definition 9.3.5 can be found in [11]. That the Tutte polyno-
mial has a deletion/contraction reduction was shown by Tutte [101, 102, 104] (also
see Brylawski [15], and Oxley and Welsh [71]).
9.3.1 Linear Recursion Definition
Broadly speaking, a linear recursion relation is a set of reduction rules together

with an evaluation for the terminal forms. The reduction rules rewrite a graph as
a weighted (formal) sum of graphs that are in some way “smaller” or “simpler”
than the original graph. Furthermore, the reduction rules again apply to the newly
generated simpler graphs, hence the recursion. This recursion process eventually
terminates in a well-defined set of “most simple” graphs, which are no longer re-
ducible by the reduction rules. These are then each identified with a monomial of
independent variables to yield a polynomial. It is essential to show that the reduction
rules are independent of the order in which they are applied and that they do in fact
terminate. See Yetter [114] for a more formal treatment.
The Tutte polynomial may be defined by a linear recursion relation given by

deleting and contracting ordinary edges. The “most simple” terminal graphs are
then just forests with loops.
Definition 9.3.1. If G D .V; E/ is a graph, and e is an ordinary edge, then
T .GI x; y/ D T .G n eI x; y/ C T .G=eI x; y/: (9.2)
Otherwise, G consists of i bridges and j loops and
T .GI x; y/ D x i y j : (9.3)
In other words, T may be calculated recursively by specifying an ordering of

the edges and repeatedly applying (9.2). Remarkably, the Tutte polynomial is well
defined in that the polynomial resulting from this recursive process is independent
of the order in which the edges are chosen. One way to prove this is by showing that
this definition is equivalent to the rank generating form we see in Definition 9.3.3.
A proof can be found in [17], for example.
Figure 9.1 gives a small example of computing T using (9.2) and (9.3) for K4
minus one edge. By adding the monomials at the bottom of Fig. 9.1 we find that
T .GI x; y/ D x 3 C 2x 2 C x C 2xy C y C y 2 .
Recall that a one-point join G H of two graphs G and H is formed by iden-
tifying a vertex u of G and a vertex v of H into a single vertex w (necessarily a cut
vertex) of G H . Also, G [ H is the disjoint union of G and H .
Proposition 9.3.2. If G and H are graphs then
T .G [ H / D T .G/ T .H / and T .G H / D T .G/ T .H /:
This follows readily from Definition 9.3.1 by induction on the number of ordinary
edges in G H or G [ H .
Fig. 9.1 An example

of computing the Tutte
polynomial recursively
9.3.2 Rank-Nullity Generating Function Definition
A generating function can often be thought of as a (possible infinite) polynomial

whose coefficients count structures that are encoded by the exponents of the vari-
ables. Because generating functions count, which is at the very heart of enumerative
combinatorics, there is extensive literature on them. Stanley’s two volumes [97]
and [98] are an excellent resource. In the case of the Tutte polynomial, there are
several different generating function formulations, each of which has its advantages.
We give one here and another in Sect. 9.3.3, with a variation in Sect. 9.7.2, and refer
the readers to Brylawski and Oxley [17] for additional forms.
Definition 9.3.3. If G D .V; E/ is a graph, then the Tutte polynomial of G has the
following expansion:
X
T .GI x; y/ D .x 1/r.E /r.A/ .y 1/n.A/ : (9.4)
AE
The advantage of a generating function formulation is that it facilitates counting.

For example, interpretations for several evaluations of the Tutte polynomial given
in Sect. 9.5 follow immediately from Definition 9.3.3.
We can also deduce the following pleasing property of the Tutte polynomial.
Proposition 9.3.4. If G is a planar graph with dual G then
T .GI x; y/ D T .G I y; x/: (9.5)
This result follows from routine checking using Definition 9.3.3 and (9.1).
9.3.3 Spanning Trees Expansion Definition
We need to develop a little terminology before presenting the spanning trees defini-
tion of the Tutte polynomial. First, given a spanning tree S and an edge e 62 S , there
is a cycle defined by e, namely the unique cycle in S [ e. Similarly, for an edge
f 2 S , there is a cut defined by f , namely the set of edges C such that if f 0 2 C ,
then .S f / [ f 0 is a spanning tree.
Assume there is a total ordering on the edges of G, say E D fe1 ; : : : ; em g,
where ei ej if i < j . Given a fixed tree S , an edge f is called internally active
if f 2 S and it is the smallest edge in the cut defined by f . Dually, an edge e
is externally active if e 62 S and it is the smallest edge in the cycle defined by e.
The internal activity of S is the number of its internally active edges and its external
activity is the number of externally active edges. With this, we have the following
definition of the Tutte polynomial.
Definition 9.3.5. If G is a connected graph with a total order on its edge set, then
X
T .GI x; y/ D tij x i y j ; (9.6)
i;j
where tij is the number of spanning trees with internal activity i and external
activity j .
Two important observations follow immediately from the equivalence of
Definitions 9.3.3 and 9.3.5. One is that the terms tij in Definition 9.3.5 are in-
dependent of the total order used in the edge set, since there is no ordering of the
edges in Definition 9.3.3. The other is that the coefficients in Definition 9.3.3 must
be nonnegative since the coefficients in Definition 9.3.5 clearly are.
9.4 Universality of the Tutte Polynomial
The universality property discussed here is one of the most powerful aspects of the
Tutte polynomial. It says that essentially any graph invariant that is multiplicative
on disjoint unions and one-point joins of graphs and that has a deletion/contraction
reduction must be an evaluation of the Tutte polynomial. Several applications of this
theorem appear throughout the rest of this chapter and in the next chapter as well.
Various generalizations of the Tutte polynomial are careful to retain this essential
property, and analogous universality properties are sought in the context of other
graph polynomials.
Definition 9.4.1. Let G be a minor closed class of graphs. A graph invariant f from
G to a commutative ring R with unity is called a generalized Tutte–Gröthendieck
invariant, or T–G invariant, if f .E1 / is the unity of R, if there exist fixed elements
a; b 2 R such that for every graph G 2 G and every ordinary edge e 2 G; then
f .G/ D af .G n e/ C bf .G=e/I (9.7)
and if for every G; H 2 G, whenever G [ H or G H is in G, then
f .G [ H / D f .G/f .H / and f .G H / D f .G/f .H /: (9.8)
Thus, the Tutte polynomial is a T–G invariant, and in fact, since the following
two results give both universal and unique extension properties, it is essentially the
only T–G invariant, in that any other must be an evaluation of it. Theorem 9.4.2 is
known as a recipe theorem since it specifies how to recover a T–G invariant as an
evaluation of the Tutte polynomial.
Theorem 9.4.2. Let G be a minor closed class of graphs, let R be a commutative
ring with unity, and let f W G ! R. If there exists a; b 2 R such that f is a T–G
invariant, then
x0 y0
f .G/ D ajE.G/jr.E.G// b r.E.G// T GI ; ; (9.9)
b a
where f .B/ D x0 and f .L/ D y0 .
Furthermore, we have the following unique extension property, which says that
if we specify any four elements a; b; x0 ; y0 2 R, then there is a unique well-defined
T–G invariant on these four elements.
Theorem 9.4.3. Let G be a minor closed class of graphs, let R be a commutative

ring with unity, and let a; b; x0 ; y0 2 R. Then there is a unique T–G invariant f W
G ! R satisfying Definition 9.4.1 with f .B/ D x0 and f .L/ D y0 . Furthermore,
this function f is given by
x y
0 0
f .G/ D ajE.G/jr.E.G// b r.E.G// T GI ; : (9.10)
b a
If a or b are not units of R, then (9.9) and (9.10) are interpreted to mean using
expansion (9.4) of Definition 9.3.3, and cancelling before evaluating.
These results can be proved by induction on the number of ordinary edges
from the deletion/contraction definition of the Tutte polynomial. See, for example,
Brylawski [15], Oxley and Welsh [71], Brylawski and Oxley [17], Welsh [109], and
Bollobás [11] for detailed discussions of these theorems and their consequences.
Examples applying this important theorem may be found throughout Sect. 9.6,
where it may be used to show that all of the graph polynomials surveyed there are
evaluations of the Tutte polynomial.
9.5 Combinatorial Interpretations of Some Evaluations
A graph polynomial encodes information about a graph. The challenge is in ex-

tracting combinatorially useful information from this algebraic object. A number
of successful techniques have evolved for meeting this challenge, and we use the
Tutte polynomial to showcase some of them while simultaneously demonstrating
the richness of the information encoded by the Tutte polynomial.
9.5.1 Spanning Subgraphs
Spanning subgraphs, and in particular spanning trees, play a fundamental role in the
theory of Tutte polynomials as we have already seen in Definition 9.3.5. This is also
reflected in the most readily attainable interpretations for evaluations of the Tutte
polynomial, which enumerate various spanning subgraphs. We begin with these
here, writing £.G/ for the number of spanning trees of a connected graph G.
Theorem 9.5.1. If G D .V; E/ is a connected graph then:

1. T .GI 1; 1/ equals £.G/.
2. T .GI 2; 1/ equals the number of spanning forests of G.
3. T .GI 1; 2/ equals the number of spanning connected subgraphs of G.
4. T .GI 2; 2/ equals 2jE j .
Proof. To illustrate common proof techniques, we give two short proofs of the first
statement. The remaining statements may be proved similarly. When x D y D 1,
the nonvanishing terms in the rank-nullity expansion (9.4) are A E such that
r.E/ D r.A/ and jAj D r.A/. That r.E/ D r.A/ implies that A has the same
number of connected components as G, namely one, so .V; A/ is connected. Then
jAj D r.A/ implies that jAj D jV j 1, so A must be a tree, and hence a span-
ning tree.
Alternatively, we can use Theorem 9.4.2. Let £0 .G/ be the number of maximal
spanning forests in a general (not necessarily connected) graph G. We prove that
T .GI 1; 1/ D £0 .G/. Then, if G is connected, we will have that T .GI 1; 1/ D
£0 .G/ D £.G/. Note that the number of maximal spanning forests has a dele-
tion/contraction reduction for ordinary edges; that is, if G is a graph and e is an
ordinary edge of G, then £0 .G/ D £0 .Gne/C£0 .G=e/. This follows because the max-
imal spanning forests of G can be partitioned into the maximal spanning forests that
do not contain e and those that do contain e. The former are the maximal spanning
forests of Gne and the latter are in one-to-one correspondence with the maximal
spanning forests of G=e.
The result then follows immediately from Theorem 9.4.2 with a D b D x0 D
y0 D 1. t
u
Computing the number of spanning trees of a graph is easy in that there are
polynomial time algorithms to do it. One of these involves a determinant. Recall
that the Laplacian matrix L of a graph G with vertices v1 ; : : : ; vn is the nn-matrix
defined by
(
deg.i / if i D j
Lij D (9.11)
r if r is the number of edges between vertices i and j :
Theorem 9.5.2. If G is a connected graph with Laplacian L, then
T .GI 1; 1/ D £.G/ D Det.L0 /; (9.12)
where L0 is any cofactor of L.

A proof of this can be found in [1, 6] using the Binet–Cauchy formula and that
L D DD t , where D is the incidence matrix of (an orientation of) G.
This result not only provides an interpretation of the Tutte polynomial at .1; 1/
in terms of the incidence matrix of a graph, but also proves that .1; 1/ is one of
the (very few see Sect. 9.8) points where the Tutte polynomial can be computed in
polynomial time.
9.5.2 The Tutte Polynomial when y D x
Combinatorial interpretations are known for the Tutte polynomial at all integer
values along the line y D x. In addition to those for T .G; 1; 1/ and T .G; 2; 2/ pre-
viously given, we have the following interpretation for T .GI 1; 1/ due to Read
and Rosenstiehl [76]. We also show alternative interpretations for T .GI 1; 1/ and
T .GI 3; 3/ in Sect. 9.5.3.
The incidence matrix D of a graph G defines a vector space over Z2 , called the
cycle space C. The bicycle space B is then just C \ C ? .
Theorem 9.5.3. T .GI 1; 1/ D .1/jE j .2/dim.B/ .
One method of extracting information from a graph polynomial is via its relation
to some other graph invariant. The following interpretations for the Tutte polyno-
mial of a planar graph along the line x D y derive from its relation to the Martin
polynomial [61], m.GI E x/, a one-variable graph polynomial for Eulerian digraphs
that we discuss further in Chap. 10.
We first recall that the medial graph of a connected planar graph G is constructed
by placing a vertex on each edge of G and drawing edges around the faces of G.
The faces of this medial graph are colored black or white, depending on whether
they contain or do not contain, respectively, a vertex of the original graph G. This
face two-colors the medial graph. The edges of the medial graph are then directed
so that the black face is on the left. We refer to this as the directed medial graph of
!
G and denote it by Gm . An example is given in Fig. 9.2.
Martin [61] showed that, for a planar graph G, the relation between the Martin
!
polynomial and Tutte polynomial is m.Gm I x/ D T .GI x; x/. Evaluations for the
Martin polynomial in [32] then give the following interpretations of the Tutte poly-
nomial.
!
Let Dn .Gm / D f.D1 ; : : : ; Dn /g, where .D1 ; : : : ; Dn / is an ordered partition
!
of E.Gm / into n subsets such that G restricted to Di is 2-regular and consistently
oriented for all i .
!
Theorem 9.5.4. Let G be a planar graph with oriented medial graph Gm . Then, for
n a positive integer,
X Pn
.n/c.G/ T .GI 1 n; 1 n/ D .1/ i D1 c.Di / :

!
Dn .Gm /

!
Fig. 9.2 On the left-hand side we have a planar graph G. On the right-hand side we have Gm with
the vertex faces colored black, oriented so that black faces are to the left of each edge
!
Theorem 9.5.5. Let G be a planar graph with oriented medial graph Gm . Then, for
n a positive integer,
X
nc.G/ T .GI 1 C n; 1 C n/ D 2./ ;
!
where the sum is over all edge colorings of Gm with n colors so that each (possibly
empty) set of monochromatic edges forms an Eulerian digraph, and where ./ is
the number of monochromatic vertices in the coloring .
9.5.3 Orientations and Score Vectors
The combinatorial interpretations of the Tutte polynomial in Theorem 9.5.1 are

given in terms of the number of certain subgraphs of the graph G. However, they
can also be given in terms of orientations of the graph and its score vectors. Given
a graph G D .V; E/, an orientation of G may be obtained by directing every edge
from one of its endpoints to the other. From this follows that T .GI 2; 2/ equals the
number of possible orientations of G.
The score vector of an orientation GE is the vector (s1 , s2 , . . . , sn ) such that vertex
i has outdegree si in the orientation. In the following theorem we gather several
similar results about the Tutte polynomial and orientations of a graph.
Theorem 9.5.6. Let G D .V; E/ is a connected graph with Tutte polynomial

T .GI x; y/. Then
1. T .GI 2; 0/ equals the number of acyclic orientations of G, that is, orientations

without oriented cycles.
2. T .GI 0; 2/ equals the number of totally cyclic orientations of G, that is, orienta-
tions in which every arc is in a directed cycle.
3. T .GI 1; 0/ equals the number of acyclic orientations with exactly one predefined
source v.
4. T .GI 2; 1/ equals the number of score vectors of orientations of G.
5. T .GI 0; 1/ equals the number of score vectors of strongly connected orientations,
that is, orientations where there is a directed path between each pair of vertices.
6. T .GI 1; 1/ equals the number of score vectors of all orientations with a given
vertex reachable from any other vertex.
Item 1 was proved by Stanley in [94] by using a deletion/contraction reduction; a

proof using the universality of the Tutte polynomial is given by Brylawski and Oxley
in [17]. For Items 2 and 3, see Green and Zaslavsky [43] and Las Vergnas [54]. The
former also gives the number of strongly connected orientations of G, and note that
the latter is independent of the choice of source vertex v. Item 4 was first proved by
Stanley in [95], with a bijective proof given by Kleitman and Winston in [52], and a
proof using Theorem 9.4.2 by Brylawski and Oxley in [17]. Comparing Item 4 with
Theorem 9.5.1, Item 2, shows that the number of score vectors equals the number
of spanning forests of G. For Items 5 and 6, see Gioan [39].
Some other evaluations of the Tutte polynomial can also be interpreted in terms
of orientations. Recall that an anticircuit in a digraph is a closed trail so that the
directions of the edges alternate as the trail passes through any vertex of degree
!
greater than 2. Note that in a 4-regular Eulerian digraph such as Gm , the set of
anticircuits can be found by pairing the two incoming edges and the two outgoing
edges at each vertex.
Two surprising results from Las Vergnas [56] and Martin [62] are the following.
Theorem 9.5.7. Let G is a connected planar graph. Then

!
T .GI 1; 1/ D .1/jE.G/j .2/a.Gm /1 (9.13)
and
!
T .GI 3; 3/ D K2a.Gm /1 ; (9.14)
!
where a.Gm / is the number of anticircuits in the directed medial graph of G and K
is some odd integer.
Comparing (9.13) to Theorem 9.5.3 gives the following corollary.
Corollary 9.5.8. If G is a connected planar graph, then the dimension of the bicycle
!
space is a.Gm / 1.
9.6 Some Specializations
Here we illustrate the wide range of applicability of the Tutte polynomial while
demonstrating some proof techniques for showing that a graph invariant is related to
the Tutte polynomial. The advantage of recognizing an application-driven function
as a specialization of the Tutte polynomial is that the large body of knowledge about
the Tutte polynomial is then available to inform the desired application. We say a
graph polynomial is a specialization of the Tutte polynomial if it may be recovered
from the Tutte polynomial by some substitution for x and y, with possibly some
prefactor.
For various substitutions along different algebraic curves in x and y, the Tutte
polynomial has interpretations as the generating function of combinatorial quantities
or numerical invariants associated with a graph. Some of these were considered long
before the development of the Tutte polynomial, and others were discovered to be
unexpectedly related to the Tutte polynomial. We survey six of the more well known
of these application-driven generating functions.
9.6.1 The Chromatic Polynomial
The chromatic polynomial, introduced by Birkhoff [8], and see also Whitney [112],
because of its theoretical and applied importance, has generated a large body of
work. Chia [21] provides an extensive bibliography on the chromatic polynomial,
and Dong et al. [29] give a comprehensive treatment.
For positive integer , a -coloring of a graph G is a mapping of V .G/ into the
set Œ D f1; 2; : : : ; g. Thus there are exactly n colorings for a graph on n vertices.
If is a -coloring such that .i / ¤ .j / for all ij 2 E, then is called a proper
(or admissible) coloring.
We wish to find the number, .GI /, of admissible -colorings of a graph G. As
noted by Whitney [112], the four-color theorem can be formulated in this general
setting as follows: If G is a planar graph, then .GI 4/ > 0.
The following theorem is due to Birkhoff in [8] and independently by Whitney
in [112]. We sketch the latter’s proof.
Theorem 9.6.1. If G D .V; E/ is a graph, then
X
.GI / D .1/jAj .A/ : (9.15)
AE
Proof. Let Pij be the set of -colorings such that vertices i and j receive the same
color. Let PNij be the complement of Pij in the set of -colorings. Then, the value
.GI / can be computed using the inclusion–exclusion principle.
ˇ ˇ
ˇ ˇ
ˇ\ ˇ
.GI / D ˇˇ PNij ˇˇ
ˇij 2E ˇ
Xˇ ˇ X ˇ ˇ
D n ˇPij ˇ C ˇPij \ Pkl ˇ
ij 2E ij;kl2E
ˇ ij ¤klˇ
ˇ\ ˇ
ˇ
jE j ˇ
ˇ
C .1/ ˇ Pij ˇˇ : (9.16)
ˇij 2E ˇ
ˇ ˇ
Every term is of the form ˇ\ij 2A Pij ˇ for some A E, and hence corresponds
to the subgraph .V; A/, where A is the set of edges given by the indices of the Pij ’s.
Thus, the cardinality of this set is the number of -colorings that have a constant
value on each of the connected components of .V; A/, that is, .A/ . The sum on the
right-hand side of (9.15) is then precisely (9.16). t
u
Thus, .GI / is a polynomial on and it is called the chromatic polynomial of

G. Some easily seen properties of .GI /, which can be found in Read’s seminal
work [75] on the chromatic polynomial, are the following.
Proposition 9.6.2. If G is a graph with chromatic polynomial .GI /, then:

1. If G has no edges, then .GI / D n .
2. If G has a loop, then .GI / D 0, for all .
3. .Kn I / D . 1/ . n C 1/.
4. If e is any edge of G, then
.GI / D .G n eI / .G=eI /:
Note that Items 1 and 4 together give a recursive alternative definition of the
chromatic polynomial.
Also in Read [75] is the following not so trivial, but not difficult to prove, prop-
erty of the chromatic polynomial.
Theorem 9.6.3. If G is the union of two vertex set induced subgraphs H1 and H2
such that the intersection H1 \ H2 is a vertex set induced subgraph isomorphic to
Kp , then
.H1 I /.H2 I /
.GI / D :
.Kp I /
Thus, although Proposition 9.6.2, Item 4 suggests that the chromatic polynomial
might be a T–G invariant, by Theorem 9.6.3, it is not multiplicative on the one point
join of two graphs. However, as is frequently the case, this can be addressed by
a simple multiplier; it is easy to check that .G/ .GI / is a T–G invariant. The
relation between the Tutte and chromatic polynomials may then be found by apply-
ing Theorem 9.4.2 with the help of Proposition 9.6.2, Item 4. We give an alternative
proof of this relationship deriving from Theorem 9.6.1.
Theorem 9.6.4. If G D .V; E/ is a graph, then
.GI / D .1/r.E / .G/ T .GI 1 ; 0/:
Proof. Since r.E/ r.A/ D .A/ .G/ we have that

X
.GI / D .1/jAj .A/
AE
X
D .1/r.E / .G/ .1/jAjr.A/ ./r.E /r.A/
AE
r.E / .G/
D .1/ T .GI 1 ; 0/;
with the last equality following from Definition 9.3.3. t
u
9.6.2 The Bad Coloring Polynomial
One way to generalize the chromatic polynomial is to count all possible colorings
of the graph G, not just proper colorings. In order to differentiate between proper
and improper colorings, we keep track of the edges between vertices of the same
color, calling them bad edges. This leads to the bad coloring polynomial.
Definition 9.6.5. The bad coloring polynomial is the generating function

X
B.GI ; t/ D bj .GI /t j ;
j
where bj .GI / is the number of -colorings of G with exactly j bad edges.

Now consider B.GI ; t C 1/, which can be written as
X
B.GI ; t C 1/ D .1 C t/jb./j ; (9.17)
WV !Œ
where b./ is the set of bad edges in the -coloring . With this last expression it is
again easy to get the relation to the Tutte polynomial using the following derivation
of Noble (private communication).
Theorem 9.6.6. For a graph G D .V; E/ we have that

Ct
B.GI ; t C 1/ D t r.E / .G/
T GI ;1 C t :
t
Proof.
X
B.GI ; t C 1/ D .1 C t/jb./j
WV !Œ
X X
D t jAj
WV !Œ Ab./
X X
D t jAj
AE WV !Œ
Ab./
X
D t jAj .A/ :
AE
Thus,
X
B.GI ; t C 1/ D t jAj .A/
AE
X r.E /r.A/
r.E / .G/
jAjr.A/
Dt t
t
AE

Dt r.E / .G/
T GI 1 C ; t C 1 :
t
t
u
Again, the above result could also be obtained from the universal property
of the Tutte polynomial given in Theorem 9.4.2 by applying it to B.GI N ; t/ D
.G/
B.GI ; t/ and verifying that:
N
1. B.GI N
; t/ D B.G N
n eI ; t/ C .t 1/B.G=eI ; t/, if e is an ordinary edge.
N N
2. B.GI ; t/ D t B.G n eI ; t/, if e is a loop.
N
3. B.GI N
; t/ D .t C 1/B.G=eI ; t/, if e is a bridge.
9.6.3 The Flow Polynomial
The dual notion to a proper -coloring is a nowhere zero -flow. A standard resource
for the material in this section is Zhang [116], and Jaeger [48] gives a good survey.
Let G be a graph with an arbitrary but fixed orientation, and let H be an Abelian
group with 0 as its identity element. An H -flow is a mapping of the oriented edges
E
E.G/ into the elements of the group H such that Kirchhoff’s law is satisfied at each
vertex of G; that is, X X
e/ C
.E e / D 0;
.E
eEDu!v eEDu v
for every vertex v, and where the first sum is taken over all arcs towards v and the
second sum is over all arcs leaving v. An H -flow is nowhere zero if never takes
the value 0.
By replacing the group element on an edge e by its inverse, it is clear that two
orientations that differ only in the direction of exactly one arc eE have the same
number of nowhere zero H -flows for any H . Thus, this number does not depend
on the choice of orientation of G. In fact, when H is finite, it does not depend
on the structure of the group, but rather only on its cardinality. The following, due
to Tutte [103], relates the number of nowhere zero flows of G over a finite group
and Tutte polynomial of G. The reason for the notation becomes clear with
Corollary 9.6.8.
Theorem 9.6.7. Let G D .V; E/ be a graph and H a finite Abelian group. If
.GI H / denotes the number of nowhere zero H -flows then
.GI H / D .1/jE jr.E / T .GI 0; 1 jH j/:
Proof (sketch). Here we use the universality of the Tutte polynomial. If e is an

ordinary edge of G, then the number of nowhere zero H -flows in G=e can be parti-
tioned into two sets P1 and P2 . We let P1 consist of those that are also nowhere zero
H -flows in G n e, and P2 be the complement of P1 . Clearly then jP1 j D
.G n eI H /. Furthermore, there is a bijection between the elements in P2 and the
nowhere zero H -flows in G, and thus jP2 j D .GI H /. It follows that
.GI H / D .G n eI H / .G=eI H /;
and hence .GI H / satisfies (9.7). It is also easy to check that .GI H / satisfies
(9.8). Since .LI H / D 0 and .BI H / D jH j 1, the result follows from
Theorem 9.4.2. t
u
Consequently, .GI / is a polynomial called the flow polynomial which for
an integer at least 1 gives the number of nowhere zero flows of G in a group of order
. We call any nowhere zero H -flow simply a -flow if jH j D .
If the Abelian group is Z3 , and the graph is 4-regular, then the Tutte polynomial
at .0; 2/ counts the number of nowhere zero Z3 -flows on G. But these flows are
in one-to-one correspondence with orientations such that at each vertex exactly two
edges are directed in and two out. Such an orientation is called an ice configuration
of G (see Lieb [58] and Pauling [72] for this important model of ice and its physical
properties). Thus, we have the following corollary.
Corollary 9.6.8. If G is a 4-regular graph, then T .GI 0; 2/ equals the number of
ice configurations of G.
We mentioned previously that proper colorings are the dual concept of nowhere
zero flows, and now with Theorem 9.6.3 and (9.5) we observe that
.GI / D .G I /;
for G a connected planar graph and G , any of its plane duals. Thus, to each
-proper coloring in G corresponds nowhere zero Z -flows of G . A bijective
proof can be found in Diestel [26].
The four-color theorem and the duality relation between colorings and nowhere
zero H -flows then mean that every bridgeless planar graph has a 4-flow. For a cubic
graph, having a nowhere zero Z2 Z2 -flow is equivalent to being 3-edge-colorable.
Therefore, as the Petersen graph is not 3-edge-colorable, it has no 4-flow. However,
the Petersen graph does have a 5-flow. In fact, the famous 5-flow conjecture of
Tutte [103] postulates that every bridgeless graph has a 5-flow.
The 5-flow conjecture is clearly difficult as it is not even apparent that every graph
will have a -flow for some . However, Jaeger [47] proved that every bridgeless
graph has an Z2 Z2 Z2 -flow, thus every bridgeless graph has an 8-flow. Subse-
quently Seymour [85] proved that every bridgeless graph has a Z2 Z3 -flow, thus
every graph has a 6-flow.
Not much is currently known about properties of the flow polynomial apart from
those that can be deduced from its duality with the chromatic polynomial and efforts
to solve the 5-flow conjecture. However, for some recent work in this direction, see
Dong and Koh [28] and Jackson [46].
9.6.4 Abelian Sandpile Models
Self-organized criticality is a concept widely considered in various domains since

Bak et al. [4] introduced it. One of the paradigms in this framework is the Abelian
sandpile model, introduced by Dhar [25].
We begin by recalling the definition of the general Abelian sandpile model on a

set of N sites labeled 1, 2, : : : , N , that we refer to as the system. A sandpile at each
site i has height given by an integer hi . The set hE D fhi g is called a configuration of
the system. For every site i , a threshold Hi is defined; configurations with hi < Hi
for all i are called stable. For every stable configuration, the height hi increases
in time at a constant rate; this is called the loading of the system. This loading
continues until hi Hi for some i . The site i then “topples” and all the values hj ,
for 1 j N , are updated according to the rule:
hj D hj Mij ; for all j; (9.18)
where M is a given fixed integer matrix satisfying

X
Mi i > 0; Mij 0 and si D Mij 0:
j
If, after this redistribution, the height at some vertex exceeds its threshold, we again
apply the toppling rule (9.18), and so on, until we arrive at a stable configuration and
the loading resumes. The sequence of topplings is called an avalanche. We assume
that an avalanche is “instantaneous”, so that no loading occurs during an avalanche.
The value si is called the dissipation at site i . We say that si is dissipative if
si > 0 and nondissipative if si D 0. It may happen that an avalanche continues with-
out end. We can avoid this possibility by requiring that from every non-dissipative
site i , there exists a path to a dissipative site j . In other words, there is a sequence
i0 ; : : : ; in , with i0 D i , in D j and Mik1 ;ik < 0, for k D 1; : : : ; n. In this case,
following Gabrielov [37], we say that the system is weakly dissipative, and we as-
sume that a system is always weakly dissipative. In a weakly dissipative system,
any configuration hE will eventually arrive at a stable configuration. But the process
is infinite, and the stable configurations are clearly finite. Thus, some stable config-
urations recur, and these are called critical configurations.
The sandpile process has an Abelian property, in that if at some stage, two sites
can topple, the resulting stable configuration after the avalanche is independent of
the order in which the sites toppled. Thus, for any configuration h, E the process even-
tually arrives at a unique critical configuration cE.
Let G be a connected graph, q 2 V .G/, and L0 be the minor of the Laplacian
of G resulting from deleting the row and column corresponding to q. When the
matrix M is L0 for some vertex q, the Abelian sandpile model coincides with the
chip-firing game or dollar game on a graph that was defined by Biggs [7]. For
the rest of this section we assume M is given in this way.
For a configuration h, E we define its weight to be w.h/E D PN hi . If cE is a
i D0
critical configuration, we define its level as
c / D w.E
level.E c / jE.G/j C deg.q/:
This definition may seem a little unnatural, but it is justified by the following
theorem of Biggs [7], which tells us that it is actually the right quantity to consider
if we want to grade the critical configurations.
Theorem 9.6.9. If G D .V; E/ is a connected graph and hE a critical configuration
of G, then
E jEj jV j C 1:
0 level.h/
The rightmost quantity is called the cyclomatic number of G. We now consider the
generating function of these critical configurations.
Definition 9.6.10. Let G D .V; E/ be a graph and for nonnegative integers i let ci
be the number of critical configurations with level i . Then the critical configuration
polynomial is
jE jjV
XjC1
Pq .GI y/ D ci y i :
i D0
Theorem 9.6.11. For a connected graph G and any vertex q, the generating func-
tion of the critical configurations equals the Tutte polynomial of G along the line
x D 1, that is,
Pq .GI y/ D T .GI 1; y/;
and thus Pq .GI y/ is independent of the choice of q.

A proof using deletion and contraction of an edge incident with the special vertex
q can be found in [64].
New combinatorial identities frequently arise when a new generating function
can be shown to be related to the Tutte polynomial, as in the following corollary.
Corollary 9.6.12. If G is a connected graph, then the number of critical configu-
rations of G is equal to the number of spanning trees, and the number of critical
configurations with level 0 is equal to the number of acyclic orientations with a
unique source.
This follows from comparing Theorem 9.6.11 with Theorems 9.5.1 and 9.5.6.
9.6.5 The Reliability Polynomial
Many of the invariants reviewed thus far have various applications in the sci-
ences, engineering, and computer science. However, when a graph models some
kind of network (e.g., electrical, communication, etc.), then the applicability of
the reliability polynomial we discuss next is particularly apparent.
Definition 9.6.13. Let G be a connected graph or network with n vertices and m
edges, and suppose that each edge is independently chosen to be active with proba-
bility p. Then the (all terminal) reliability polynomial is
X
R.GI p/ D p jAj .1 p/jE Aj
A spanning
connected
(9.19)
X
mnC1
D gk p kCn1
.1 p/ mknC1
;
kD0
where gk is the number of spanning connected subgraphs with k C n 1 edges.

Thus the reliability polynomial, R.GI p/, is the probability that in this random
model there is a path of active edges between each pair of vertices of G. In other
words, it gives the probability that the overall network is functioning.
Theorem 9.6.14. If G is a connected graph with m edges and n vertices, then

1
R.GI p/ D p n1 .1 p/mnC1 T GI 1; :
1p
Proof. We first note from the rank generating expansion of Definition 9.3.3 that
X
mnC1
T .GI 1; y C 1/ D gk y k ;
kD0
since the only nonvanishing terms are those corresponding to A E with r.E/ D
r.A/, that is, spanning connected subgraphs.
We then observe that
X
mnC1
R.GI p/ D gk p kCn1 .1 p/mknC1
kD0
X
mnC1 k
p
D p n1 .1 p/mnC1 gk
1p
kD0

p
Dp n1
.1 p/ GI 1; 1 C
mnC1
T
1p

1
D p n1 .1 p/mnC1 T GI 1; :
1p
t
u
If we extend the reliability polynomial to graphs with more than one component
by defining R.G [ H I p/ WD R.G; p/R.H; p/, then this result may also be proved
using the universality property of the Tutte polynomial. Observe that if an ordi-
nary edge is not active (this happens with probability 1 p), then the reliability
of the network is the same as if the edge were deleted. Similarly, if an edge is ac-
tive (which happens with probability p), then the reliability is the same as it would
be if the edge were contracted. Thus, the reliability polynomial has the following
deletion/contraction reduction:
R.GI p/ D .1 p/R.G n e/ C pR.G=e/:
With this, and noting that R.G H I p/ D R.GI p/R.H I p/ with R.L; p/ D 1
and R.BI p/ D p, Theorem 9.6.14 also follows immediately from Theorem 9.4.2.
There is a vast literature about reliability and the reliability polynomial; for a
good survey, including a wealth of open problems, we refer the reader to Chari and
Colbourn [20].
9.6.6 The Shelling Polynomial
A simplicial complex is a collection of subsets of a set of vertices V such that if

v 2 V , then fvg 2 , and also if F 2 and H F , then H 2 . The elements
of are called faces. Maximal faces are called facets, and if all the facets have the
same cardinality, is called pure. The dimension of a face is its cardinality minus
one and the dimension of a pure simplicial complex is the dimension of any of its
facets.
If fk is the number of faces of cardinality k in a simplicial complex , then the
vector (f0 , f1 , . . . , fd ) is called the face vector or f -vector of , and
X
d
f .x/ D fk x d k ; (9.20)
kD0
is the generating function of the faces of , or face enumerator.

The collection of spanning forests of a connected graph G forms a pure .d 1/-
dimensional simplicial complex .G/. The points of .G/ are the nonloop edges of
G and its facets are the spanning trees, so d D r.E/. The collection of complements
of spanning connected subgraphs of G also forms a pure .d 1/-dimensional
simplicial complex .G/. Here the elements are the nonbridge edges, while the
facets are complements of spanning trees, when viewed as subsets of E; in general,
if A is the edge set of a spanning connected subgraph of G of cardinality k C n 1,
then E n A is a face of size m n C 1 k in .G/. Thus, d D m n C 1 and if,
as before, gk is the number of spanning connected subgraphs with k C n 1 edges,
the f -vector of .G/ is .f0 ; : : : ; fd /, where fi D gd i .
Theorem 9.6.15. The Tutte polynomial gives the face enumerators for both .G/
and .G/:
X
d
T .GI x C 1; 1/ D fk x d k D f.G/ .x/;
kD0
and

X
d
i
T .GI 1; y C 1/ D fi y d D f .G/ .x/:
i D0
Proof. This follows readily by comparing (9.20) with Definition 9.3.3. t

u
For a pure simplicial complex , a shelling is a linear ordering of the facets
F1 , F2 , : : : , Ft such that, if 1 k t, then Fk meets the complex generated by
its predecessors, denoted k1 , in a nonempty union of maximal proper faces. A
complex is said to be shellable if it is pure and admits a shelling. A good exposition
of the following results can be found in Björner [9].
For 1 k t, define R.Fk / D fx 2 Fk j Fk n x 2 k1 g, where here 0 D ;.
The number of facets such that jFk R.Fk /j D i is denoted by hi and it does not
depend on the particular shelling (this follows, for example, from (9.21) below).
The vector (h0 , h1 , : : :, hd ) is called the h-vector of . The shelling polynomial is
the generating function of the h-vector, and is given by
X
d
h .x/ D hi x d i :
i D0
The face enumerator and shelling polynomial are related in a somewhat surpris-
ing way, namely
h .x C 1/ D f .x/: (9.21)
Both .G/ and .G/ are known to be shellable (see, for example, Provan and
Billera [74]), and thus (9.21) gives the following corollary to Theorem 9.6.15, relat-
ing the two shelling polynomials to the Tutte polynomial (see Björner [9]).
Corollary 9.6.16. Let G be a graph. Then
X
d
T .GI x; 1/ D h.M / .x/ D hi x d i
i D0
and

X
d
i
T .GI 1; y/ D h.G/ .y/ D hi y d :
i D0
The reader may have noticed that the reliability polynomial as well as the face
enumerator and shelling polynomial of .G/ are all specializations of the Tutte
polynomial along the line x D 1. There is an important open conjecture in algebraic
combinatorics about the h-vectors (and hence the shelling polynomials), of the two
complexes coming from a graph (or, more generally, a matroid), namely that they
are “pure O-sequences”. For more details see Stanley [96] or [65]. The latter also
relates the shelling polynomial and the chip firing game. Let G be a graph with
n vertices and m edges. From Corollary 9.6.16 and Theorem 9.6.11, we get that
ci D hmnC1i , where ci is the number of critical configurations of level i of G

and (h0 , . . . , hmnC1 ) is the h-vector of .G/. In [65] it is proved that (cmnC1 ,
. . . , c0 ) is a pure O-sequence. Thus, the conjecture is true for the simplicial complex
.G/ but is still open for .G/.
It is also clear from Theorem 9.6.14 and Corollary 9.6.16 that the reliability and
shelling polynomials are related. This connection is explored, and open questions
related to it presented, by Chari and Colbourn [20].
9.7 Some Properties of the Tutte Polynomial
There is a large and ever-growing body of information about properties of the Tutte
polynomial. Here, we present some of them, again with an emphasis on illustrating
general techniques for extracting information from a graph polynomial.
9.7.1 The Beta Invariant
Even a single coefficient of a graph polynomial can encode a remarkable amount

of information. It may characterize entire classes of graphs and have a number of
combinatorial interpretations. A noteworthy example is the ˇ invariant, introduced
(in the context of matroids) by Crapo in [23].
Definition 9.7.1. Let G D .V; E/ be a graph with at least two edges. The ˇ invari-
ant of G is X
ˇ .G/ D .1/r.G/ .1/jAj r .A/:
AE
The beta invariant is a deletion/contraction invariant; that is, it satisfies (9.7).

However, the ˇ invariant is zero if and only if G either has loops or is not
2-connected. Thus, the ˇ invariant is not a Tutte–Gröthendieck invariant in the sense
of Sect. 9.4. While the ˇ invariant may be defined to be 1 for a single edge or a sin-
gle loop, it still will not satisfy (9.8), and it is not multiplicative with respect to
disjoint unions and one-point joins. Nevertheless, the ˇ invariant derives from the
Tutte polynomial.
Theorem
P 9.7.2. If G has at least two edges, and we write T .GI x; y/ in the form
tij x i y j , then t0;1 D t1;0 , and this common value is equal to the ˇ invariant.
Proof. This can easily be proved by induction, using deletion/contraction for an

ordinary edge, and otherwise noting that the ˇ invariant is zero if the graph has
loops or is not 2-connected. t
u
The ˇ invariant does not change with the insertion of parallel edges or edges in
series. Thus, homeomorphic graphs have the same ˇ invariant. The ˇ invariant is
also occasionally called the chromatic invariant, because the derivative 0 .GI 1/ D
.1/r.G/ ˇ .G/, where .GI x/ is the chromatic polynomial.
Definition 9.7.3. A series–parallel graph is a graph constructed from a digon (two
vertices joined by two edges in parallel) by repeatedly adding an edge in parallel to
an existing edge, or adding an edge in series with an existing edge by subdividing
the edge. Series–parallel graphs are loopless multigraphs, and are planar.
Brylawski [14] and also [16], in the context of matroids, showed that the ˇ in-
variant completely characterizes series–parallel graphs.
Theorem 9.7.4. G is a series–parallel graph if and only if ˇ .G/ D 1.
Using the deletion/contraction definition of the Tutte polynomial, it is quite easy
to show that the ˇ invariant is unchanged by adding an edge in series or in parallel
to another edge in the graph. This, combined with the ˇ invariant of a digon being
one, suffices for one direction of the proof. The difficulty is in the reverse direc-
tion, and the proof is provided in [15] by a set of equivalent characterizations for
series–parallel graphs, one by excluded minors and another that the ˇ invariant is
1 for series–parallel graphs. For graphs, the excluded minor is K4 (cf. Duffin [30]
and Oxley [70]). Succinct proofs may also be found in Zaslavsky [115]. The fun-
damental observation, which may be applied to other situations, is that there is a
graphical element, here an edge which is in series or parallel with another edge,
which behaves in a tractable way with respect to the computation methods of the
polynomial.
The ˇ invariant has been explored further, for example, by Oxley in [70] and by
Benashski et al. in [5]. Oxley characterized 3-connected matroids with ˇ 4, and
a complete list of all simple 3-connected graphs with ˇ 9 is given in [5].
A wide variety of combinatorial interpretations have also been found for the ˇ
invariant. Most interpretations involve objects other than graphs, but we give two
graphical interpretations below. The first is due to Las Vergnas [55].
Theorem 9.7.5. Let G be a connected graph. Then 2ˇ .G/ gives the number of
orientations of G that have a unique source and sink, independent of their relative
locations.
This result is actually a consequence of a more general theorem giving an alter-

native formulation of the Tutte polynomial, which we discuss further in Sect. 9.7.2.
We also have the following result from [32].
Theorem 9.7.6. Let G D .V; E/ be a connected planar graph with at least two
edges. Then
1X
ˇD .1/c.E nP /C1 ;
2
E m which visit each vertex at least once.
where the sum is over all closed trails P in G
Like the interpretations for T .GI x; x/ given in Sect. 9.5.2, this result follows
from the Tutte polynomial’s relation to the Martin polynomial.
Graphs in a given class may have ˇ invariants of a particular form. McKee [63]
provides an example of this in dual-chordal graphs. A dual-chordal graph is
2-connected, 3-edge-connected, such that every cut of size at least four creates a
bridge. A graph has two vertices with three edges in parallel between them. A
dual-chordal graph has the property that it may be reduced to a graph by repeat-
edly contracting induced subgraphs of the following forms: digons, triangles, and
K2;3 ’s, where in all cases each vertex has degree 3 in G.
Theorem 9.7.7. If G is a dual-chordal graph, then ˇ.G/ D 2a 5b . Here, a is the

number of triangles in G, where each vertex has degree 3 in G, that are contracted
in reducing G to a graph. Similarly, b is the number of induced K2;3’s in G, again
where each vertex has degree 3 in G, that are contracted in reducing G to a graph.
The proof follows from considering the acyclic orientations of G with unique
source and sink and applying the results of Green and Zaslavsky [43].
9.7.2 Coefficient Relations
After observing that t1;0 D t0;1 in the development of the ˇ invariant, it is nat-
ural to ask if there are similar
P relations among the coefficients tij of the Tutte
polynomial T .GI x; y/ D tij x i y j and whether there are combinatorial interpre-
tations for these coefficients as well. The answer is yes, although less is known. The
most basic fact, and one which is not obvious from the rank-nullity formulation of
Definition 9.3.3, is that all the coefficients of the Tutte polynomial are nonnegative.
That t1;0 D t0;1 is one of an infinite family of relations among the coefficients of
the Tutte polynomial. Brylawski [16] has shown the following.
Theorem 9.7.8. If G is a graph with at least m edges, then

!
X
k X
ki
ki
.1/ j
tij D 0;
j
i D0 j D0
for k D 0; 1 : : : ; m 1.
Additionally, Las Vergnas in [55] found combinatorial interpretations in the con-

text of oriented matroids for these coefficients by determining yet another generating
function formulation for the Tutte polynomial. Las Vergnas [55] gives the following
specialization to orientations of graphs, and see also Gioan and Las Vergnas [40] for
a bijective interpretation of this result.
Theorem 9.7.9. Let G be a graph with a linear ordering of its edges. Let oi;j be
the number of orientations of G such that the number of edges that are smallest on
some consistently directed cocycle is i and the number of edges that are smallest on
a consistently directed cycle is j. Then
Fig. 9.3 A counterexample

to the unimodularity
conjecture
e
X
T .GI x; y/ D oi;j 2.i Cj / x i y j ;
i;j
and thus tij D oi;j =.2i Cj /.
The proof is modeled on Tutte’s proof that the tij ’s are independent of the order-
ing of the edges by using deletion/contraction on the greatest edge in the ordering.
Another natural question is to ask if these coefficients are unimodular or perhaps
log concave, for example in either x or y. While this was originally conjectured to
be true (see Seymour and Welsh [86], Tutte [105]), then Schwärzler [83] found a
contradiction in the graph in Fig. 9.3. This counterexample can be extended to an
infinite family of counterexamples by increasing the number of edges parallel to e
or f .
The unimodularity question for the chromatic polynomial, raised by Read in [75],
is still unresolved.
9.7.3 Zeros of the Tutte Polynomial
Because the Tutte polynomial is after all a polynomial, it is natural to ask about its
zeros and factorizations. The importance of its zeros is magnified by their interpre-
tations. For example, since T .GI 0; y/ is essentially the flow polynomial, a root of
the form .0; 1 /, for a positive integer, means that G does not have a nowhere
zero flow for any Abelian group of order . Similarly, since T .GI x; 0/ is essentially
the chromatic polynomial, a root of the form .1 ; 0/ with a positive integer,
means that G cannot be properly colored with colors. In particular, a direct proof
the four-color theorem would follow if it could be shown that the Tutte polynomial
has no zero of the form .3; 0/ on the class of planar graphs. Of course, because of
the duality between the flow and chromatic polynomials, results for the zeros of the
one informs the other, and vice versa. Jackson [45] surveys zeros of both chromatic
and the flow polynomials.
As we discuss in Chap. 10, the chromatic polynomial has an additional interpreta-
tion as the zero-temperature antiferromagnetic Potts model of statistical mechanics.
In this context, its zeros correspond to numbers of spins for which the ground-state
degeneracy function may be nonanalytic. This has led to research into its zeros
by theoretical physicists as well as mathematicians. Traditionally, the focus from a

graph theory perspective was on positive integer roots of the chromatic polynomial,
corresponding to graphs not being properly colorable with q colors. In statistical
mechanics, however, the relevant quantity involves the limit of an increasing family
of graphs as the number, n, of vertices goes to infinity. This shifted the focus to the
complex roots of the chromatic polynomial, since the sequence of complex roots as
n ! 1 may have an accumulation point on the real axis.
Because of this, a significant body of work has emerged in recent years devoted
to clearing regions of the complex plane (in particular, regions containing inter-
vals of the real axis) of roots of the chromatic polynomial. Results showing that
certain intervals of the real axis and certain complex regions are free of zeros of
chromatic polynomials include those of Woodall [113], Jackson [44], Shrock and
Tsai [87, 88], Thomassen [99], Sokal [92], Procacci et al. [73], Choe et al. [22],
Borgs [12], and Fernandez and Procacci [36]. One particular question concerns the
maximum magnitude of a zero of a chromatic polynomial and of zeros compris-
ing region boundaries in the complex plane as the number of vertices n ! 1.
An upper bound is given by Sokal in [92], depending on the maximal vertex de-
gree. There are, however, families of graphs where both of these magnitudes are
unbounded (see Read and Royle [77], Shrock and Tsai [87, 89], Brown et al. [13],
and Sokal [93]). For recent discussions of some relevant research directions con-
cerning zeros of chromatic polynomials and properties of their accumulation sets
in the complex plane, as well as approximation methods, see, e.g., Shrock and
Tsai [88], Shrock [90], Sokal [91, 92], Chang and Shrock [18], Chang et al. [19],
Choe et al. [22], Dong and Koh [27], and more recently Royle [81, 82].
If G is a graph with chromatic number k C 1, then .GI x/ has integer roots at
0; 1; : : : ; k. Thus, the chromatic polynomial of G can be written as
.GI x/ D x a0 .x 1/a1 .x k/ak q.x/;
where a0 ; : : : ; ak are integers and q.x/ is a polynomial with no integer roots in the
interval Œ0; k. In contrast to this we have the following result of Merino et al. [66].
Theorem 9.7.10. If G is a 2-connected graph, then T .GI x; y/ is irreducible in

ZŒx; y.
The proof is quite technical and it heavily relies on Theorem 9.7.8 and that
ˇ.G/ ¤ 0 if and only if G has no loops and it is 2-connected.
If G is not 2-connected, then T .GI x; y/ can be factored. From Proposition 9.3.2
we get that if G is a disconnected
Q graph with connected components G1 ; : : : ; G ,
then T .GI x; y/ D i D1 T .Gi I x; y/. So we assume G is connected but
not 2-connected.
One of the basic properties mentioned in [17] is that y s jT .GI x; y/ if and only if
G has s loops. Thus, we assume G is loopless and connected but not 2-connected.
It is well known that such graphs have a decomposition into their blocks; see, for
example, [11]. A block of a graph G is either a bridge or a maximal 2-connected
subgraph. If two blocks of G intersect, they do so in a cut vertex. By Theorem 9.7.10

and Proposition 9.3.2 we get the following.
Corollary 9.7.11. If G is a loopless connected graph that is not 2-connected with
blocks H1 ; : : : ; Hp , then the factorization of T .GI x; y/ in ZŒx; y is exactly
T .GI x; y/ D T .H1 I x; y/ T .Hp I x; y/:
9.7.4 Derivatives of the Tutte Polynomial
It is also most natural to differentiate the Tutte polynomial and to ask for combina-
torial interpretations of its derivatives. For example, Las Vergnas [57] has found the
following combinatorial interpretation of the derivatives of the Tutte polynomial. It
first requires a slight generalization of the notions of internal and external activities
given in Sect. 9.3.3.
Definition 9.7.12. Let G D .V; E/ be a graph with a linear order on its edges, and
let A E. An edge e 2 A and a cut C are internally active with respect to A
if e 2 C .EnA/ [ feg and e is the smallest element in C . Similarly, an edge
e 2 EnA and a cycle C are externally active with respect to A if e 2 C A [ feg.
In the case that A is a spanning tree, this reduces to the previous definitions of
internally and externally active.
Theorem 9.7.13. Let G be a graph with a linear ordering on its edges. Then
@pCq X
p q
T .GI x; y/ D pŠ qŠ x in.A/ y ex.A/ ;
@x @y
where the sum is over all subsets A of the edge set of G such that r .G/ r .A/ D p
and jAj r .A/ D q, and where in.A/ is the number of internally active edges with
respect to A, and ex.A/ is the number of externally active edges with respect to A.
The proof begins by differentiating the spanning tree definition of the Tutte poly-
nomial, Definition 9.3.5, which gives a sum over i and j restricted by p and q. This
is followed by showing that the coefficients of x i p y j q enumerate the edge sets
described in the theorem statement. The enumeration comes from examining, for
each subset A of E, the set of e 2 EnA such that there is a cut-set of G contained
in EnA with e as the smallest element (and dually for cycles).
The Tutte polynomial along the line x D y is a polynomial in one variable that,
for planar graphs, is related to the Martin polynomial via a medial graph construc-
tion. From this relationship, [31] derives an interpretation for the n-th derivatives of
this one variable polynomial evaluated at 2 in terms of edge disjoint closed trails in
the oriented medial graph.
Definition 9.7.14. For an oriented graph G E , let Pn be the set of ordered n-tuples
pN WD .p1 ; : : : ; pn /, where the pi ’s are consistently oriented edge-disjoint closed
E
trails in G.
!
Theorem 9.7.15. If G is a connected planar graph with oriented medial graph Gm ,
then, for all nonnegative integers n,
ˇ
@n ˇ X
n
nŠ X
T .GI x; x/ˇˇ D .1/nk N
2m.p/ ;
@x xD2 kŠ
!
kD0 N
p2P k Gm
!
N is the number of vertices of Gm not belonging to any of the trails in p.
where m .p/ N
9.7.5 Convolution and the Tutte Polynomial
Since the Tutte polynomial can also be formulated as a generating function, the tools
of generating functions, such as Möbius inversion and convolution, are available to
analyze it. A comprehensive treatment of convolution and Möbius inversion can
be found in Stanley [97]. Convolution identities are valuable because they write a
graph polynomial in terms of the polynomials of its substructures, thus facilitating
induction techniques. We have the following result from Kook et al. [53] using this
approach (see also [33]).
Theorem 9.7.16. The Tutte polynomial can be expressed as
X
T .GI x; y/ D T .G=AI x; 0/T . GjA I 0; y/;
where the sum is over all subsets A of the edge set of G, and where GjA is the
restriction of G to the edges of A; i.e., GjA D G n .E n A/.
This result is particularly interesting in that it essentially writes the Tutte polyno-
mial of a graph in terms of the chromatic and flow polynomials of its minors. It may
be proved in several ways, for example, by induction using the deletion/contraction
relation, or from the spanning trees expansion of the Tutte polynomial. However,
we present the first proof from [53], which is dependent on results of Crapo [24], to
illustrate an application of convolution.
Proof (sketch). We begin with a convolution
P product of two functions on graphs
into the ring ZŒx; y given by f g D AE .G/ f . GjA /g .G=A/. The identity for
convolution is ı.G/ which is 1 if and only if G is edgeless and 0 otherwise. From
Crapo [24], we have that
T .GI x C 1; y C 1/ D .
.1; y/
.x; 1// .G/ ;

where
.x; y/ .G/ D x r.G/ y r.G / . Kook et al. [53] then show that
.x; y/1 D
.x; y/. From this it follows that T .GI x C 1; 0/ D .

.1; 1/
.x; 1//.G/ and
P
T .GI 0; y C 1/ D .
.1; y/
.1; 1//.G/. Thus, T . GjA I 0; y C 1/ T .G=AI x C
1; 0/ D .
.1; y/
.1; 1// .
.1; 1/
.x; 1//.G/. By associativity, the last
expression is the same as .
.1; y/ .
.1; 1/
.1; 1//
.x; 1//.G/ D .
.1; y/
.x; 1//.G/ D T .GI x C 1; y C 1/. t

u
A formula, known as Tutte’s identity for the chromatic polynomial, with a similar
form, exists for the chromatic polynomial.
Theorem 9.7.17. The chromatic polynomial can be expressed as
X
.GI x C y/ D . GjA I x/ . GjAc I y/;
where the sum is over all subsets A of the set of vertices of G, and where GjA is the
restriction of G to the vertices of A.
Proof. Consider an .m C n/-coloring of G, and let A be the vertices colored by the
first m colors. Then an .m C n/-coloring of G decomposes into an m coloring of
GjA using the first m colors and an n coloring of GjAc using the remaining colors.
Thus,
P for any two nonnegative integers m and n, it follows that .GI m C n/ D
. GjA I m/ . GjAc I n/. Since the expressions involve finite polynomials, this
establishes the result for indeterminates x and y. t
u
9.8 The Complexity of the Tutte Polynomial
We assume the reader is familiar with the basic notions of computational complex-
ity, but for formal definitions in the present context, see, for example, Garey and
Johnson [38] or Welsh [109].
We have seen that along different algebraic curves in the x–y plane, the
Tutte polynomial evaluates to many diverse quantities. Some of these, such as
T .GI 2; 2/ D 2jE j are very easy to compute, and others such as T .GI 1; 1/ may also
be computed efficiently, as in Sect. 9.5.1. In general though, the Tutte polynomial is
intractable, as shown in the following theorem of Jaeger et al. [49].
Theorem 9.8.1. The problem of evaluating the Tutte polynomial of a graph at a
point .a; b/ is #P -hard except when .a; b/ is on the special hyperbola
H1
.x 1/.y 1/ D 1
or when .a; b/ is one of the special points .1; 1/, .1; 1/, .0; 1/, .1; 0/, .i; i /,
.i; i /, .j; j 2 /, and .j 2 ; j /, where j D e 2 i=3 .
In each of the exceptional cases the evaluation can be done in polynomial time;
see Vertigan [107] and Gioan and Las Vergnas [41].
For planar graphs there is a significant difference. The technique developed using
the Pfaffian to solve the Ising problem for the plane square lattice by Kasteleyn [51]
can be extended to give a polynomial time algorithm for the evaluation of the Tutte
polynomial of any planar graph along the special hyperbola
H2
.x 1/.y 1/ D 2:
However, even restricting a class of graphs to its planar members, or further

restricting colouring enumeration on the square lattice, does not necessarily yield
any additional tractability, as shown by the following results, the first due to Vertigan
and Welsh [108], and the second to Farr [34].
Theorem 9.8.2. The evaluation of the Tutte polynomial of bipartite planar graphs
at a point .a; b/ is #P -hard except when
.a; b/ 2 H1 [ H2 [ f.1; 1/; .1; 1/; .j; j 2 /; .j 2 ; j /g
where again j D e 2 i=3 .
Theorem 9.8.3. For 3, computing the number of -colorings of induced sub-

graphs of the square lattice is #P -complete.
A natural question then arises as to how well an evaluation of the Tutte poly-
nomial might be approximated. That is, if there is a fully polynomial randomized
approximation scheme, or FPRAS, for T at a point .x; y/ for a well-defined family
of graphs. Here, FPRAS refers to a probabilistic algorithm that takes the input s and
the degree of accuracy to produce, in polynomial time on jsj and 1 , a random
variable which approximates T .GI x; y/ within a ratio of 1 C with probability
greater than or equal to 3/4. For example, Jerrum and Sinclair [50] show that there
exists an FPRAS for T along the positive branch of the hyperbola H2 .
However, in general approximating is provably difficult as well. Recently,
Goldberg and Jerrum [42] have extended the region of the x–y plane for which
the Tutte polynomial does not have an FPRAS, to essentially all but the first quad-
rant (under the assumption that RP ¤ NP ). A consequence of this is that there is
no FPRAS for counting nowhere zero -flows for > 2. They also provide a good
overview of prior results. For a somewhat more optimistic prognosis in the case of
dense graphs, we refer the reader to [111], and to Alon et al. [2].
There has been an increasing body of work since the seminal results of Robertson
and Seymour [78–80] impacting computational complexity questions for graphs
with bounded tree-width (see Bodlaender’s accessible introduction to tree-width
in [10]). A powerful aspect of this work is that many NP -hard problems become
tractable for graphs of bounded tree-width. For example, Noble [67] and Andrze-
jak [3] have shown that the Tutte polynomial may be computed in polynomial time
(in fact it requires only a linear number of multiplications and additions) for ra-
tional points on graphs with bounded tree width. Makowsky et al. [60] provide
similar results for bounded clique-width (a notion with significant computational
complexity consequences analogous to those for bounded tree-width; see Oum
and Seymour [69]). Noble [68] gives a recent survey of complexity results for
this area, including new monadic second-order logic methods and extensions to
the multivariable generalizations of the Tutte polynomial discussed in Chap. 10
(see also [59, 100]).
Although the Tutte polynomial is not in general computationally tractable,
there are some resources for reasonably sized graphs (up to about 100 edges).
These include Sekine et al. [84], which provides an algorithm to implement
the recursive definition. Common computer algebra systems such as Maple
and Mathematica will compute the Tutte polynomial for smallish graphs, and
there are also some implementations freely available on the Web, such as
http://ada.fciencias.unam.mx/rconde/tulic/ by R. Conde or http://homepages.mcs.
vuw.ac.nz/djp/tutte/ by G. Haggard and D. Pearce.
9.9 Conclusion
For further exploration of the Tutte polynomial and its properties, we refer the reader
to the relevant chapters of Welsh [109] and Bollobás [11] for excellent introductions,
and to Brylawki [16], Brylawski and Oxley [17], and Welsh [110] for an in-depth
treatment of the Tutte polynomial, including generalizations to matroids. Although
we focused on graphs here to broaden accessibility, matroids, rather than graphs, are
the natural domain of the Tutte polynomial, and Crapo [24] gives a compelling jus-
tification for this viewpoint. Farr [35] gives a recent treatment and engaging history
of the Tutte polynomial. Finally, we especially recommend Tutte’s own account of
how he “became acquainted with the Tutte polynomial” in [106].
Acknowledgments We thank all the friends and colleagues who offered many helpful comments
and suggestions during the writing of this chapter.
The first author was supported by the National Security Agency and by the Vermont Genetics
Network through Grant Number P20 RR16462 from the INBRE Program of the National Center
for Research Resources (NCRR), a component of the National Institutes of Health (NIH).
The second author was supported by CONACYT of Mexico, Grant 83977.
References
1. Aigner M, Ziegler GM (2001) Proofs from the book. Springer, Berlin, Heidelberg
2. Alon N, Frieze AM, Welsh DJA (1995) Polynomial time randomized approximation schemes
for Tutte–Gröthendieck invariants: the dense case. Random Struct Algorithm 6:459–478
3. Andrzejak A (1998) An algorithm for the Tutte polynomials of graphs of bounded treewidth.
4. Bak P, Tang C, Wiesenfeld K (1988) Self-organized criticality. Phys Rev A 38:364–374
5. Benashski J, Martin R, Moore J, Traldi L (1995) On the ˇ-invariant for graphs. Congr Numer
109:211–221
6. Biggs N (1996) Algebraic graph theory, 2nd edn. Cambridge University Press, Cambridge
7. Biggs N (1996) Chip firing and the critical group of a graph. Research report, London school
of economics, London
8. Birkhoff GD (1912) A determinant formula for the number of ways of coloring a map. Ann
Math 14:42–46
9. Björner A (1992) Homology and shellability of matroids and geometric lattices. In: White
N (ed) Matroid applications, encyclopedia of mathematics and its applications. Cambridge
10. Bodlaender HL (1993) A tourist guide through treewidth. Acta Cybernet 11:1–21
11. Bollobás B (1998) Modern graph theory. Graduate texts in mathematics. Springer, New York
12. Borgs C (2006) Absence of zeros for the chromatic polynomial on bounded degree graphs.
Combinator Probab Comput 15:63–74
13. Brown JI, Hickman CA, Sokal AD, Wagner DG (2001) On the chromatic roots of generalized
theta graphs. J Combin Theory B 83:272–297
14. Brylawski T (1971) A combinatorial model for series–parallel networks. Trans Am Math Soc
154:1–22
15. Brylawski T (1972) A decomposition for combinatorial geometries. Trans Am Math Soc
171:235–282
16. Brylawski T (1982) The Tutte polynomial, Part 1: general theory. In: Barlotti A (ed) Matroid
theory and its applications. Proceedings of the 3rd international mathematical summer center
(C.I.M.E. 1980)
17. Brylawski T, Oxley J (1992) The Tutte polynomial and its applications. In: White N (ed) Ma-
troid applications, encyclopedia of mathematics and its applications. Cambridge University
Press, Cambridge
18. Chang SC, Shrock R (2001) Exact Potts model partition functions on wider arbitrary-length
strips of the square lattice. Physica A 296:234–288
19. Chang SC, Jacobsen J, Salas J, Shrock R (2004) Exact Potts model partition functions for
strips of the triangular lattice. J Stat Phys 114:768–823
20. Chari MK, Colbourn CJ (1997) Reliability polynomials: a survey. J Combin Inf System Sci
22:177–193
21. Chia GL (1997) A bibliography on chromatic polynomials. Discrete Math 172:175–191
22. Choe YB, Oxley JG, Sokal AD, Wagner DG (2004) Homogeneous multivariate polynomials
with the half-plane property. Adv Appl Math 32:88–187
23. Crapo HH (1967) A higher invariant for matroids. J Combin Theory 2:406–417
24. Crapo HH (1969) The Tutte polynomial. Aeq Math 3:211–229
25. Dhar D (1990) Self-organized critical state of sandpile automaton models. Phys Rev Lett
64:1613–1616
26. Diestel R (2000) Graph theory. Graduate texts in mathematics. Springer, New York
27. Dong FM, Koh KM (2004) On upper bounds for real roots of chromatic polynomials. Discrete
Math 282:95–101
28. Dong FM, Koh KM (2007) Bounds for the coefficients of flow polynomials. J Combin Theory
B 97:413–420
29. Dong FM, Koh KM, Teo KL (2005) Chromatic polynomials and chromaticity of graphs.
World Scientific, Hackensack, NJ
30. Duffin RJ (1965) Topology of series–parallel networks. J Math Anal Appl 10:303–318
31. Ellis-Monaghan J (2004) Exploring the Tutte–Martin connection. Discrete Math 281:173–187
32. Ellis-Monaghan J (2004) Identities for the circuit partition polynomials, with applications to
the diagonal Tutte polynomial. Adv Appl Math 32:188–197
33. Etienne G, Las Vergnas M (1998) External and internal elements of a matroid basis. Discrete
Math 179:111–119
34. Farr GE (2006) The complexity of counting colourings of subgraphs of the grid. Combinator
Probab Comput 15:377–383
35. Farr GE (2007) Tutte–Whitney polynomials: some history and generalizations. In: Grimmett
GR, McDiarmid CJH (eds) Combinatorics, complexity, and chance: a tribute to Dominic
Welsh. Oxford University Press, Oxford
36. Fernandez R, Procacci A (2008) Regions without complex zeros for chromatic polynomials
on graphs with bounded degree. Combinator Probab Comput 17:225–238
37. Gabrielov A (1993) Abelian avalanches and the Tutte polynomials. Physica A 195:253–274
38. Garey MR, Johnson DS (1979) Computers and intractability – a guide to the theory of NP-
completeness. W.H. Freeman, San Francisco
39. Gioan E (2007) Enumerating degree sequences in digraphs and a cycle–cocycle reversing
system. Eur J Combinator 28:1351–1366
40. Gioan E, Las Vergnas M (2005) Activity preserving bijections between spanning trees and
orientations in graphs. Discrete Math 298:169–188
41. Gioan E, Las Vergnas M (2007) On the evaluation at .j; j 2 / of the Tutte polynomial of a
ternary matroid. J Algebr Combinator 25:1–6
42. Goldberg LA, Jerrum MR (2007) Inapproximability of the Tutte polynomial. In STOC ’07:
Proceedings of the 39th annual ACM symposium on theory of computing. ACM Press,
New York
43. Green C, Zaslavsky T (1983) On the interpretation of whitney numbers through arrangements
of hyperplanes, zonotopes, non-radon partitions and orientations of graphs. Trans Am Math
Soc 280:97–126
44. Jackson B (1993) A zero-free interval for chromatic polynomials of graphs. Combinator
45. Jackson B (2003) Zeros of chromatic and flow polynomials of graphs. J Geom. 76:95–109
46. Jackson B (2007) Zero-free intervals for flow polynomials of near-cubic graphs. Combinator
47. Jaeger F (1976) On nowhere-zero flows in multigraphs. In: Nash-Williams Crispin St JA,
Sheehan J (eds) Proceedings of the 5th British combinatorial conference, Winnipeg
48. Jaeger F (1988) Nowhere-zero flow problems. In: Beineke LW, Wilson RJ (eds) Selected
topics in graph theory, vol 3. Academic, New York
49. Jaeger F, Vertigan DL, Welsh DJA (1990) On the computational complexity of the Jones and
Tutte polynomials. Math Proc Cambridge Philos Soc 108:35–53
50. Jerrum MR, Sinclair A (1993) Polynomial time approximation algorithms for the Ising model.
SIAM J Comput 22:1087–1116
51. Kasteleyn PW (1961) The statistics of dimers on a lattice. Physica 27:1209–1225
52. Kleitman DJ, Winston KJ (1981) Forests and score vectors. Combinatorica 1:49–54
53. Kook W, Reiner V, Stanton D (1999) A convolution formula for the Tutte polynomial.
J Combin Theory B 76:297–300
54. Las Vergnas M (1977) Acyclic and totally cyclic orientations of combinatorial geometries.
55. Las Vergnas M (1984) The Tutte polynomial of a morphism of matroids II. Activities of ori-
entations. In: Bondy JA, Murty USR (eds) Progress in graph theory, Proceedings of Waterloo
Silver Jubilee Combinatorial Conference 1982. Academic, Toronto
56. Las Vergnas M (1988) On the evaluation at (3,3) of the Tutte polynomial of a graph. J Combin
Theory B 44:367–372
57. Las Vergnas M. The Tutte polynomial of a morphism of matroids V. Derivatives as generating
functions, Preprint
58. Lieb EH (1967) Residual entropy of square ice. Phys Rev 162:162–172
59. Makowsky JA (2005) Colored Tutte polynomials and Kauffman brackets for graphs of
bounded tree width. Discrete Appl Math 145:276–290
60. Makowsky JA, Rotics U, Averbouch I, Godlin B (2006) Computing graph polynomials on
graphs of bounded clique-width. In: Lecture Notes in Computer Science 4271. Springer,
New York
61. Martin P (1977) Enumérations eulériennes dans le multigraphs et invariants de Tutte–
Gröthendieck. PhD thesis, Grenoble
62. Martin P (1978) Remarkable valuation of the dichromatic polynomial of planar multigraphs.
63. McKee TA (2001) Recognizing dual-chordal graphs. Congr Numer 150:97–103
64. Merino C (1997) Chip firing and the Tutte polynomial. Ann Combin 1:253–259
65. Merino C (2001) The chip firing game and matroid complex. Discrete Mathematics and
Theoretical Computer Science, Proceedings, vol AA, pp 245–256
66. Merino C, de Mier A, Noy M (2001) Irreducibility of the Tutte polynomial of a connected
matroid. J Combin Theory B 83:298–304
67. Noble SD (1998) Evaluating the Tutte polynomial for graphs of bounded tree-width. Combi-
nator Probab Comput 7:307–321
68. Noble SD (2007) The complexity of graph polynomials. In: Grimmett GR, McDiarmid CJH
(eds) Combinatorics, complexity, and chance: a tribute to Dominic Welsh. Oxford University
Press, Oxford
69. Oum S, Seymour PD (2006) Approximating clique-width and branch-width. J Combin The-
ory B 96:514–528
70. Oxley J (1982) On Crapo’s beta invariant for matroids. Stud Appl Math 66:267–277
71. Oxley J, Welsh DJA (1979) The Tutte polynomial and percolation. In: Bondy JA, Murty USR
(eds) Graph theory and related topics. Academic, London
72. Pauling L (1935) The structure and entropy of ice and of other crystals with some randomness
of atomic arrangement. J Am Chem Soc 57:2680–2684
73. Procacci A, Scoppola B, Gerasimov V (2003) Potts model on infinite graphs and the limit of
chromatic polynomials. Commun Math Phys 235:215–231
74. Provan JS, Billera LJ (1980) Decompositions of simplicial complexes related to diameters of
convex polyhedra. Math Oper Res 5:576–594
75. Read RC (1968) An introduction to chromatic polynomials. J Combin Theory B 4:52–71
76. Read RC, Rosenstiehl P (1978) On the principal edge tripartition of a graph. Ann Discrete
Math 3:195–226
77. Read RC, Royle G (1991) Chromatic roots of families of graphs. In: Alavi Y et al (eds) Graph
theory, combinatorics, and applications. Wiley, New York
78. Robertson N, Seymour PD (1984) Graph minors. I. Excluding a forest. J Combin Theory B
35:39–61
79. Robertson N, Seymour PD (1984) Graph minors. III. Planar tree-width. J Combin Theory B
36:49–64
80. Robertson N, Seymour PD (1986) Graph minors. II. Algorithmic aspects of tree-width. J
Algorithm 7:309–322
81. Royle G (2007) Graphs with chromatic roots in the interval (1,2). Electron J Combinator
14(1):N18
82. Royle G (2008) Planar triangulations with real chromatic roots arbitrarily close to four. Ann
83. Schwärzler W (1993) The coefficients of the Tutte polynomial are not unimodal. J Combin
Theory B 58:240–242
84. Sekine K, Imai H, Tani S (1995) Computing the Tutte polynomial of a graph of moderate size.
In: Lecture Notes in Computer Science. Springer, Berlin
85. Seymour PD (1981) Nowhere-zero 6-flows. J Combin Theory B, 30, 130–135
86. Seymour PD, Welsh DJA (1975) Combinatorial applications of an inequality of statistical
mechanics. Math Proc Cambridge Philos Soc 77:485–495
87. Shrock R, Tsai SH (1997) Asymptotic limits and zeros of chromatic polynomials and ground
state entropy of Potts antiferromagnets. Phys Rev E 55:5165–5179
88. Shrock R, Tsai SH (1997) Families of graphs with Wr .G; q/ functions that are nonanalytic at
1=q D 0. Phys Rev E 56:3935–3943
89. Shrock R, Tsai SH (1998) Ground state entropy of Potts antiferromagnets: cases with non-
compact W boundaries having multiple points at 1=q D 0. Physica A 259:315–348
90. Shrock R (2001) Chromatic polynomials and their zeros and asymptotic limits for families of
91. Sokal AD (2001) A personal list of unsolved problems concerning lattice gases and antifer-
romagnetic Potts models. Markov Process Relat Fields 7:21–38
92. Sokal AD (2001) Bounds on the complex zeros of (di)chromatic polynomials and Potts-model
partition functions. Combinator Probab Comput 10:41–77
93. Sokal AD (2004) Chromatic roots are dense in the whole complex plane. Combinator Probab
Comput 13:221–261
94. Stanley R (1973) Acyclic orientations of graphs. Discrete Math 5:171–178

95. Stanley R (1980) Decomposition of rational polytopes. Ann Discrete Math 6:333–342
96. Stanley R (1996) Combinatorics and commutative algebra, 2nd edn. Progress in Mathematics,
vol 41. Birkhäuser, Boston
97. Stanley R (1996) Enumerative combinatorics, vol 1. Cambridge University Press, Cambridge
98. Stanley R (1999) Enumerative combinatorics, vol 2. Cambridge University Press, Cambridge
99. Thomassen C (1997) The zero-free intervals for chromatic polynomials of graphs. Combina-
tor Probab Comput 6:497–506
100. Traldi L (2006) On the colored Tutte polynomial of a graph of bounded treewidth. Discrete
Appl Math 154:1032–1036
101. Tutte WT (1947) A ring in graph theory. Proc Cambridge Philos Soc 43:26–40
102. Tutte WT (1948) An algebraic theory of graphs, PhD thesis, University of Cambridge
103. Tutte WT (1954) A contribution to the theory of chromatic polynomials. Can J Math 6:80–91
104. Tutte WT (1967) On dichromatic polynomials. J Combin Theory 2:301–320
105. Tutte WT (1984) Graph theory. Cambridge University Press, Cambridge
106. Tutte WT (2004) Graph-polynomials. Special issue on the Tutte polynomial. Adv Appl Math
32:5–9
107. Vertigan D (1998) Bicycle dimension and special points of the Tutte polynomial. J Combin
Theory B 74:378–396
108. Vertigan DL, Welsh DJA (1992) The computational complexity of the Tutte plane: the bipar-
tite case. Combinator Probab Comput 1:181–187
109. Welsh DJA (1993) Complexity: knots, colorings and counting. Cambridge University Press,
Cambridge
110. Welsh DJA (1999) The Tutte polynomial, in statistical physics methods in discrete probability,
combinatorics, and theoretical computer science. Random Struct Algorithm 15:210–228
111. Welsh DJA, Merino C (2000) The Potts model and the Tutte polynomial. J Math Phys
41:1127–1152
112. Whitney H (1932) A logical expansion in mathematics. Bull Am Math Soc 38:572–579
113. Woodall D (1992) A zero-free interval for chromatic polynomials. Discrete Math 101:
333–341
114. Yetter D (1990) On graph invariants given by linear recurrence relations. J Combin Theory B
48:6–18
115. Zaslavsky T (1987) The Möbius function and the characteristic polynomial. In: White N
(ed) Combinatorial geometries, encyclopedia of mathematics and its applications. Cambridge
116. Zhang CQ (1997) Integer flows and cycle covers of graphs. Marcel Dekker Inc., New York
Chapter 10
Graph Polynomials and Their Applications II:
Interrelations and Interpretations
Abstract We survey a variety of graph polynomials, giving a brief overview of

techniques for defining a graph polynomial and then for decoding the combinatorial
information it contains. These polynomials are not generally specializations of the
Tutte polynomial, but they are each in some way related to the Tutte polynomial,
and often to one another. We emphasize these interrelations and explore how an
understanding of one polynomial can guide research into others. We also discuss
multivariable generalizations of some of these polynomials and the theory facilitated
by this. We conclude with two examples, the interlace polynomial in biology and
the Tutte polynomial and Potts model in physics, that illustrate the applicability of
graph polynomials in other fields.
Keywords Tutte polynomial Characteristic polynomial Matching polynomial

Penrose polynomial Martin polynomial Circuit partition polynomial Ehrhart
polynomial Interlace polynomial U-polynomial W-polynomial Bollobás–
Riordan polynomial Ribbon graph polynomial Topological Tutte polynomial
Multivariable Tutte polynomial Parametrized Tutte polynomial Transition
polynomial Polychromate Symmetric function DNA sequencing Potts model
MSC2000: Primary 05-02; Secondary 05C90, 05C45, 05C70, 05E05
10.1 Introduction
A graph polynomial is an algebraic object associated with a graph that is usually

invariant at least under graph isomorphism. As such, it encodes information
about the graph, and enables algebraic methods for extracting this information.
J.A. Ellis-Monaghan ()

Department of Mathematics, Saint Michaels College, One Winooski Park, Colchester,
VT 05439, USA
and
Department of Mathematics and Statistics, University of Vermont, 16 Colchester Avenue,
Burlington, VT 05405, USA

This chapter surveys a comprehensive, although not exhaustive, sample of graph

polynomials. It concludes Chap. 9 by continuing the goal of providing a brief
overview of a variety of techniques for defining a graph polynomial and then for
decoding the combinatorial information it contains.
The polynomials we discuss here are not evaluations of the Tutte polynomial.
However, they are each in some way related to the Tutte polynomial, and often to
one another. We emphasize these interrelations and explore how an understanding
of one polynomial can guide research into others. We also present multivariable
generalizations of some of these polynomials and discuss the theory facilitated by
this. We conclude with two examples, one from biology and one from physics, that
illustrate the applicability of graph polynomials in other fields.
10.2 Formulating Graph Polynomials
We have seen two methods for formulating a graph polynomial with the linear
recursion (deletion/contraction) and generating function definitions of the Tutte
polynomial in Chap. 9. Here we show several more. We begin with one of the earli-
est graph polynomials, the edge-difference polynomial, a multivariable polynomial
defined as a product and originally studied by Sylvester [129] and Peterson [113]
in the late 1800s. More recently, it has been used to address list coloring questions
(see Alon and Tarsi [8] and Ellingham and Goddyn [53]), where a list coloring of
a graph is a proper coloring of the vertices of a graph with the color of each vertex
selected from a predetermined list of colors assigned to that vertex.
Definition 10.2.1. The edge-difference polynomial. Let Q .v1 ; : : : ; vn / be an ordering
of the vertices of a graph G. Then D .GI x1 ; : : : ; xn / D i <j .xi xj /, where the

product is over all edges vi ; vj of G.
Note that a proper coloring of G corresponds to finding positive integer values
Ni (not necessarily distinct) for each of the xi ’s so that D .GI N1 ; : : : ; Nn / ¤ 0.
There are also several polynomials based on various determinants (or even per-
manents; see Pathasarthy [111] for a survey) involving the adjacency matrix of a
graph. Recall that A.G/, the adjacency matrix of a graph, has entries aij D 1 if
.i; j / is an edge of the graph and 0 if it is not. The characteristic polynomial is the
classic example of a such a graph polynomial, and is discussed further in Sect. 10.3.
Definition 10.2.2. The characteristic polynomial. Let A.G/ be the adjacency
matrix of a graph G. Then f .GI x/ D jxI A.G/j.
Other examples of such polynomials are the idiosyncratic polynomial introduced
by Tutte [133], that is defined by .GI x; y/ D jA.G/Cy.J I A/xI j, where J
is the matrix having all entries equal to 1. Also .GI x; y/ D jxI D.G/ C A.G/j,
where D.G/ is the degree matrix of G, that is, the diagonal matrix with deg.i / in
the position .i; i /, introduced by Kel’mans [93]. Note that J I A is the adjacency
matrix of the complement of G and when G is a simple graph, D.G/ A.G/ is
just the Laplacian matrix L.G/ of the graph.
10 Interrelations and Interpretations 259
v or or
Fig. 10.1 The three possible local reconfigurations at a vertex v, identified, from left to right, as
white, black, and crossing. Which strand passes over which in the crossing configuration does not
affect the computation
A number of important graph polynomials may be defined by state model

formulas. Loosely speaking, a state of a graph is some configuration resulting from
making local assignments for substructures (e.g., the edges or vertices) of the graph.
These assignments may be, for example, associating an element of a given set to
each vertex, or even the result of reconfiguring the edges incident with a vertex.
A graph polynomial is formed by associating an expression, often a weighted mono-
mial, to each state of the graph, and then summing over all possible graph states. The
language comes from physics, and is also found in knot theory. We show several
state model graph polynomials among those surveyed below, as well as an applica-
tion of this method in the Potts model of statistical mechanics in Sect. 10.5.
An early example of a graph polynomial given by a state model formulation is
P .GI x/, the Penrose polynomial. This polynomial graph invariant for planar graphs
was defined implicitly by Penrose [112] in the context of tensor diagrams in physics,
but an excellent graph theoretical exposition can be found in Aigner [1]. To compute
P .GI x/, let G be a plane graph, and let Gm be its medial graph, face two-colored
with the unbounded face colored white. At each vertex, we consider three possible
local reconfigurations, as in Fig. 10.1. A state S of Gm results from choosing one
of these three reconfigurations at each vertex of Gm and consists of a set of disjoint
closed curves (like a knot diagram). Furthermore, to each local reconfiguration at
a vertex v, we assign a weight !.S; v/ that is C1, 0, or 1 for a white, black, or
crossing configuration, respectively.
Definition 10.2.3. The Penrose polynomial. Let G be a planar graph with medial
graph Gm , let S t.Gm / be the set of states of Gm , and let S t 0 .Gm / be the set of states
with no black configurations. Then,
00 1 1
X Y X
P .GI x/ D @@ !.S; v/A x k.S/ A D .1/cr.S/ x c.S/ ;
St .Gm / v2Gm St 0 .Gm /
where c.S / is the number of components in the graph state S , and cr.S / is the
number of crossing vertex configurations chosen in the state S .
For example, if G is the -graph consisting of two vertices joined by three edges
in parallel, then P .GI x/ D x 3 3x 2 C 2x, as in Fig. 10.2. The Penrose polynomial
may also be computed via a linear recursion relation (see Jaeger [89], for example).
The Penrose polynomial has some surprising properties, particularly with respect
to graph coloring. The four-color theorem is equivalent to showing that every planar,
G= Gm =
–x +x –x2 +x
+x –x2 +x3 –x2
Fig. 10.2 Computing the Penrose polynomial of a graph G from the states of its medial graph
cubic, connected graph can be properly edge-colored with three colors. The Penrose
polynomial, when applied to planar, cubic, connected graphs, encodes exactly this
information (see Penrose [112]):
jV2 j
1
P .GI 3/ D P .GI 2/ D the number of 3-edge-colorings of G:
4
10.3 Some Interrelated Polynomial Invariants
We present a further sampling of graph polynomials here. They are each related in
some way to the Tutte polynomial, and have additional relations among themselves.
These relations lead to combinatorial insights as results for any one polynomial then
inform those related to it.
10.3.1 Characteristic and Matching Polynomials
The characteristic and matching polynomials are particularly interrelated, so we

treat them together here, beginning with the characteristic polynomial f .GI x/
already introduced in Definition 10.2.2. Note that f .GI x/ is a monic polynomial
of degree n. Furthermore, since the adjacency matrix A is real and symmetric, all
its eigenvalues are real, and thus all the zeros of f .GI x/ are real.
By using properties of determinants we can find interpretations of the coefficients

of f .GI x/ in terms of the principal minors of A. A principal minor of order r is the
determinant of an r r submatrix of A obtained by choosing r rows and columns
with the same set of indices.
P
Proposition 10.3.1. Suppose that f .GI x/ D niD0 ai x ni . Then .1/i ai is equal
to the sum of the principal minors of A with order i .
This property of the characteristic polynomial can be found, for example, in Horn
and Johnson [85].
Since the diagonal elements of A are all zero, we have that a1 D 0. The principal
minors of order two and three that are not zero are of the form jJ I j, where J
is the matrix having all entries +1 and J I has order 2 or 3. The 2 2 submatrices
J I of A.G/ correspond naturally to the edges of G and the 3 3 submatrices
J I correspond to the K3 subgraphs of G. Thus a2 D jE.G/j and a3 is twice
the number of K3 subgraphs of G.
A linear subgraph of G is a subgraph whose components are edges or cycles.
An expression for the coefficients of f .GI x/ in terms of linear subgraphs is given
in the following result.
Proposition 10.3.2. The coefficients of the characteristic polynomial may be
expressed as X
.1/i ai D .1/r./ 2r ./ ;

where r is the rank function and the sum is over all linear subgraphs of G having
i vertices.
Note that because is a linear subgraph, r ./ is simply the number of compo-
nents in that are cycles. The proof of Proposition 10.3.2 uses Proposition 10.3.1
and can be found in Harary [82], while a detailed history of this result is given by
Cvetković et al. [45].
As with the Tutte polynomial we also have here some reduction formulas and an
expression for the derivative of the characteristic polynomial.
Theorem 10.3.3. The characteristic polynomial of a graph satisfies the following
identities:
1. f .G [ H I x/ D f .GI x/f .H I x/,
2. f .GI x/ D f .G
Pn e; x/ f .G u vI x/ if e D uv is a cut-edge of G,
@
3. @x f .GI x/ D v2V .G/ f .G vI x/.
A proof of these properties can be found in Godsil [75]. Item 1 is an easy exer-
cise in matrix theory, as in Horn and Johnson [85]. Item 2 can be proved by using
Proposition 10.3.2 and considering the linear subgraphs of G that use the edge e
and the ones that do not use it. The result follows because e is in no cycle of G if
and only if it is a cut-edge. Item 3 can be proved by using Proposition 10.3.1 since
any principal minor of order i is counted n i times in the right-hand side of the
formula in Item 3.
Given a graph G, the collection of (unlabeled) subgraphs G v, for v 2 V .G/, is

called the deck of G, and the individual subgraphs are called cards. Thus, the deck
for a graph on n vertices consists of n graphs, each of which has n 1 vertices.
Ulam’s reconstruction conjecture in [135] asserts that any finite graph G with more
than two vertices is uniquely determined by its deck (see [135]), and we call any
graph that satisfies the conjecture reconstructible. Similarly, an invariant of G which
can be deduced from the deck is called reconstructible.
Clearly, the number n of vertices of a graph is reconstructible. Also, as every
edge is present in exactly n 2 cards, the number of edges is also reconstructible.
The following useful example of reconstructibility is due to Kelly [92].
Lemma 10.3.4 (Kelly’s lemma). Let G and H be graphs, and let .H; G/ denote
the number of subgraphs of G isomorphic to H . Then
X
.jV .G/j jV .H /j/.H; G/ D .H; G v/:
v2V .G/
The proof is by a double counting argument, and it follows that .H; G/ is recon-
structible whenever jV .H /j < jV .G/j.
Tutte proved in [132] that the Tutte polynomial is reconstructible, and thus the
chromatic polynomial, the flow polynomial, the number of spanning trees and any
invariant mentioned in Chap. 9 are also reconstructible. Tutte also proved that the
characteristic polynomial is reconstructible in [133].
Theorem 10.3.5. The characteristic polynomial of a graph is reconstructible.
For the proof, note that we have immediately from Theorem 10.3.3 that f 0 .GI x/
is reconstructible. It then remains to prove that the constant term of f .GI x/ is re-
constructible. But by Proposition 10.3.1, this is the same as proving that jA.G/j
is reconstructible. Then, using Theorem 10.3.2 and an extension of Kelly’s lemma
(see [94]), the problem is reduced to proving that the number of Hamiltonian cycles
is reconstructible. A complete proof of Theorem 10.3.5 based on the proof in
Kocay [94], can be found in [75].
Let us turn now to the matching polynomial. An i -matching in a graph G is a set
of i edges, no two of which have a vertex in common. Let ˚i .G/ denote the number
of i -matchings, setting ˚0 .G/ D 1. Thus ˚1 .G/ D m is the number of edges of
G, and if n, the number of vertices, is even, then ˚n=2 .G/ is the number of perfect
matchings of G.
Definition 10.3.6. Let G be a graph. Then the matching polynomial of G is
X
.GI x/ D .1/i ˚i .G/x n2i :
i 0
A more natural polynomial might be the matching generating polynomial, given

as the generating function of i -matchings by
X
g.GI x/ D ˚i .G/x i :
i 0
However, the two polynomials are related by the identity
.GI x/ D x n g.GI .x/2 /;
so there is no essential difference between them.

The matching polynomial is also known as the acyclic polynomial in Gutman and
Trinajstić [81], matching defect polynomial in Lovász and Plummer [101] and ref-
erence polynomial in Aihara [6]. It has appeared independently in several different
contexts. In combinatorics, it was probably introduced by Farrell in [65], but since
the matching polynomial is essentially the same as the rook polynomial for bipar-
tite graphs (see Farrell [67]), then its origin can be traced back at least to Riordan
[117]. In statistical physics it appears because of the monomer-dimer problem and
was introduced by Heilmann and Lieb in [83] and independently by Kunz in [95].
Finally, in theoretical chemistry it was introduced by Hosaya in [86] and later in con-
nection with the so-called topological resonance energy by Gutman et al. in [79–81]
and independently by Aihara in [6]. For a full account of the history of the matching
polynomial see Gutman [77].
As with the Tutte and characteristic polynomials, we have some reduction formu-
las for the matching polynomial. The proof of the following theorem can be found
in Godsil [75].
Theorem 10.3.7. The matching polynomial satisfies the following identities:
1. .G [ H I x/ D .GI x/.H I x/,
2. .GI x/ D .G n eI x/ .G
P u vI x/ if e D uv is an edge of G,
3. .GI x/ D x.G uI x/ uv2E.G/ .G v uI x/ if u 2 V .G/,
@ P
4. @x .GI x/ D v2V .G/ .G vI x/.
An i -matching in G [ H corresponds to an s-matching in G and a t-matching in H
such that s C t D i . Item 1 then follows by the fundamental counting principle. For
Item 2, notice that the set of i -matchings can be partitioned into those i -matchings
that use the edge e and those that do not use it. Item 3 follows similarly. Finally,
every i -matching of G with i < n=2 is counted n 2i times in the right-hand side
of the formula in Item 4, so the result follows.
When the graph G is a forest, a linear subgraph of G with j vertices corresponds
to a matching covering j vertices, with j even. Thus, Proposition 10.3.2 has the
following corollary, observed by Hosaya [86] and by Heilmann and Lieb [84].
Corollary 10.3.8. If G is a forest then f .GI x/ D .GI x/.
An unexpected property of the matching polynomial, proved by Heilmann and

Lieb [84], is that all its zeros are real, and furthermore the zeros for any graph G
interlace with the zeros of any of the cards in its deck. The same paper also gives
bounds for the zeros.
Theorem 10.3.9. For any graph G, the matching polynomial .GI x/ has only real
zeros. Furthermore, if u is any vertex in G and if a1 ; a2 ; : : : ; an are the zeros of
.GI x/ while the zeros of .G uI x/ are a10 ; a20 ; : : : ; an1
0
, then
a1 a10 a2 a20 an1

0
an I
that is, the zeros of .GI x/ and .G uI x/ interlace.
Theorem 10.3.10. The (real) zeros, a1 ; a2 ; : : : ; an , of .GI x/, satisfy

p
jai j < 2 maxdeg.G/ 1:
We outline a proof of Theorem 10.3.9 from Godsil [73] that uses some of the
results already mentioned for .GI x/ and f .GI x/. First, given a graph G and a
vertex u in G, the path tree T .G; u/ is the tree that has as its vertices the paths in G
which start at u, and where two such vertices are joined by an edge if one represents
a maximal proper subpath (i.e., all but the last edge) of the other. We then have the
following proposition from [73] that leads to a proof of Theorem 10.3.9.
Proposition 10.3.11. Let u be a vertex in a graph G, let T D T .G; u/ be the path
tree of G with respect to u, and let u0 be the vertex of T corresponding to the path
of length 0 beginning at u. Then
.G uI x/ .T u0 I x/ f .T u0 I x/
D D :
.GI x/ .T I x/ f .T I x/
The last equality follows from Corollary 10.3.8. Because all the roots of the char-
acteristic polynomial are real, we conclude that all zeros and poles of the rational
function .G uI x/=.GI x/ are real. An induction argument on the number of
vertices in G then yields the conclusion that all the zeros of .GI x/ are real.
An interesting combinatorial consequence of Theorem 10.3.9 is the following
result of Heilmann and Lieb [84], which gives a stark contrast with how little is
known about the coefficients of the chromatic polynomial.
Theorem 10.3.12. For any graph G, the sequence ˚0 .G/, ˚1 .G/, : : : of coeffi-
cients of g.GI x/ is log-concave, that is ˚i2 ˚i 1 ˚i C1 .
The characteristic polynomial has been well studied, particularly with respect to
graphs with the same characteristic polynomial. Godsil [75, 76] gives a thorough
treatment of both the characteristic and the matching polynomials. Another good
reference for the characteristic polynomial is Biggs [20]. Just as the matching poly-
nomial is a way to study the matchings of a graph, the characteristic polynomial is
a way to study the spectra of the adjacency matrix of a graph. Cvetković et al. have
written a book [45] dedicated to the spectra of the adjacency matrix, and Lovász
and Plummer [101] have a book devoted to the theory of matchings. Furthermore,
although the characteristic polynomial is not a complete invariant of graphs, it is
conjectured that the characteristic polynomial of a graph G is reconstructible from
its polynomial deck, i.e., from the set of characteristic polynomials of the cards
of G. See Gutman and Cvetković [78] for the conjecture, and then Cvetković and
Lepović [46], where it is proved in the case of trees.
10.3.2 Ehrhart Polynomial
A convex polytope P is the convex hull of a finite set of points in Rm . We denote

the interior of P (in the usual topological sense) by P o . A convex polytope P is
said to be a rational, or integral, polytope if all its vertices have rational, or integral,
coordinates, respectively. We write d D dim P and call P a d -polytope.
For P Rm a rational d -polytope and t a nonnegative integer we define the
functions i.P I t/ D jtP \ Zm j and i .P I t/ D jtP o \ Zm j, where tP D ftaja 2 P g
is the t-fold dilatation of P . Ehrhart proved in [50–52] that these functions are
quasi-polynomials; that is, they are of the form
cd .t/t d C ct 1 .t/t d 1 C C c0 .t/;
where each ci .t/ is a periodic function with integer period. Since i.P I t/ is a quasi-
polynomial, it can be defined for all t 2 Z. In fact, we have the following reciprocity
law due to Ehrhart [49]:
i.P I t/ D .1/d i .P I t/:

From Ehrhart [50–52] (also see Stanley [127]), we have that when P Rm is
an integral d -polytope, then i.P I t/ and i .P I t/ are polynomials, which leads to the
following definition of the Ehrhart polynomial.
Definition 10.3.13. Let P be an integral convex d -polytope. Then the Ehrhart poly-
nomial of P is
i.P I t/ D c0 C c1 t C C cd 1 t d 1 C cd t d :
From the early works of Ehrhart [50] and Macdonald [102] it is known that c0 D1
and cd D vol.P /, and that cd 1 is half of the surface area of P , normalized with
P
respect to the sub-lattice on each face of P . Specifically, cd 1 D 1=2 F
vold 1 .F /, where F ranges over all facets of P and the volume of a facet is
measured intrinsically with respect to the lattice Zm \ LF , where LF is the affine
hull of F . The other coefficients were not well understood, until the later work
of Betke and Kneser [19], Pommersheim [116], Kantor and Khovanskii [90], and
Diaz and Robins [47], but such interpretations go beyond the scope of this chapter.
For the complexity of computing these coefficients see Barvinok [16]. A reference
for integer point enumeration in polytopes is Beck and Robins [18].
In the special case that P is a zonotope there is a combinatorial interpretation
for the coefficients of the Ehrhart polynomial. First recall that if A is an r m real
matrix written in the form A D Œa1 ; :::; ar , then it defines a zonotope Z.A/ which
consists of those points p of Rm that can be expressed in the form
m
X
pD i ai ; 0 i 1:
i D1
In other words, Z.A/ is the Minkowski sum of the line segments Œ0; ai , for
1 i n. For more on zonotopes, see McMullen [105].
When A has integerP entries, Stanley [125], using techniques from Shephard [121],
proved that i.P I t/ D X f .X /t jXj , where X ranges over all linearly independent
subsets of columns of A and where f .X / denotes the greatest common divisor of
all minors of sizes jX j of the matrix A.
When A is a totally unimodular matrix, that is, the determinant of every square
submatrix is 0 or ˙1, then Z.A/ is described as a unimodular zonotope. For these
polytopes the previous result shows that
r
X
i.Z.A/I t/ D fk t k ;
kD0
where fk is the number of subsets of columns of the matrix A which are lin-
early independent and have cardinality k. In other words, the Ehrhart polynomial
i.Z.A/I t/ is the generating function of the number of independent sets in the regular
matroid M.A/.
The incidence matrix D.G/ of a graph G is totally unimodular, a long-standing
result due to Poincaré [115] with a modern treatment given by Biggs [20]. A lin-
early independent subset of columns in D corresponds to a subset of edges with no
cycle. Thus, the coefficient fk in this case is the number of spanning forests of G
Pr exactly
with k edges. From the previous chapter we know that T .GI x C 1; 1/ D
rk
kD0 fk x , where r is the rank of the graph G. With these ingredients we get
the following relation to the Tutte polynomial from Welsh [138].
Theorem 10.3.14. If G is a graph and D is its incident matrix then the Ehrhart
polynomial of the unimodular zonotope Z.D/ is given by

1
i.Z.D/I t/ D t r T GI 1 C ; 1 ;
t
where r is the rank of G.

In this case, the zonotope Z.D/ is a r-polytope in Rn , where n is the number of

vertices of G.
The reciprocity law of Theorem 10.3.14 leads to the following geometric result,
also from Welsh [138].
Corollary 10.3.15. If D is the incidence matrix of a graph G with rank r and n
vertices then for any positive integer the number of lattice points of Rn lying
strictly inside the zonotope tZ.D/ is given by

r 1
i .Z.D/I t/ D .t/ T GI 1 ; 1 :
t
In particular we have that the number of lattice points strictly inside Z.D/ is
.1/r T .GI 0; 1/.
10.3.3 The Topological Tutte Polynomial of Bollobás and Riordan
The classical Tutte polynomial discussed in the previous chapter is an invariant of

abstract graphs, so it encodes no information specific to graphs embedded in sur-
faces. In [24, 25], Bollobás and Riordan generalize the classical Tutte polynomial
to topological graphs, that is, graphs embedded in surfaces. In [24], Bollobás and
Riordan define the cyclic graph polynomial, a three-variable deletion/contraction
invariant for graphs embedded in oriented surfaces. They extend this work in [25],
using a different approach, with the four-variable ribbon graph polynomial. Both
of these polynomials extend the classical Tutte polynomial, but in such a way that
topological information about the embedding is encoded. The version for oriented
surfaces is subsumed by the version for arbitrary surfaces, so we focus on the latter
here. The ribbon graph polynomial is also sometimes called the Bollobás–Riordan
polynomial after the authors or the topological Tutte polynomial to emphasize that
it simultaneously encodes topological information while generalizing the classical
Tutte polynomial.
First recall that a cellular embedding of a graph in an orientable or unorientable
surface can be specified by providing a sign for each edge and a rotation scheme for
the set of half edges at each vertex, where a rotation scheme is simply a cyclic or-
dering of the half edges about a vertex. This is equivalent to a ribbon (or fat) graph,
which is a surface with boundary where the vertices are represented by a set of disks
and the edges by ribbons, with the ribbon of an edge with a negative sign having
a half-twist. This can also be thought of as taking a slight “fattening” of the edges
of the graph as it is embedded in the surface, or equivalently as “cutting out” the
graph together with a small neighborhood of it from the surface. Figure 10.3 shows
a graph with two vertices and two parallel edges, one positive and one negative. It is
embedded on a Klein bottle, and the ribbon graph is a Möbius band with boundary.
In addition to the usual graphic characteristics such as number of vertices, con-
nected components, rank, and nullity for a ribbon graph G, we also consider bc .G/,
Fig. 10.3 A ribbon graph

which is a Möbius band with
boundary
the number of boundary components of the surface, and t.G/, an index of the
orientability of the surface. The value of t.G/ is 0 if the surface is orientable, and
1 if it is not. Thus, t.G/ is 1 if and only if for some cycle in G, the product of the
signs of the edges is negative.
Definition 10.3.16. Let G be a ribbon graph, that is, a graph embedded in a surface.
Then the topological Tutte polynomial of Bollobás and Riordan is given by
X
R.GI x; y; z; w/ D .x 1/r.G/r.A/ y n.A/ z.A/bc.A/Cn.A/ wt .A/
AE.G/
as an element of ZŒx; y; z; w=hw2 wi:
As previously, r.A/, .A/, n.A/, and now also bc.A/ and t.A/, refer to the spanning
subgraph of G with edge set A, here with its embedding inherited from G.
Clearly, by comparing with the rank-nullity generating function definition of the
classical Tutte polynomial given in Chap. 9, this generalizes the classical Tutte poly-
nomial. Like the classical Tutte polynomial, R.GI x; y; z; w/ is multiplicative on
disjoint unions and one-point joins of ribbon graphs. More importantly, it retains
the essential properly of obeying a deletion/contraction reduction relation.
To see this, we must first define deletion and contraction in the context of em-
bedded graphs. The ribbon graph resulting from deleting an edge is clear, but
contraction requires some care. Let e be a nonloop edge. First assume the sign of
e is positive, by flipping one endpoint if necessary to remove the half-twist (this
reverses the cyclic order of the half edges at that vertex and toggles their signs).
Then G=e is formed by deleting e and identifying its endpoints into a single vertex
v. The cyclic order of edges at v comes from the original cyclic order at one end-
point, beginning where e had been, and continuing with the cyclic order at the other
endpoint, again beginning where e had been.
Theorem 10.3.17. If G is a ribbon graph, then
R.GI x; y; z; w/ D R.G=eI x; y; z; w/ C R.G eI x; y; z; w/
if e is an ordinary edge and R.GI x; y; z; w/ D xR.G=eI x; y; z; w/ if e is a bridge.

The proof depends on a careful analysis of how each of the relevant parameters
r.A/, .A/, n.A/, bc.A/, and t.A/ changes with the deletion or contraction of an
edge.
Repeated application of this theorem reduces a ribbon graph to a disjoint union

of embedded bouquet graphs, that is, graphs each consisting of a single vertex with
some number of loops. Because of the embedding, the loops are signed, and there
is a rotation system of the half-edges about the single vertex. Not surprisingly, the
topological information is distilled into these minors of the original graph, and to
complete a deletion/contraction linear recursion computation, it is necessary to spec-
ify an evaluation of these terminal forms.
Signed chord diagrams provide a useful device for determining the relevant
parameters of an embedded bouquet graph. Recall that a chord diagram consists
of a circle with n symbols on its perimeter, with each symbol appearing twice and
a chord drawn between each pair of like symbols. A signed chord diagram simply
has a sign on each chord. A signed chord diagram D corresponds to an embedded
bouquet graph G by assigning a symbol to each loop and arranging them on the
perimeter of the circle in the chord diagram in the same order as the cyclic order
of the half-edges about the vertex. A chord receives the same sign as the loop it
represents. If we “fatten” the chords as in Fig. 10.4, with a negative chord receiv-
ing a half-twist, then bc.G/ is equal to the number of components in the resulting
diagram, which is denoted bc.D/. Similarly, since G has only one vertex, n.G/ is
the number of edges of G, which is the number of chords of D, so we denote this
by n.D/. We also set t.D/ D t.G/, and note that t.D/ D 0 if all chords of D
have a positive sign, and t.D/ D 1 otherwise. This, combined with the definition of
R.GI x; y; z; w/ above, gives the following evaluation for these terminal forms.
Theorem 10.3.18. If G is an embedded bouquet graph with corresponding signed

chord diagram D, then
X 0 0 0 0
R.GI x; y; z; w/ D y n.D / z1bc.D /Cn.D / wt .D / ;
D 0 D
where the sum is over all subdiagrams D 0 of D.
Theorems 10.3.17 and 10.3.18 taken together give a linear recursion defini-
tion for R.GI x; y; z; w/. There are a number of technical considerations, similar
to the care that must be taken in contracting edges, but nevertheless many other
properties analogous to those of the classical Tutte polynomial hold. For exam-
ple, R.GI x; y; z; w/ has a spanning tree expansion, a universality property, and
duality relation (in addition to Bollobás and Riordan’s work in [24, 25], see also
b − b
+ a
a + −
b a
Fig. 10.4 A signed bouquet graph, its signed chord diagram, and the boundary components of the
signed chord diagram
Las Vergnas’ early exploration [97], and recent work by Chmutov [39], Moffatt
[108], and [58, 59]). Furthermore, Chmutov and Pak [40], and Moffatt [107, 108]
have shown that R.GI x; y; z; w/ also extends the relation between the classical
Tutte polynomial and the Kauffman bracket and the Jones polynomial of knot theory
due to Thistlethwaite [130] and Kauffman [91].
10.3.4 Martin, or Circuit Partition, Polynomials
In his 1977 thesis, Martin [103] recursively defined polynomials M.G; x/ and
m.GIE x/ that encode, respectively, information about the families of circuits in 4-
regular Eulerian graphs and digraphs. Las Vergnas subsequently found a state model
expression for these polynomials, extended their properties to general Eulerian
graphs and digraphs, and further developed their theory (see [96, 98, 99]). Both
Martin [104] and Las Vergnas [99] found combinatorial interpretations for some
small integer evaluations of the polynomials, while combinatorial interpretations
for all integer values as well as some derivatives were given in [55–57], and by
Bollobás [22].
Transforms of the Martin polynomials, J.GI x/ and j.GI E x/, given in [54], and
then aptly named circuit partition polynomials in [11], facilitate these computations,
and for this reason we give the definitions below in terms of J and j . As do many of
the polynomials surveyed here, the circuit partition polynomials have several defini-
tions, including linear recursion formulations, generating function formulations, and
state model formulations. We give the state model definition, and refer the reader to
[56, 57] for the others.
As with other state model formulations, we must first specify what we mean
by a state of a graph (or digraph) in this context. Here an Eulerian graph must
have vertices all of even degree, but it need not be connected. An Eulerian digraph
must have the indegree equal to the outdegree at each vertex, and again need not be
connected.
Definition 10.3.19. An Eulerian graph state of an Eulerian graph G is the result of
replacing each 2n-valent vertex v of G with n 2-valent vertices joining pairs of half
edges originally adjacent to v. An Eulerian graph state of an Eulerian digraph G E
is defined similarly, except here each incoming half edge must be paired with an
outgoing half edge.
Note that a Eulerian graph state is a disjoint union of cycles, each consistently
oriented in the case of a digraph.
Definition 10.3.20. The circuit partition polynomial. Let G be an Eulerian graph,
let S t.G/ be the set of states of G, and let c.S / be the number of components in a
state S 2 S t.G/. Then the circuit partition polynomial has a state model formula-
tion given by X
J.GI x/ D x c.S/ :
S2St .G/
The circuit partition polynomial is defined similarly for Eulerian digraphs as

X
E x/ D
j.GI x c.S/ :
E
S2St .G/
The transforms between the circuit partition polynomials and the original Martin
polynomial, as extended to general Eulerian graphs and digraphs by Las Vergnas,
are:
J.GI x/ D xM .GI x C 2/ ; for G an Eulerian graph, and (10.1)

E x/ D xm GI
j.GI E x C 1 for G
E an Eulerian digraph: (10.2)
The circuit partition polynomials have “splitting” formulas, analogous to Tutte’s

identity for the chromatic polynomial given in Chap. 9, proofs for which may be
found in [54, 57]. These formulas derive from the Hopf algebra structures of the
generalized transition polynomial we discuss in Sect. 10.4.3, but may also be proved
combinatorially, as in [57] and by Bollobás [22].
Theorem 10.3.21. Let G be an Eulerian graph and G E be an Eulerian digraph. Then
X
J.GI x C y/ D J .AI x/ J .Ac I y/;
where the sum is over all subsets A E.G/ such that G restricted to both A and
Ac D E.G/ A is Eulerian. Also,
X
E x C y/ D
j.GI E x j AEc I y ;
j AI
where the sum is over all subsets AE E.G/ E such that G

E restricted to both AE and
AE is an Eulerian digraph.
c
The connection between the circuit partition polynomial of a digraph and the
!
Tutte polynomial of a planar graph G is through the oriented medial graph Gm
described in the previous chapter. Martin [103] proved the following, which we
extend to the circuit partition polynomial via (10.2).
!
Theorem 10.3.22. Let G be a connected planar graph, and let Gm be its oriented
medial graph. Then relationships among the Martin polynomial, circuit partition
polynomial, and Tutte polynomial are:
! !
j.Gm I x/ D xm.Gm I x C 1/ D xt.GI x C 1; x C 1/:
The proof of this theorem depends on a fundamental observation relating dele-

tion/contraction in G with choices of configurations at a vertex in an Eulerian graph
!
state of Gm , as illustrated in Fig. 10.5. Theorems 10.3.21 and 10.3.22 combine to
Fig. 10.5 An edge e in a planar graph G, with the corresponding vertex v in the oriented medial
!
graph Gm (dotted edges). Deleting e corresponds to one possible configuration at v in an Eulerian

!
graph state of Gm , while contracting e corresponds to the other
give the basis for many of the combinatorial interpretation of the Tutte polyno-
mial along the line y D x described in the previous chapter. For more details, see
Martin [103, 104], Las Vergnas [96, 98, 99], Bollobás [22], and also [54–57].
Evolving from the relation between the Tutte and Martin polynomials is the
theory of isotropic systems, which unifies essential properties of 4-regular graphs
and pairs of dual binary matroids. A series of papers throughout the 1980s and
1990s, including work by Bouchet [26–31], as well as Bouchet and Ghier [37], and
Jackson [87], significantly extends the relationship between the Tutte polynomial
of a planar graph and the Martin polynomial of its medial graph via the theory of
isotropic systems.
10.3.5 Interlace Polynomial
In [11], Arratia, Bollobás, and Sorkin defined a one-variable graph polynomial mo-
tivated by questions arising from DNA sequencing by hybridization addressed by
Arratia, Bollobás, Coppersmith, and Sorkin in [10], an application we will return
to in Sect. 10.5. In [12], Arratia, Bollobás, and Sorkin defined a two-variable inter-
lace polynomial, and showed that the original polynomial of [11] is a specialization
of it, renaming the original one-variable polynomial as the vertex-nullity interlace
polynomial due to its relationship with the two-variable generalization.
Remarkably, despite very different terminologies, motivations, and approaches,
the original vertex-nullity interlace polynomial of a graph may be realized as the
Tutte–Martin polynomial of an associated isotropic system (see Bouchet [36]). For
exploration of this relationship, see the works mentioned in Sect. 10.3.4, as well as
Aigner [3], Aigner and Mielke [4], Aigner and van der Holst [5], Allys [7], and also
Bouchet’s series on multimatroids [32–35].
Both the vertex-nullity interlace polynomial of a graph and the two-variable
interlace polynomial may be defined recursively via a pivot operation. This pivot
is defined as follows. Let vw be an edge of a graph G, and let Av , Aw , and Avw be
v w v w v
Avw Avw Avw
Av Aw Av Aw Av Aw
G Gvw Gvw-w
Fig. 10.6 Pivoting on the edge vw. Av , Aw , and Avw are the sets of vertices of G adjacent to v only,
w only, and to both v and w, respectively. These sets are constant in all the diagrams. Vertices of G
adjacent to neither v nor w are omitted. Heavy lines indicate that all edges are present, and dotted
lines represent nonedges. Note interchange of edges and nonedges among Av , Aw , and Avw
the sets of vertices in V .G/ n fv; wg adjacent to v only, w only, and to both v and
w, respectively. The pivot operation “toggles” the edges among Av , Aw and Avw , by
deleting existing edges and inserting edges between previously nonadjacent vertices.
The result of this operation is denoted G vw . More formally, G vw has the same vertex
set as G, and edge set equal to the symmetric difference E.G/ S , where S is the
complete tripartite graph with vertex classes Av , Aw and Avw . See Fig. 10.6.
Also, G a is the local complementation of G, defined as follows. Let N.a/ be
the neighbors of a, that is, the set fw 2 V W a and w are joined by an edgeg. The
graph G a is equal to G except that we “toggle” the edges among the neighbors of
a, switching edges to nonedges and vice versa.
Definition 10.3.23. Let G be a graph of order n, which may have loops, but no
multiple loops or multiple edges. The two-variable interlace polynomial may be
given recursively by q.En / D y n for En , the edgeless graph on n 0 vertices, with
q.G/ D q.G a/ C q.G ab b/ C ..x 1/2 1/q.G ab a b/;
for any edge ab where neither a nor b has a loop, and
q.G/ D q.G a/ C .x 1/q.G a a/;
for any looped vertex a.

Alternatively, the interlace polynomial has the following generating function
formulation.
Definition 10.3.24. Let G be a graph of order n, which may have loops, but no
multiple loops or multiple edges. Then the two-variable interlace polynomial may
be given by X
q.GI x; y/ D .x 1/r. GjS / .y 1/n. GjS / ;
SV .G/
where r. GjS / and n. GjS / D jS jr. GjS / are, respectively, the F2 -rank and nullity
of the adjacency matrix of GjS , the subgraph of G restricted to S .
Definition 10.3.25. The vertex-nullity interlace polynomial is defined recur-

sively as:
8
<x n if G D En ; the edgeless graph on n vertices
qN .GI x/ D
:q .G vI x/ C q .G vw wI x/ if vw 2 E.G/:
N N
This polynomial was shown to be well defined by Arratia, Bollobás, and Sorkin
for all simple graphs in [11], and then was shown in [12] to be a specialization of
the two-variable interlace polynomial as follows:
X
qN .GI y/ D q.GI 2; y/ D .y 1/n. GjW / :
W V .G/
An equivalent formulation for qN .GI x/ for simple graphs is given by Aigner

and van der Holst in [5].
A somewhat circuitous route through the circuit partition polynomial relates the
vertex-nullity interlace polynomial to the Tutte polynomial. First recall that a circle
graph on n vertices is a graph G derived from a chord diagram.
Two vertices v and w in G share an edge if and only if their corresponding chords
intersect in the chord diagram. Note that G is necessarily simple.
For circle graphs, the vertex-nullity interlace polynomial and the circuit partition
polynomial are related by the following theorem, noting that although G E may be a
multigraph, H is necessarily simple.
E is a 4-regular Eulerian digraph, C is
Theorem 10.3.26. ([11], Theorem 6.1). If G
E and H is the circle graph of the chord diagram deter-
any Eulerian circuit of G,
E x/ D xqN .H I x C 1/.
mined by C , then j.GI
This now allows us to relate the vertex-nullity interlace polynomial to the Tutte
polynomial, a relation proved in [62] and also observed by Arratia et al. at the end
of Sect. 7 in [12].
Theorem 10.3.27. If G is a planar graph, and H is the circle graph of some

!
Eulerian circuit of Gm , then qN .H I x/ D t.GI x; x/.
!
Proof. By Theorem 10.3.26, j.Gm I x/ D xqN .H I x C 1/, but recalling that the
circuit partition and Martin polynomials are simple translations of each other,
! !
we have from Theorem 10.3.22 that j.Gm I x/ D xm.Gm I x C 1/, and hence
!
qN .H I x/ D m.Gm I x/ D t.GI x; x/. t
u
The interlace polynomial has generated further interest and other applica-
tions in Balister et al. [14, 15], Glantz and Pelillo [72], and Ellis-Monaghan and
Sarmiento [62].
10.4 Multivariable Extensions
Multivariable extensions have proved valuable theoretical tools for many of the
polynomials we have seen since they capture information not encoded by the orig-
inal polynomial. More critically, powerful algebraic tools not applicable to the
original polynomial may be available to the multivariable version, providing new
means of extracting combinatorial information from the polynomial. Although the
multivariable indexing may make the defining notation somewhat bulky, these gen-
eralizations are natural extensions of classical versions, computed in exactly the
same ways, only now also keeping track of some additional parameters in the com-
putation processes.
10.4.1 Generalized Coloring Polynomials and the U-Polynomial
The evaluation of the chromatic polynomial at can be written as

X

G ./ D 1: (10.3)
WV !f1;:::;g
proper
This was generalized to a symmetric function over (commuting) indeterminates

x1 ; x2 ; : : : by Stanley [126] in the following way.
Q G D .V; G/ be a graph, let W V ! P D f1; 2; : : :g, and

Definition 10.4.1. Let
denote the product v2V x.v/ by x . Then the symmetric function generalization
of the chromatic polynomial is
X
XG .x/ WD X.GI x1 ; x2 ; : : :/ D x :
WV !P
proper
That this is a generalization of the chromatic polynomial can be seen by setting

xi D 1 for 1 i and xj D 0 for j > and noting that the expression in (10.3)
for the chromatic polynomial evaluated at results.
Generalizing polynomial graph invariants is not a theoretical exercise. The
original invariant encodes combinatorial information, and the multivariable general-
ization will encode not only the same information but also more refined information.
For example, the chromatic polynomial of any tree with n vertices has chromatic
polynomial x.x 1/n1 . But not all trees have the same XG .x/. For example, if
K1;3 is the 4-star graph and P 4 is the path of order 4, then XK1;3 .x/ has a term
xi xj3 for all i ¤ j , but such a term is not present in XP 4 .x/. In fact, it is still an
open question if X distinguishes trees, that is, if XT1 .x/ ¤ XT2 .x/, whenever T1
and T2 are not isomorphic trees.
A similar multivariable extension of the bad coloring polynomial is also natural,

especially given the importance of the latter because of its being equivalent to the
Tutte polynomial. The following generalization of the bad coloring polynomial is
also due to Stanley [128].
Definition 10.4.2. Let G D .V; E/ be a graph, let W V ! P D f1; 2; : : :g, and let
b./ be the set of monochromatic edges in the coloring given by . Then the sym-
metric function generalization of the bad coloring polynomial over indeterminates
x1 ; x2 ; : : : and t is
X
XG .x; t/ D .1 C t/jb./j x ;
WV !P
where the sum is over all possible colorings of the graph G.
Again, by setting xi D 1 for 1 i and xj D 0 for j > we get the

bad-coloring polynomial, and hence the Tutte polynomial. Therefore, XG .x; t/ is a
multivariable generalization of the Tutte polynomial.
There is another multivariable generalization of the Tutte polynomial that was
developed independently and for very different reasons. This generalization is called
the U-polynomial and is due to Noble and Welsh in [109].
Definition 10.4.3. Let G D .V; E/ be a graph. Then the U-polynomial of G is

X
UG .x; y/ D xn1 xnk .y 1/jAjr.A/ ;
AE
where n1 ; : : : ; nk are the numbers of vertices in the k different components of G

restricted to A.
Clearly, this is a generalization of the Tutte polynomial, as by setting xi D .x1/

for all i in UG .x; y/ we get .x 1/.G/ TG .x; y/. Note that the factor xn1 xnk
in every term keeps track of the number of vertices in the different components in
A. Thus, this is a refinement of the rank-nullity generating-function definition of
the Tutte polynomial where the factors x r.G/r.A/ D x .A/.G/ in each term keep
track of the number of components in A.
That UG captures more combinatorial information from G than the Tutte poly-
nomial can be seen by noting that UG contains the matching generating polynomial,
and thus the matching polynomial, as a specialization as well.
Theorem 10.4.4. For any graph G,
g.GI x/ D UG .1; t; 0; : : : ; 0; : : : ; y D 1/:
The U-polynomial has a deletion/contraction reduction relationship not in the

class of graphs but in the class of weighted graphs. To see this, we turn to the
W-polynomial also due to Noble and Welsh in [109]. A weighted graph consists
of a graph G D .V; E/, together with a weight function ! W V ! ZC .
If e is an edge of .G; !/ then .G n e; !/ is the weighted graph obtained from

.G; !/ by deleting e and leaving ! unchanged. If e is not a loop, .G=e; !=e/ is the
weighted graph obtained from .G; !/ by contracting e, and the weight function !=e
is defined as !=e.u/ D !.u/ for all u 2 V n fv; v0 g and !=e.v00 / D !.v/ C !.v0 /.
Definition 10.4.5. Let .G; !/ be a weighted graph. The W-polynomial may be
given recursively by the following rules. If e is an ordinary edge or a bridge, then
W.G; !/ .x; y/ D W.Gne; !/ .x; y/ C W.G=e; !=e/ .x; y/:
If e is a loop, then W.G; !/ .x; y/ D yW.Gne; !/ .x; y/. Finally, if .G; !/ is En , the
edgeless graph on n 0 vertices, with weights a1 ; : : : ; an , then W.En ; !/ .x; y/ D
xa1 xan .
That the resulting multivariate polynomial W is independent of the order in which
the edges are deleted and contracted is proved in [109]. This can easily be done
by induction on the number of edges once it is proved that the order in which you
contract or delete edges in .G; !/ does not affect the weighted graph that you obtain.
The U-polynomial is obtained from the W-polynomial by setting all weights
equal to 1 and a proof that this definition is equivalent to Definition 10.4.3 can
be found in [109]. Actually in [109] it is proved that W has a representation of the
form X
W.G; !/ .x; y/ D xc1 xck .y 1/jAjr.A/ ;
AE
where ci , for 1 i k, is the total weight of the i th component of the weighted

subgraph .A; !/.
Noble and Welsh [109] show that the symmetric function generalization of the
bad coloring polynomial and the U-polynomial are equivalent in the following
sense.
Theorem 10.4.6. For any graph P G, the polynomials UG and XG determine each
other in that if p0 D 1 and pr D i xir , then
pj
XG .x; t/ D t jV j UG xj D ;y D t C 1 :
t
There is yet another polynomial, the polychromate, introduced originally by
Brylawski in [38], that is as general as UG or XG . Given a graph G and a parti-
tion of its vertices into nonempty blocks, let e./ be the number of edges with
both ends in the same block of the partition. If ./ D .n1 ; : : : ; nk / is the type of
Q n
the partition , we denote by x ./ the monomial kiD1 xi i .
Definition 10.4.7. Let G be a graph. Then the polychromate
G .x; y/ is
X

G .x; y/ D y e./ x ./ ;

where the sum is over all partitions of V .G/.

We have the following theorem due to Sarmiento in [119], with an alternative

proof given by Merino and Noble [106].
Theorem 10.4.8. The polynomials UG .x; y/ and
G .x; y/ are equivalent.
The story does not end here. All three polynomials UG .x; y/, XG .x; t/ and
G .x; y/ have natural extensions. For example, the extension of the XG .x; t/
replaces the t variable by countably infinitely many variables t1 ; t2 ; : : :, thus enu-
merating not just the total number of monochromatic edges but the number of
monochromatic edges of each color. It is defined as follows:
1
!
X Y
XG .x; t/ D .1 C ti /jbi ./j x ;
WV !P i D1
where the sum is over all colorings of G and bi ./ is the set of monochromatic
edges for which both end points have color i . By setting ti D t for all i 1 we
regain XG .x; t/.
For the other extensions the reader is referred to Merino and Noble [106], where
it is also proved that all of these extensions are equivalent.
10.4.2 The Parametrized Tutte Polynomial
The basic idea of a parametrized Tutte polynomial is to allow each edge of a graph
to have four parameters (four ring values specific to that edge), which apply as the
Tutte polynomial is computed via a deletion/contraction recursion. Which parameter
is applied in a linear recursion reduction depends on whether the edge is deleted or
contracted as an ordinary edge, or whether it is contracted as an isthmus or deleted as
a loop. The difficulty lies in ensuring that a well-defined function, that is, one inde-
pendent of the order of deletion/contraction, results. This requires a set of relations,
coming from three very small graphs, to be satisfied. Interestingly, additional con-
straints are necessary for there to be a corank-nullity expansion or even for the func-
tion to be multiplicative or a graph invariant, that is, equal on isomorphic graphs.
The motivation for allowing edge-specific values for the deletion/contraction re-
cursion comes from a number of applications where it is natural. This includes
graphs with signed edges coming from knot theory, graphs with edge-specific failure
probabilities in network reliability, and graphs whose edges represent various inter-
action energies within a molecular lattice in statistical mechanics. Although there
is compelling motivation for allowing various edge parameters, the technical details
of a general theory are challenging. The two major works in this area are Zaslavsky
[142] and Bollobás and Riordan [23]. However, these two works take different
approaches, which were subsequently reconciled with a mild generalization in [63],
and for this reason we adopt the formalism of [63]. Bollobás and Riordan [23]
also give a succinct historical overview of the development of these multivariable
extensions.
For the purposes of the following, we consider a class of graphs minor-closed if

it is closed under the deletion of loops, the contraction of bridges, and the contrac-
tion and deletion of ordinary edges; however, we do not require closure under the
deletion of bridges. Some formalism is necessary to handle the parameters.
Definition 10.4.9. Let U be a class, and let R be a commutative ring. Then an
R-parametrization of U consists of four parameter functions x; y; X; Y W U ! R,
denoted e ! xe ; ye ; Xe ; Ye .
Definition 10.4.10. Let U be an R-parametrized class, and let be a minor-closed

class of graphs with E.G/ U for all G 2 . Then a parametrized Tutte polyno-
mial on is a function T W ! R that satisfies the following: T .G/ D Xe T .G=e/
for any bridge e of G 2 , and T .G/ D Ye T .G e/ for any loop e of G 2 , and
T .G/ D ye T .G e/ C xe T .G=e/ for any ordinary edge e.
The following theorem gives the central result. The identity in Item 1
comes from requiring to be equal the two ways of carrying out deletion/
contraction reductions on ˚a graph on two vertices with two parallel edges e1
and e2 having parameters xei ; yei ; Xei ; Yei . Similarly, the identities in Items 2
and 3 come from considering the -graph and K3 . Here again En is the edgeless
graph on n vertices.
Theorem 10.4.11 (The generalized Zaslavsky–Bollobás–Riordan theorem
for graphs). Let R be a commutative ring, let be a minor-closed class of
graphs whose edge-sets are contained in an R-parametrized class U , and let a1 ,
a2 , . . . 2 R. Then there is a parametrized Tutte polynomial T on with T .En / D an
for all n with En 2 if and only if the following identities are satisfied.
1. Whenever e1 and e2 appear together in a circuit of a k-component graph G 2 ,
then ak .xe1 Ye2 C ye1 Xe2 / D ak .xe2 Ye1 C ye2 Xe1 /.
2. Whenever e1 , e2 and e3 appear together in a circuit of a k-component graph
G 2 , then ak Xe3 .xe1 Ye2 C ye1 xe2 / D ak Xe3 .Ye1 xe2 C xe1 ye2 /.
3. Whenever e1 , e2 and e3 are parallel to one another in a k-component graph
G 2 , then ak Ye3 .xe1 Ye2 C ye1 xe2 / D ak Ye3 .Ye1 xe2 C xe1 ye2 /.
A most general parametrized Tutte polynomial, which possibly could be called
the parametrized Tutte polynomial, might begin with the polynomial ring on
independent variables fxe ; ye ; Xe ; Ye : e 2 U g [ fai W i 1g. However, the re-
sulting function is not technically a polynomial, in that it must take its values not in
the polynomial ring, but has as R the polynomial ring modulo the ideal generated
by the identities in Theorem 10.4.11.
The question also arises as to whether “the most general” parametrized Tutte
polynomial should be multiplicative on disjoint unions and the one-point joint of
graphs, as this introduces additional relations among the ai ’s. This is because a
parametrized Tutte polynomial is not necessarily multiplicative. A sufficient condi-
tion is the following.
Proposition 10.4.12. Suppose T is a parametrized Tutte polynomial on a minor-

closed class of graphs that contains at least one graph with k components for every
k and that is closed under one-point unions and the removal of isolated vertices.
Then T is multiplicative with respect to both disjoint unions and one-point joins if
and only if the ai D T .Ei is idempotent, and ak D a1 for all k 1.
Bollobás and Riordan [23] emphasize graph invariants, and hence require that
the parametrization be a coloring of the graph. That is, graphs are edge-colored (not
necessarily properly), with edges of the same color having the same parameter sets.
This enables consideration of parametrized Tutte polynomials that are invariants of
colored graphs, but requires the following additional constraints. For every e1 2 U ,
there are e2 , e3 2 U with e1 ¤ e2 ¤ e3 ¤ e1 such that xe1 D xe2 D xe3 ,
ye1 D ye2 D ye3 , Xe1 D Xe2 D Xe3 , and Ye1 D Ye2 D Ye3 .
Proofs of the above results and further details may be found in [23, 63, 142]. We
note that any relation between this Tutte polynomial generalization with its edge
parameters, and the W- and U-polynomials of Sect. 10.4.1 with their vertex weights,
has not yet been studied.
Interestingly, although the parametrized Tutte polynomial has an activities ex-
pansion analogous to that of the classical Tutte polynomial, it does not necessarily
have an analog of the rank-nullity formulation. However, under modest assumptions
involving nonzero parameters and some inverses, the parametrized Tutte polynomial
may be expressed in a rank-nullity form. This is fortunate, because significant results
for the zeros of the chromatic and Tutte polynomial have arisen from such a multi-
variable realization. Examples may be found in Sokal [124], Royle and Sokal [118],
and Choe et al. [41].
10.4.3 The Generalized Transition Polynomial
A number of state model polynomials, for example the circuit partition polynomials,
Penrose polynomial, the Kauffman bracket for knots and links, and the transition
polynomials of Jaeger [89], which are not specializations of the Tutte polynomial,
are specializations of the multivariable generalized transition polynomial of [61]
which we describe here. This multivariable extension is a Hopf algebra map, which
leads to structural identities that then inform its various specializations. The medial
graph construction that relates the circuit partition polynomial and the classical Tutte
polynomial extends to similarly relate the generalized transition polynomial and the
parametrized Tutte polynomial when it has a rank-nullity formulation.
The graphs here are Eulerian, although not necessarily connected, with loops and
multiple edges allowed. A vertex state, or transition, is a choice of local reconfig-
uration of a graph at a vertex by pairing the half edges incident with that vertex.
A graph state, or transition system, S.G/, is the result of choosing a vertex state
at each vertex of degree greater than 2, and hence is a union of disjoint cycles. We
write St.G/ for the set of graph states of G, and throughout we assume weights have
values in R, a commutative ring with unity.
A skein relation for graphs is a formal sum of weighted vertex states, together
with an evaluation of the terminal forms (the graph states). See [54,61] for a detailed
discussion of these concepts, which are appropriated from knot theory, in their most
general form, and Yetter [141] for a general theory of invariants given by linear
recursion relations. A skein type (or state model, or transition) polynomial is one
which is computed by repeated applications of skein relations. See Jaeger [89] for a
comprehensive treatment of these in the case of 4-regular graphs.
For brevity, we elide technical details such as free loops and isomorphism classes
of graphs with weight systems which may be found in [61].
Definition 10.4.13. Pair, vertex, and state weights.

1. A pair weight is an association of a value p ev ; ev0 in a unitary ring R to a pair of
half edges incident with a vertex v in G. A weight system, W .G/, of an Eulerian
graph G is an assignment of a pair weight to every possible pair of adjacent half
edges of G. Q
2. The vertex state weight of a vertex state is p.ev ; ev0 / where the product is over
the pairs of half edges comprising the vertex state.
3. The stateQweight of a graph state S of a graph G with weight system W is
!.S / D !.v; S /, where !.v; S / is the vertex state weight of the vertex state
at v in the graph state S , and where the product is over all vertices of G.
When A is an Eulerian subgraph of an Eulerian graph G with weight sys-
tem W .G/, then A inherits its weight system W .A/ from G in the obvious way,
with each pair of adjacent edges in A having the same pair weight as it has in
G.
Qn1When A is a graph resulting from locally replacing the vertex v by one of its
i D0 .2n .2i C 1// vertex states, then all the pair weights are the same as they
are in G, except that all the pairs of half edges adjacent to the newly formed vertices
of degree 2 in A have pair weight equal to 1, the identity in R.
The generalized transition polynomial N .GI W; x/ has several formulations, and
we give two of them, a linear recursion formula and a state model formula, here.
Definition 10.4.14. The generalized transition polynomial, N.GI W; x/, is defined

recursively by repeatedly applying the skein relation
X
N.GI W; x/ D ˇi N.Gi I W .Gi /; x/
at any vertex v of degree greater than 2. Here the Gi ’s are the graphs that result
from locally replacing a vertex v of degree 2n in G by one of its vertex states. The
ˇi ’s are the vertex state weights. Repeated application of this relation reduces G to a
weighted (formal) sum of disjoint unions of cycles (the graph states). These terminal
forms are evaluated by identifying each cycle with the variable x, weighted by the
product of the pair weights over all pairs of half edges in the cycle.
Definition 10.4.15. The state model definition of the generalized transition polyno-
mial is:
! !
X Y X
N.GI W; x/ D ! .v; S / x k.S/ D ! .S / x k.S/ :
St .G/ St .G/
Note that vertex states commute; that is, if Guv results from choosing a vertex
state at u, and then at v, we have Guv D Gvu . Thus, Definition 10.4.14 gives a well-
defined function, and Definitions 10.4.14 and 10.4.15 are equivalent.
Several of the polynomials we have already seen are specializations of this gen-
eralized transition polynomial. For example, if all the pair weights are 1, then the
circuit partition polynomial for an unoriented Eulerian graph results. If G E is an
Eulerian digraph, and G is the underlying undirected graph with pair weights of 1
for pairs half edges corresponding to one inward and one outward oriented half edge
of GE and 0 otherwise, then the oriented version of the circuit partition polynomial
results.
In the special case that G is 4-regular, the polynomial N .GI W; x/ is essentially
the same as the transition polynomial Q.G; A; / of Jaeger [89], where G is a 4-
regular graph and A is a system of vertex state weights (rather than pair weights). If
the vertex state weight in .G; A/ is w, then define W .G/ by letting
p the pair weights
for each of the two pairs of edges determined by the state be w. The two poly-
nomials then just differ by a factor of x, so N .GI W; x/ D xQ.G; A; x/, and here
we retain vertices of degree 2 in the recursion while they are elided in [89]. Thus
N .GI W; x/ gives a generalization of Jaeger’s transition polynomials to all Eulerian
graphs.
Because Q.G; A; / assimilates the original Martin polynomial for 4-regular
graphs and digraphs, the Penrose polynomial, and the Kauffman bracket of knot
theory (see [89]), and N .GI W; x/ assimilates Q.G; A; /, we have that the Penrose
polynomial and Kauffman bracket are also specializations of N .GI W; x/. Specif-
ically, if G is a planar graph with face two-colored medial graph Gm , and we
give a weight system to Gm by assigning a value of 1 to pairs of edges that
either cross at a vertex or bound the same black face and 0 otherwise, then
N .Gm I W; x/ D P .GI x/. Similarly, if L is a link, and GL is the signed, face
two-colored
universeof L, then a weight system can be assigned to GL so that
N GL I W; a2 C a2 D .a2 C a2 /KŒL where KŒL is the Kauffman bracket of
the link.
Because of these specializations, the algebraic properties of the generalized
transition polynomial are available to inform these other polynomials as well.
In particular, N .GI W; x/ is a Hopf algebra map from the freely generated (com-
mutative) hereditary Hopf algebra of Eulerian graphs with weight systems to the
binomial bialgebra RŒx (details may be found in [61]). This leads to two structural
identities, the first from the comultiplication in the Hopf algebra, the second from
the antipode.
Theorem 10.4.16. Let G be an Eulerian graph. Then

X
N .GI W; x C y/ D N .A1 I W .A1 / ; x/ N .A2 I W .A2 / ; y/
where the sum is over all ordered partitions of G into two edge-disjoint Eulerian
subgraphs A1 and A2 , and
N .GI W; x/ D N . .GI W / ; x/ ;

P
where is the antipode .G; W / D .1/jP j .A1 AjP j /, with the sum over
all ordered partitions P of G into jP j edge-disjoint Eulerian subgraphs each with
inherited weight system. Here N.GI W; x/ is extended linearly over such formal
sums.
This type of Hopf algebraic structure has already been used to considerably
extend the known combinatorial interpretations for evaluations of the Martin,
Penrose, and Tutte polynomials implicitly by Bollobás [22], and explicitly by Ellis-
Monaghan and Sarmiento [54, 56, 57, 60, 120]. The first identity has been used to
find combinatorial interpretations for the Martin polynomials for all integers, where
this was previously only known for 2, 1, 0, 1 in the oriented case, and 2, 0, 2
in the unoriented case. This then led to combinatorial interpretations for the Tutte
polynomial (and its derivatives) of a planar graph for all integers along the line
x D y, where previously 1, 3 were the only known nontrivial values. These results
for the Tutte polynomial were mentioned in Chap. 9 and for the circuit partition
polynomial in Sect. 10.3.4. The second identity has been used to determine combi-
natorial interpretations for the Penrose polynomial for all negative integers, where
this was previously only known for positive integers.
10.5 Two Applications
Graph polynomials have a wide range of applications throughout many fields. We

have already seen some examples of this with various applications of the classical
Tutte polynomial in the previous chapter. Here we present two representative im-
portant applications (out of many possible) and show how they may be modeled by
graph polynomials.
10.5.1 DNA Sequencing
We begin with string reconstruction, a problem that may be modeled by the inter-
lace and circuit partition polynomials (and hence indirectly in special cases by the
Tutte polynomial). String reconstruction is the process of reassembling a long string
of symbols from a set of its subsequences together with some (possibly incom-
plete, redundant, or corrupt) sequencing information. Although we focus on DNA
sequencing, which was the original motivation for the development of the inter-
lace polynomial, the methods here apply to any string reconstruction problem. For
example, fragmenting and reassembling messages is a common network protocol,
and reconstruction techniques might be applied when the network protocol has been
disrupted, yet the original message must be reassembled from the fragments.
DNA sequences are typically too long to read at once with current labora-
tory techniques, so researchers probe for shorter fragments (reads) of the strand.
They then are faced with the difficulty of recovering the original long sequence
from the resulting set of subsequences. DNA sequencing by hybridization is a
method of reconstructing the nucleotide sequence from a set of short substrings
(see Waterman [136] for an overview). The problem of determining the number of
possible reconstructions may be modeled using Eulerian digraphs, with a correct se-
quencing of the original strand corresponding to exactly one of the possible Eulerian
circuits in the graph. The probability of correctly sequencing the original strand is
thus the reciprocal of the total number of Euler circuits in the graph.
The most basic (two-way repeats only) combinatorial model for DNA sequenc-
ing by hybridization uses an Eulerian digraph with two incoming and two outgoing
edges at each vertex (see Pevzner [114] and Arratia et al. [9]). The raw data
consist of all subsequences of the DNA strand of a fixed length L, called the
L-spectrum of the sequence. As L increases, the statistical probability that the
beginning and end of the DNA strand are the same approaches zero, as does
the likelihood of three or more repeats of the same pattern of length L or more
in the strand (see Dyer et al. [48]). Thus, this model assumes that the only con-
sideration in reconstructing the original sequence is the appearance of interlaced
two-way repeats, that is, alternating patterns of length L or greater, for example,
: : : ACTG : : : CTCT : : : ACTG : : : CTCT : : : .
From the multiset (duplicates are allowed) of subsequences of length L, create
a single vertex of the de Bruijn graph for each subsequence of length L-1 that ap-
pears in one of the subsequences. For example, if L D 4 and ACTG appears as a
subsequence, create two vertices, one labeled ACT and one labeled CTG. Edges are
directed from head to tail of a subsequence; e.g., there would be a directed edge
labeled ACTG from the vertex labeled ACT to the vertex labeled CTG. If there is
another subsequence ACTT, we do not create another vertex ACT, but rather draw
an edge labeled ACTT from the vertex ACT to a new vertex labeled CTT. If, in the
multiset of subsequences, ACTG appears twice, then we draw two edges from ACT
to CTG.
The beginning and end of the strand are identified to be represented by the
same vertex, and, since by assumption no subsequence appears more than twice,
the result is an Eulerian digraph of maximum degree 4. Tracing the original DNA
sequence in this graph corresponds to an Eulerian circuit that starts at the vertex
representing the beginning and end of the strand. All other possible sequences that
could be (mis)reconstructed from the multiset of subsequences correspond to other
Eulerian circuits in this graph. Thus (up to minor reductions for long repeats and
forced subsequences), finding the number of DNA sequences possible from a given
multiset of subsequences corresponds to enumerating the Eulerian circuits in this
directed graph.
The generalized transition polynomial models this problem directly: when the
pair weights are identically 1, it reduces to the circuit partition polynomial. This is
a generating function for families of circuits in a graph, so the coefficient of x is
the number of Eulerian circuits. The interlace polynomial informs the problem as
follows. Consider an Eulerian circuit through the de Bruijn graph, which gives a se-
quence of the vertices visited in order. Now construct the interlace graph by placing
a vertex for each symbol and an edge between symbols that are interlaced (occur in
alternation) in the sequence. The interlace polynomial of the interlace graph is then
a translation of the circuit partition polynomial of the original de Bruijn graph, as in
Theorem 10.3.26, where again the coefficient of x is the number of Eulerian circuits
(see Arratia et al. [10, 11, 13]).
One of the original motivating goals of Arratia et al. [10] was classifying Eulerian
digraphs with a given number of Eulerian circuits. The BEST theorem, a formula
for the number of the circuits of an Eulerian graph in terms of its Kirchhoff matrix
(see Fleischner [70] for good exposition) gives only a tautological classification: the
Eulerian digraphs with m Eulerian circuits are those where the BEST theorem for-
mula gives m circuits. Critically, all of the above graph polynomials encode much
more information than is available from the BEST theorem, and all of them are em-
bedded in broader algebraic structures that provide tools for extracting information
from them. Thus, they better serve the goal of seeking structural characterizations
of graph classes with specified Eulerian circuit properties.
10.5.2 The Potts Model of Statistical Mechanics
Here we have an important physics model that remarkably was found to be exactly
equivalent to the Tutte polynomial.
Complex systems are networks in which very simple interactions at the mi-
croscale level determine the macroscale behavior of the system. The Potts model
of statistical mechanics models complex systems whose behaviors depend on near-
est neighbor energy interactions. This model plays an important role in the theory
of phase transitions and critical phenomena, and has applications as widely varied
as magnetism, adsorption of gases on substrates, foam behaviors, and social demo-
graphics, with important biological examples including disease transmission, cell
migration, tissue engulfment, diffusion across a membrane, and cell sorting.
Central to the Potts model is the Hamiltonian,
X
h.!/ D J ı.i ; j /;
fi;j g2E.G/
a measure of the energy of the system. Here a spin, i , at a vertex i , is a choice of

condition (for example, healthy, infected, or necrotic for a cell represented by the
vertex). J is a measure of the interaction energy between neighboring vertices, ! is

a state of a graph G (here a state is a fixed choice of spin at each vertex), and ı is
the Kronecker delta function.
The Potts model partition function is the normalization factor for the Boltzmann
probability distribution. Systems such as the Potts model, following Boltzmann
distribution laws, will have the number of states with a given energy (Hamiltonian
value) exponentially distributed. Thus, the probability of the system being in a par-
ticular state ! at temperature t is:
exp .ˇh .!//

Pr .!; ˇ/ D P :
exp .ˇh .$//
1
Here, the sum is over all possible states $ of G, and ˇ D t , where D
23
1:38 10 J/K is the Boltzmann constant. The parameter t is an important
variable in the model, although it may not represent physical temperature, but
some other measure of volatility relevant to the particular application (for exam-
ple, ease of disease
P transmission/reinfection). The denominator of this expression,
P .GI q; ˇ/ D exp .ˇh .$//, called the Potts model partition function, is the
most critical, and difficult, part of the model.
Remarkably, the Potts model partition function is equivalent to the Tutte
polynomial:

qCv
P .GI q; ˇ/ D q k.G/ vjv.G/jk.G/ T GI ;v C 1 ;
v
where q is the number of possible spins, and v D exp.Jˇ/ 1. See Fortuin

and Kasteleyn [71] for the nascent stages of this theory, later exposition in
Tutte [134], Biggs [20], Bollobás [21], Welsh [137, 139], and surveys by Welsh
and Merino [140], and Beaudin et al. [17].
One common extension of the Potts model involves allowing interaction ener-
P to depend on individual edges. With this, the Hamiltonian becomes h.!/ D
gies
e2E.G/ Je ı.i ; j /, where Je is the interaction energy on the edge e. The parti-
tion function is then
X Y
P .G/ D q k.A/ ve ;
AE .G/ e2A
where ve D exp .ˇJe / 1. Again see Fortuin and Kasteleyn [71], and more recently
Sokal [122,123]. As we have seen in Sect. 10.4.2, the Tutte polynomial has also been
extended to parametrized Tutte functions that incorporate edge weights. The gen-
eralized partition function given above satisfies the relations of Theorem 10.4.11,
however, and thus is a special case of a parametrized Tutte function.
This relationship between the Potts model partition function and the Tutte poly-
nomial has led to a remarkable synergy between the fields, particularly, for example,
in the areas of computational complexity and the zeros of the Tutte and chromatic
polynomials. For overviews, see Welsh and Merino [140], and Beaudin et al. [17].
10.6 Conclusion
There are a great many other graph polynomials equally interesting to those sur-
veyed here, including, for example, the F-polynomials of Farrell, the Hosaya or
Wiener polynomial, the clique/independence and adjoint polynomials, etc. In partic-
ular, Farrell [66] has a circuit cover polynomial (different from the circuit partition
polynomial of Sect. 10.3.4) with noteworthy interrelations with the characteristic
polynomial. There are rich connections between graph theory and knot theory via
the Tutte polynomial, including a relation to the HOMFLY polynomial given by
Jaeger [88], with applications in biology such as Emmert-Streib [64]. Also, Chung
and Graham developed a “Tutte-like” polynomial for directed graphs in [43]. The
resultant cover polynomial is extended to a symmetric function generalization, like
those in Sect. 10.4.1, by Chow [42]. Similarly, Courcelle [44] and Traldi [131] have
also very recently developed multivariable extensions of the interlace polynomial.
Some surveys of graph polynomials with complementary coverage to this one in-
clude Pathasarthy [111], Jaeger [89], Farrell [68], Fiol [69], Godsil [74], Aigner [2],
Noy [110], and Levit and Mandrescu [100].
Acknowledgments We thank all the friends and colleagues who offered many helpful comments
and suggestions during the writing of this chapter.
The first author was supported by the National Security Agency and by the Vermont Genetics
Network through Grant Number P20 RR16462 from the INBRE Program of the National Center
for Research Resources (NCRR), a component of the National Institutes of Health (NIH).
The second author was supported by Conacyt of Mexico, Grant 83977.
References
1. Aigner M (1997) The Penrose polynomial of a plane graph. Ann Math 307:173–189
2. Aigner M (1997) The Penrose polynomial of graphs and matroids. In: Hirschfeld JWP (ed)
Surveys in combinatorics, 2001. Cambridge University Press, Cambridge
3. Aigner M (2000) Die Ideen von Penrose zum 4-Farbenproblem. Jahresber Deutsch Math-
Verein 102:43–68
4. Aigner M, Mielke H (2000) The Penrose polynomial of binary matroids. Monatsh Math
131:1–13
5. Aigner M, van der Holst H (2004) Interlace polynomials. Lin Algebra Appl 377:11–30
6. Aihara J (1976) A new definition of Dewar-type resonance energies. J Am Chem Soc
98:2750–2758
7. Allys L (1994) Minimally 3-connected isotropic systems. Combinatorica 14:247–262
8. Alon N, Tarsi M (1992) Colorings and orientations of graphs. Combinatorica 12:125–134
9. Arratia R, Martin D, Reinert G, Waterman M (1996) Poisson process approximation for
sequence by hybridization. J Comput Biol 3:425–463
10. Arratia R, Bollobás B, Coppersmith D, Sorkin G (2000) Euler circuits and DNA sequencing
by hybridization, combinatorial molecular biology. Discrete Appl Math 104:63–96
11. Arratia R, Bollobás B, Sorkin G (2000) The interlace polynomial: a new graph polyno-
mial. In: Proceedings of the 11th annual ACM-SIAM symposium on discrete algorithms.
San Francisco, CA
12. Arratia R, Bollobás B, Sorkin G (2004) A two-variable interlace polynomial. Combinatorica
24:567–584
13. Arratia R, Bollobás B, Sorkin G (2004) The interlace polynomial of a graph. J Combin Theory
B 92:199–233
14. Balister PN, Bollobás B, Riordan OM, Scott AD (2001) Alternating knot diagrams, Euler
circuits and the interlace polynomial. Eur J Combinator 22:1–4
15. Balister PN, Bollobás B, Cutler J, Pebody L (2002) The interlace polynomial of graphs at 1.
Eur J Combinator 23:761–767
16. Barvinok AI (1994) Computing the Ehrhart polynomial of a convex lattice polytope. Discrete
Comput Geom 12:35–48
17. Beaudin L, Ellis-Monaghan JA, Pangborn G, Shrock R (2010) A little statistical mechanics
for the graph theorist. Discrete Math 310:2037–2053
18. Beck M, Robins S (2007) Computing the continuous discretely: integer-point enumeration in
polyhedra. Springer, New York
19. Betke U, Kneser M (1985) Zerlegungen und Bewertungen von Gitterpolytopen. J Reine
Angew Math 358:202–208
20. Biggs N (1996) Algebraic graph theory, 2nd edn. Cambridge University Press, Cambridge
21. Bollobás B (1998) Modern graph theory. Graduate text in mathematics. Springer, Berlin,
New York
22. Bollobás B (2002) Evaluations of the circuit partition polynomial. J Combin Theory B
85:261–268
23. Bollobás B, Riordan O (1999) A Tutte polynomial for coloured graphs. Combinator Probab
Comput 8:45–93
24. Bollobás B, Riordan O (2001) A polynomial invariant of graphs on orientable surfaces. Proc
Lond Math Soc 83:513–531
25. Bollobás B, Riordan O (2002) A polynomial of graphs on surfaces. Ann Math 323:81–96
26. Bouchet A (1987) Isotropic systems. Eur J Combinator 8:231–244
27. Bouchet A (1987) Reducing prime graphs and recognizing circle graphs. Combinatorica
7:243–254
28. Bouchet A (1988) Graphic presentations of isotropic systems. J Combin Theory B 45:58–76
29. Bouchet A (1989) Connectivity of isotropic systems. (J Combin Math, Proceedings of the 3rd
international conference, New York, 1985) Ann N Y Acad Sci 555:81–93
30. Bouchet A (1991) Tutte–Martin polynomials and orienting vectors of isotropic systems.
Graph Combinator 7:235–252
31. Bouchet A (1993) Compatible Euler tours and supplementary Eulerian vectors. Eur J Combi-
nator 14:513–520
32. Bouchet A (1997) Multimatroids. I. Coverings by independent sets. SIAM J Discrete Math
10:626–646
33. Bouchet A (1998) Multimatroids. II. Orthogonality, minors and connectivity. Electron J Com-
binator 5, R8
34. Bouchet A (1998) Multimatroids. IV. Chain-group representations. Lin Algebra Appl
277:271–289
35. Bouchet A (2001) Multimatroids. III. Tightness and fundamental graphs. Eur J Combinator
22:657–677
36. Bouchet A (2005) Graph polynomials derived from Tutte–Martin polynomials. Discrete Math
302:32–38
37. Bouchet A, Ghier L (1996) Connectivity and ˇ invariants of isotropic systems and 4-regular
38. Brylawski TH (1981) Intersection theory for graphs. J Combin Theory B 30:233–246
39. Chmutov S (2009) Generalized duality for graphs on surfaces and the signed Bollobás-
Riordan polynomial. J Combin Theory B 99:617–638
40. Chmutov S, Pak I (2007) The Kauffman bracket of virtual links and the Bollobás-Riordan
polynomial. Mosc Math J 7:409–418, 573
41. Choe Y-B, Oxley J, Sokal A, Wagner D (2004) Homogeneous multivariate polynomials with
the half-plane property. Adv Appl Math 32:88–187
42. Chow T (1996) The path-cycle symmetric function of a digraph. Adv Math 118:71–98
43. Chung FRK, Graham RL (1995) On the cover polynomial of a digraph. J Combin Theory B
65:273–290
44. Courcelle B (2008) A multivariate interlace polynomial and its computation for graphs of
bounded clique-width. Electron J Combinator 15(1):R69
45. Cvetković DM, Doob M, Sachs H (1980) Spectra of graphs: theory and applications.
Academic, New York
46. Cvetković DM, Lepović M (1998) Seeking counterexamples to the reconstruction conjecture
for characteristic polynomials of graphs and a positive result. Bull Acad Serbe Sci Arts, Cl
Sci Math Natur, Sci Math 116:91–100
47. Diaz R, Robins S (1997) The Ehrhart polynomial of a lattice polytope. Ann Math 145:
503–518
48. Dyer M, Frieze A, Suen S (1994) The probability of unique solutions of sequencing by
hybridization. J Comput Biol 1:105–110
49. Ehrhart E (1967) Démonstration de la loi de réciprocité du polyèdre rationnel. C R Acad Sci
Paris Sér A–B 265:A91–A94
50. Ehrhart E (1967) Sur un problème de géometrie diophantienne linéaire I. J Reine Angew Math
226:1–29
51. Ehrhart E (1967) Sur un problème de géometrie diophantienne linéaire II. J Reine Angew
Math 227:25–49
52. Ehrhart E (1977) Polynômes Arithmétiques et Méthode des Polyèdres en Combinatoire.
International Series of Numerical Mathematics vol 35. Birkhäuser, Basel-Stuttgart
53. Ellingham MN, Goddyn L (1996) List edge colourings of some 1-factorable multigraphs.
54. Ellis-Monaghan JA (1998) New results for the Martin polynomial. J Combin Theory B
74:326–352
55. Ellis-Monaghan JA (2000) Differentiating the Martin polynomial. Cong Numer 142:173–183
56. Ellis-Monaghan JA (2004) Exploring the Tutte–Martin connection. Discrete Math 281:
173–187
57. Ellis-Monaghan JA (2004) Identities for circuit partition polynomials, with applications to the
Tutte polynomial. Adv Appl Math 32:188–197
58. Ellis-Monaghan JA, Moffatt I. Twisted duality and polynomials of embedded graphs, preprint
arXiv:0906.5557
59. Ellis-Monaghan JA, Sarmiento I. A recipe theorem for the topological Tutte polynomial of
Bollobás and Riordan, preprint arXiv:0903.2643
60. Ellis-Monaghan JA, Sarmiento I (2001) Medial graphs and the Penrose polynomial. Congr
Numer 150:211–222
61. Ellis-Monaghan JA, Sarmiento I (2002) Generalized transition polynomials. Congr Numer
155:57–69
62. Ellis-Monaghan JA, Sarmiento I (2007) Distance hereditary graphs and the interlace polyno-
mial. Combinator Probab Comput 16:947–973
63. Ellis-Monaghan JA, Traldi L (2006) Parametrized Tutte polynomials of graphs and matroids.
Combinator Probab Comput 15:835–834
64. Emmert-Streib F (2006) Algorithmic computation of knot polynomials of secondary structure
elements of proteins. J Comput Biol 13(8):1503–1512
65. Farrell EJ (1979) An introduction to matching polynomials. J Combin Theory B 27:75–86
66. Farrell EJ (1979) On a class of polynomials obtained from the circuits in a graph and its
application to characteristic polynomials of graphs. Discrete Math 25:121–133
67. Farrell EJ (1988) On the matching polynomial and its relation to the rook polynomial.
J Franklin Inst 325:527–543
68. Farrell EJ (1993) The impact of F -polynomials in graph theory, Quo vadis, graph theory?
Ann Discrete Math, North-Holland, Amsterdam, 55:173–178
69. Fiol MA (1997) Some applications of the proper and adjacency polynomials in the theory of
graph spectra. Electron J Combinator 4(1):R21
70. Fleischner H (1991) Eulerian graphs and related topics, part 1, vol 2, p 50. Ann Discrete Math,
North-Holland Publishing Co., Amsterdam
71. Fortuin CM, Kasteleyn PW (1972) On the random cluster model. Physica 57:536–564
72. Glantz R, Pelillo M (2006) Graph polynomials from principal pivoting. Discrete Math
306:3253–3266
73. Godsil CD (1981) Matchings and walks in graphs. J Graph Theory 5:285–297
74. Godsil CD (1984) Real graph polynomials. In: Bondy JA, Murty USR (eds) Progress in graph
theory. Academic, Toronto
75. Godsil CD (1993) Algebraic combinatorics. Chapman & Hall, New York
76. Godsil CD (1995) Tools from linear algebra. In: Graham RL, Grötschel M, Lovász L (eds)
Handbook of combinatorics, vol 2. Elsevier, Amsterdam
77. Gutman I (1991) Polynomials in graph theory. In: Bonchev D, Rouvray DH (eds) Chemical
graph theory: introduction and fundamentals. Abacus Press, New York
78. Gutman I, Cvetković DM (1975) The reconstruction problem for the characteristic polyno-
mial of graphs. Publ Electrotehn Fac Ser Fiz 488–541:45–48
79. Gutman I, Milun M, Trinajstić N (1976) Graph theory and molecular orbitals. XVIII. On
topological resonance energy. Croat Chem Acta 48:87–95
80. Gutman I, Milun M, Trinajstić N (1977) Graph theory and molecular orbitals. 19. Nonpara-
metric resonance energies of arbitrary conjugated systems. J Am Chem Soc 99:1692–1704
81. Gutman I, Trinajstić N (1976) Graph theory and molecular orbitals, XIV. On topological
definition of resonance energy. Acta Chim Acad Sci Hung 91:203–209
82. Harary F (1962) The determinant of the adjacency matrix of a graph. SIAM Rev 4:202–210
83. Heilmann OJ, Lieb EH (1970) Monomers and dimers. Phys Rev Lett 24:1412–1414
84. Heilmann OJ, Lieb EH (1972) Theory of monomer-dimer systems. Commun Math Phys
25:190–232
85. Horn RA, Johnson CR (1990) Matrix analysis. Cambridge University Press, Cambridge
86. Hosaya H (1971) Topological Index. A newly proposed quantity characterizing the topologi-
cal nature of structural isomers of saturated hydrocarbons. Bull Chem Soc Jpn 44:2332–2339
87. Jackson B (1991) Supplementary Eulerian vectors in isotropic systems. J Combin Theory B
53:93–105
88. Jaeger F (1988) Tutte polynomials and link polynomials. Proc Am Math Soc 103(2):647–654
89. Jaeger F (1990) On Transition polynomials of 4-regular graphs, cycles and rays. NATO Adv
Sci Inst Ser C: Math Phys Sci 301. Kluwer, Dordrecht
90. Kantor JM, Khovanskii A (1993) Une application du Théorème de Riemann-Roch com-
binatoire au polynôme d’Ehrhart des polytopes entier de Rd . C R Acad Sci Paris Ser I
317:501–507
91. Kauffman LH (1989) A Tutte polynomial for signed graphs. Discrete Appl Math 25:105–127
92. Kelly PJ (1957) A congruence theorem for trees. Pac J Math 7:961–968
93. Kel’mans AK (1965) The number of trees in a graph. I. Automat i Telemeh 26:2194–2204
(1965) (in Russian); transl. Autom Rem Contr 26:2118–2129
94. Kocay WL (1981) An extension of Kelly’s lemma to spanning subgraphs. Congr Numer
31:109–120
95. Kunz H (1970) Location of the zeros of the partition function for some classical lattice sys-
tems. Phys Lett A 32:311–312
96. Las Vergnas M (1979) On Eulerian partitions of graphs. In: Wilson RJ (ed) Graph theory and
combinatorics. Pitman, Boston London
97. Las Vergnas M (1981) Eulerian circuits of 4-valent graphs imbedded in surfaces. Algebric
methods in graph theory, Vol. I, II (S-zeged, 1978), pp 451–477, Colloq math soc Jnos Bolyai,
25, North-Holland, Amsterdam, New York
98. Las Vergnas M (1983) Le polynôme de Martin d’un graphe eulérien. In: Berge C,
Bresson D, Camion P, Maurras J-F, Sterboul F (eds) Combinatorial mathematics. North-
Holland, Amsterdam
99. Las Vergnas M (1988) On the evaluation at (3,3) of the Tutte polynomial of a graph. J Combin
Theory B 44:367–372
100. Levit VE, Mandrescu E (2005) The independence polynomial of a graph – a survey. In:
Bozapalidis S, Kalampakas A, Rahonis G (eds) Proceedings of the 1st international con-
ference on algebraic informatics. Aristotle University of Thessaloniki, Thessaloniki
101. Lovász L, Plummer MD (1986) Matching theory. Ann Discrete Math 29, Amsterdam
102. Macdonald IG (1971) Polynomials associated with finite cell complexes. J Lond Math Soc
4:181–192
103. Martin P (1977) Enumérations eulériennes dans le multigraphs et invariants de Tutte–
Grothendieck. Thesis, Grenoble
104. Martin P (1978) Remarkable valuation of the dichromatic polynomial of planar multigraphs.
105. McMullen P (1971) On zonotopes. Trans Am Math Soc 159:91–109
106. Merino C, Noble SD (2009) The equivalence of two graph polynomials and a symmetric
function. Combinator Probab Comput 18:601–615
107. Moffatt I (2010) Unsigned state models for the Jones polynomial. Ann Combinator (to
appear).
108. Moffatt I (2008) Knot invariants and the Bollobás-Riordan Polynomial of embedded graphs.
Eur J Combinator 29:95–107
109. Noble SD, Welsh DJA (1999) A weighted graph polynomial from chromatic invariants of
knots. Annales de l’institute Fourier 49:1057–1087
110. Noy M (2003) Graphs determined by polynomial invariants. Theor Comput Sci 307:365–384
111. Pathasarthy KR (1989) Graph polynomials. In: Kulli VR (ed) Recent studies in graph theory.
Vishwa International Publications, Gulbarga
112. Penrose R (1971) Applications of negative dimensional tensors. In: Welsh DJA (ed) Combina-
torial mathematics and its applications: Proceedings of a conference held at the mathematical
institute, Oxford, 1969. Academic, London/New York
113. Peterson J (1891) Die theorie der regularen graphs. Acta Math 15:193–220
114. Pevzner PA (1989) l-tuple DNA sequencing: computer analysis. J Biomol Struct Dynam
7:63–73
115. Poincaré H (1901) Second complément à l’analysis situs. Proc Lond Math Soc 65:23–45
116. Pommersheim J (1993) Toric varieties, lattice points, and Dedekind sums. Ann Math 295:
1–24
117. Riordan J (1958) An introduction to combinatorial analysis. Wiley, New York
118. Royle G, Sokal A (2004) The Brown–Colbourn conjecture on zeros of reliability polynomials
is false. J Combin Theory B 91:345–360
119. Sarmiento I (2000) The polychromate and a chord diagram polynomial. Ann Combinator
4:227–236
120. Sarmiento I (2001) Hopf algebras and the Penrose polynomial. Eur J Combinator 22:
1149–1158
121. Shephard GC (1974) Combinatorial properties of associated zonotopes. Can J Math 26:
302–321
122. Sokal AD (2000) Chromatic polynomials, Potts models and all that. Physica A 279:324–332
123. Sokal AD (2001) A personal list of unsolved problems concerning lattice gases and antifer-
romagnetic Potts models. Markov Process Relat Fields 7:21–38
124. Sokal AD (2001) Bounds on the complex zeros of (di)chromatic polynomials and Potts-model
partition functions. Combinator Probab Comput 10:41–77
125. Stanley RP (1980) Decompositions of rational convex polytopes. Ann Discrete Math
6:333–342
126. Stanley RP (1995) A symmetric function generalization of the chromatic polynomial of a
graph. Adv Math 111:166–194
127. Stanley RP (1996) Enumerative combinatorics, vol 1. Cambridge University Press,
Cambridge
128. Stanley RP (1998) Graph colourings and related symmetric functions: ideas and applications.
A description of results, interesting applications, and notable open problems. Discrete Math
193:267–286
129. Sylvester JJ (1878) On an application of the new atomic theory to the graphical representa-
tion of the invariants and covariants of binary quantics, with three appendices. Am J Math
1:64–125
130. Thistlethwaite MB (1987) A spanning tree expansion of the Jones polynomial. Topology
26:297–309
131. Traldi L (2010) Weighted interlace polynomials. Combinator Probab Comput 19:133–157
132. Tutte WT (1967) On dichromatic polynomials. J Combin Theory 2:301–320
133. Tutte WT (1979) All the kings horses. In: Bondy JA, Murty USR (eds) Graph theory and
related topics. Academic, London
134. Tutte WT (1984) Graph theory. Addison-Wesley, New York
135. Ulam S (1960) A collection of mathematical problems. Wiley, New York
136. Waterman MS (1995) Introduction to computational biology: maps, sequences and genomes.
Chapman & Hall, New York
137. Welsh DJA (1993) Complexity: knots, colorings and counting. Cambridge University Press,
Cambridge
138. Welsh DJA (1997) Approximate counting. In: Bailey R (ed) Surveys in Combinatorics, 1997.
Cambridge University Press, Cambridge
139. Welsh DJA (1999) The Tutte polynomial. Statistical physics methods in discrete probability,
combinatorics, and theoretical computer science. Random Struct Algorithm 15:210–228
140. Welsh DJA, Merino C (2000) The Potts model and the Tutte polynomial. J Math Phys
41:1127–1152
141. Yetter DN (1990) On graph invariants given by linear recurrence relations. J Combin Theory
B 48:6–18
142. Zaslavsky T (1992) Strong Tutte functions of matroids and graphs. Trans Am Math Soc
334:317–347
Chapter 11
Reconstruction Problems for Graphs,
Krawtchouk Polynomials, and Diophantine
Equations
Thomas Stoll
Abstract We give an overview about some reconstruction problems in graph

theory, which are intimately related to integer roots of Krawtchouk polynomials.
In this context, Tichy and the author recently showed that a binary Diophantine
equation for Krawtchouk polynomials only has finitely many integral solution. Here,
this result is extended. By using a method of Krasikov, we decide the general
finiteness problem for binary Krawtchouk polynomials within certain ranges of the
parameters.
Keywords Krawtchouk polynomials Graph reconstruction Diophantine

equations Discrete orthogonal polynomials Laguerre inequality
MSC2000: Primary 11D45; Secondary 33C05, 33C45, 39B72
11.1 Introduction
11.1.1 The Reconstruction Conjecture
A famous conjecture in graph theory states that graphs are determined (up to
isomorphism) by their subgraphs. This conjecture is known as the (Kelly-Ulam-)
Reconstruction Conjecture and the literature on solving the conjecture for special
graphs is vast (see [2] for a survey). Also, negative results are known, for exam-
ple, digraphs and hypergraphs are in general not reconstructible. On the other hand,
there is much freedom in formulating reconstructions problems, namely, one may
remove edges, vertices, or specific sets of vertices for the subgraphs under question.
The aim of the present chapter is to give a short overview on how these reconstruc-
tion problems relate to the investigation of integral zeroes of so-called Krawtchouk
T. Stoll ()
Faculty of Mathematics, School of Computer Science,
University of Waterloo, Waterloo, ON, Canada

294 T. Stoll
polynomials as well as to report on known results on this connection. Indeed, recon-

struction can be put in terms of a one-variable Diophantine problem for Krawtchouk
polynomials. It is a great challenge to study this Diophantine problem in the most
general setting, hereby making a substantial attempt to unify several of the dispersed
results in the area of graph reconstruction.
11.1.2 Reconstruction Problems and Zeroes of Krawtchouk

Polynomials
Given a finite, simple graph G with jV .G/j D n 3. For U V .G/, the switching
GU of G at U is the graph obtained from G by replacing all edges between U and
V .G/nU by the nonedges. The multiset of unlabeled graphs Ds .G/ D fGU W jU j D
sg is called the s-switching deck of G. The vertex-switching reconstruction problem
asks whether G is uniquely defined up to isomorphism by Ds .G/. Stanley [17]
pointed out that the vertex-switching reconstruction problem has a negative answer
in general, as illustrated by the following simple example. Let G be the totally dis-
connected graph 4K1 on four vertices, respectively, the cycle of length four, C4 .
Then, in both cases, D1 .G/ consists of the star K1;3 only (see Fig. 11.1, where we
switched at the left-upper vertex of the graph).
On the other hand, it is natural to ask which conditions have to be imposed on the
underlying graphs in order to solve the reconstruction problem. Many special graphs
have been investigated and several bounds on the degree of reconstructible graphs
have been shown (cf. [4–7, 12, 13]). A major result in this area has been obtained by
Krasikov and Roditty [13, Remark 2]. They proved an analogue of Kelly’s lemma
to reconstruct the number of subgraphs in a graph. To state the result, some more
notation is needed. Given graphs G and H , let Xs .G ! H / denote the number
of sets U V .G/, jU j D s, such that GU is isomorphic to H . Furthermore, let
Ans denote the matrix with rows and columns indexed by the unlabeled graphs on n
vertices, with the .G; H / entry being Xs .G ! H /. Denote by
4K1 C4
D1(4K1)
∼
= D1(C4)
Fig. 11.1 Vertex-reconstruction for 4K1 and C4

11 Reconstruction Problems 295
k
! !
X x nx
Pkn .x/ D .1/j (11.1)
j kj
j D0
the binary Krawtchouk polynomial of degree k (for more details see Sect. 11.2).
Theorem 1 ([13]). The s-switching deck Ds .G/ of G determines the number
of induced subgraphs of G isomorphic to a given m-vertex graph provided no
eigenvalue of Am
1 is a root y of
!
X
min.m;s/
nm
Rsm .y/ D Pkn ..m y/=2/:
sk
kDmax.0;sCmn/
Ellingham [4] used an idea about m-cubes to simplify the result, thus directly
relating the reconstruction to the existence of integral roots of Krawtchouk polyno-
mials. Recall that G has n vertices.
Theorem 2 ([4]). The s-switching deck Ds .G/ of G determines the number of
induced subgraphs of G isomorphic to a given m-vertex graph provided Psn .x/
has no even root in Œ0; m.
Several other reconstruction problems relate to integer roots of Krawtchouk
polynomials [11]. Mention, for example, the reorientation reconstruction problem,
which refers to a reconstruction problem for directed graphs. We are given a directed
graph with E. / D m. For any A E denote by A the graph obtained by flip-
ping the orientation of all arcs in A. Similarly as before, define the s-reorientation
deck Ds . / D fA W jAj D sg. The reorientation reconstruction problem asks
whether is uniquely defined up to isomorphism by Ds . /. The following con-
nection holds [11]:
Theorem 3 ([10]). If Psm .x/ has no integer root then can be reconstructed.
A similar connection holds for the sign reconstruction problem.
11.1.3 Outline of Chapter
In the present chapter we study integral roots of Krawtchouk polynomials from a

Diophantine point of view and prove our main result (see Sect. 11.1.4). The chap-
ter is organized as follows. In Sect. 11.2 we recall several well-known facts on
Krawtchouk polynomials, which we use in the sequel. Section 11.3 is devoted to
a short account on Diophantine equations of the type f .x/ D g.y/, where f; g 2
QŒx. Most important, we present the algorithmic criterion for finiteness of solu-
tions of Bilu and Tichy [1]. In Sect. 11.4 we recall the discrete Laguerre inequality,
a striking result by Krasikov [9]. After presenting the connection of monotonic-
ity of stationary points and indecomposability of polynomials (Sect. 11.5), we use
296 T. Stoll
Krasikov’s result for the stationary points of Krawtchouk polynomials (Sect. 11.6)
to decompose these polynomials in Sect. 11.7. In the final section, Sect. 11.8, we
treat the remaining possibilities for decomposing the polynomials with the standard
pairs. The exposition ends with a short summary and perspectives for future work.
11.1.4 Main Result
Our main result is the following (for the exact notion we refer to Sect. 11.3).
Theorem 4. Let g.x/ 2 QŒx with deg g 3 and assume that n; k 2 ZC with
16 n 100; .n/ k .n/ C 10;
where
17 19
.n/ D max 7; n :
40 2
Suppose that the Diophantine equation
Pkn .x/ D g.y/ (11.2)
with Krawtchouk polynomials Pkn .x/ has infinitely many rational solutions .x; y/
with a bounded denominator. Then we are in one of the following cases.
(i) g.x/ D Pkn .g.x//
Q for some polynomial gQ 2 QŒx.
(ii) k D 2k 0 ; k 0 2 and g.x/ D .g.x//,
Q where gQ is a polynomial over Q, whose
square-free part has at most two zeroes, such that gQ takes infinitely many square
values in Z.
11.2 Krawtchouk Polynomials
11.2.1 Basic Facts

.p;n/
The Krawtchouk polynomials Pk .x/ resp. Pkn .x/ are often found while studying
combinatorial problems where some sort of involution on the underlying structure
takes place. This is well explained by the generating function,
1
X
1p x
Pk.p;n/ .x/zk D 1 z .1 C z/nx : (11.3)
p
kD0
According to the Askey-scheme [14] (see also [22, pp. 35/36]), the (general)
Krawtchouk polynomials Pk.p;n/ .x/ form a family of polynomials which are orthog-

onal with respect to the discrete measure defined by .i / D ni p i .1 p/ni ,
i D 0; : : : ; n with 0 < p < 1. The special case p D 1=2 yields the standard
binary Krawtchouk polynomials, which – for the sake of brevity – we denote by
Pkn .x/ D Pk.1=2;n/ .x/. From (11.1) it is easy to derive that
k
! !
X x nj
Pkn .x/ D .2/ j
; (11.4)
j kj
j D0
from which again the uppermost coefficients of
Pkn .x/ D ck x k C ck1 x k1 C ck2 x k2 C C c0
follow at once,
.2/k .2/k1 n .2/k2

ck D ; ck1 D ; ck2 D .3n2 3n C 2k 4/;
kŠ .k 1/Š 6.k 2/Š
(11.5)
.2/k3 n 2
ck3 D .n 3n C 2k 4/;
6.k 3/Š
.2/k2
ck4 D .20k 2 108k 60k n C 60k n2 C 150n
360.k 4/Š
90n3 C 15n4 75n2 C 112/;
.2/k2 n
ck5 D .20k 2 108k 60k n C 20k n2 C 150n
360.k 5/Š
C 5n2 C 112 C 3n4 30n3 /; etc.
We also recall the three-term recurrence relation

n
.k C 1/PkC1 .x/ D .n 2x/Pkn .x/ .n k C 1/Pk1
n
.x/; k 1; (11.6)
and the difference equation
.n x/Pkn .x C 1/ D .n 2k/Pkn .x/ xPkn .x 1/; k 0; (11.7)
which is especially important for the method presented in this chapter. Another use-
ful recurrence relation is [10, relation (7)],
.n k C 1/PknC1 .x/ D .3n 2k 2x C 1/Pkn .x/ 2.n x/Pkn1 .x/: (11.8)

298 T. Stoll
11.2.2 Zeroes and Upper Bounds
As for a detailed study of the zeroes of Pkn .x/ (such as interlacing properties,
bounds, etc.), we refer to [10, 11]. Here we briefly recall some well-known facts,
which are crucial for our discussion. One easily notes that
( n=2
.1/k=2 ; n even;
Pkn .n=2/ D k=2 (11.9)
0; n odd.
The Krawtchouk polynomial Pkn .x/ has k simple roots
0 < r1;n .k/ < r2;n .k/ < < rk;n .k/ < n: (11.10)
Since
Pkn .x/ D .1/k Pkn .n x/; (11.11)
they lie symmetric around the point x D n=2. Moreover, for k < n=2 the distance
between consecutive zeroes decreases towards n=2. Also, recall that for 1 k <
n=2 we have
ri C1;n .k/ ri;n.k/ > 2; (11.12)
and for k < n we have ri C1;n .k/ ri;n.k/ > 1. Levenshtein [15] proved the fol-
lowing explicit formula for the smallest root,
k2
!
X p
r1;n .k/ D n=2 max xi xi C1 .i C 1/.n i / ; (11.13)
i D0
Pk1
where the maximum is taken over all .x1 ; : : : ; xn / with i D0 xi2 D 1. It is not
difficult to see that
r1;n .k/ > 1: (11.14)
It is well known that the zeroes of Krawtchouk polynomials for small k can be
approximated by the corresponding roots of the Hermite polynomials. If .n k/ !
1 then the zeroes of Pkn .x/ indeed approach
p
n nk1
C hi .x/; (11.15)
2 2
where h1 .k/ < < hk .k/ are the roots of the Hermite polynomial Hk .x/. Finally,
we also mention a result due to Krasikov [8] which gives a bound of Pkn .x/ at integer
p
values provided k n=2. Let q D 2 k.n k/; then it holds that
xŠ.n x/Š
.Pkn .x//2 .n; k; x/; x D 0; 1; : : : ; bn=2c; (11.16)
b k2 cŠ2 b nk
2 cŠ
2
where .n; k; x/ is
q 2 C 2n 4
; n; k evenI ; n even; k oddI
4.n x/ nx
2k C 1 2n 2k C 1
; n odd; k evenI ; n; k odd:
nx nx
In the vicinity of n=2 there are better estimates available [8].
11.3 The Diophantine Equation Pkn .x/ D g.y/
11.3.1 Introduction
The integrality of zeroes of Krawtchouk polynomials relates to the study of the

solution set of the one-variable Diophantine equation
Pkn .x/ D 0 (11.17)
in rational integers x. Much interest has been focused on classifying the zeroes
for certain values of k and n (see [11]). For instance, the zeroes are completely
classified for k 7, for k D .n t/=2 with t 6 and t D 8 when the root is odd.
It is conjectured that for any choice of the pair .k; n/ the number of integral zeroes
does not exceed 4. On the other hand, there are also results of a typical Diophantine
nature. For example, for every k 4, the polynomial Pkn .x/ can have nontrivial
integer roots only for finitely many values n.
An interesting generalization is to allow an arbitrary rational polynomial g.y/ on
the right-hand side of (11.17),
Pkn .x/ D g.y/; (11.18)
which makes up the hub of the present chapter. How many integral solutions .x; y/
does (11.18) have? Is it possible to find an infinite set of solutions which can be
constructed via a suitable integer-valued parametrization?
The study of Diophantine equations of the shape f .x/ D g.y/ has a long history.
In order to settle the problem of finiteness of integral solutions .x; y/ for a specific
equation (i.e., without parameters involved), one can resort to Siegel’s theorem on
integral points on algebraic curves [16]. The procedure is as follows: First, one
computes the genus of the algebraic curve under question, and in the case of zero
genus one calculates the number of points at infinity to conclude. If the polynomials
f and g themselves depend on several parameters (e.g., on k and n in (11.18)), such
a direct calculation is not possible. In 2000, Bilu and Tichy [1], while extending
300 T. Stoll
work of Davenport, Ehrenfeucht, Fried, Lewis, MacRae, Ritt, Schinzel, Siegel, and
others, proved an algorithmic criterion which makes it possible to apply Siegel’s
theorem also in the multiparametric case.
11.3.2 The Criterion of Bilu and Tichy
In order to formulate the criterion we need the definition of the five so-called stan-
dard pairs (over Q). In what follows, let ; ı 2 Q n f0g, q; s; t 2 Z>0 , r 2 Z0 and
v.x/ 2 QŒx a nonzero polynomial (which may be constant). We also make use of
the Dickson polynomials which can be defined by
bs=2c
!
X s si
Ds .x; / D ds;i x s2i with ds;i D . /i : (11.19)
si i
i D0
We say that the equation f .x/ D g.y/ has infinitely many rational solutions with
a bounded denominator, if there is 2 ZC such that f .x/ D g.y/ has infinitely
many rational solutions .x; y/ with x; y 2 Z. If an equation has only finitely
many rational solutions with a bounded denominator then, in particular, it has only
finitely many solutions in integers.
The list of standard pairs (over Q), which is referred to in Theorem 5, includes
five different pairs of polynomials .f1 ; g1 /.
A standard pair of the first kind is of the type
.x q ; x r v.x/q / (11.20)
(or switched), where 0 r < q, gcd.r; q/ D 1, and r C deg v > 0.

A standard pair of the second kind is given by
.x 2 ; .x 2 C ı/v.x/2 / (11.21)
(or switched).
A standard pair of the third kind is
.Ds .x; t /; Dt .x; s // (11.22)
with s; t 1 and gcd.s; t/ D 1.

A standard pair of the fourth kind is
. s=2 Ds .x; /; ı t =2 Dt .x; ı// (11.23)
(or switched) with s; t 1 and gcd.s; t/ D 2:

A standard pair of the fifth kind is of the form
..x 2 1/3 ; 3x 4 4x 3 / (11.24)
(or switched).
We are now ready to state the criterion of Bilu and Tichy [1].
Theorem 5 ([1]). Let f .x/; g.x/ 2 QŒx be nonconstant polynomials. Then the
following two assertions are equivalent.
(i) The equation f .x/ D g.y/ has infinitely many rational solutions with a
bounded denominator.
(ii) We can express f ı
1 D ı f1 and g ı
2 D ı g1 where
1 ;
2 2 QŒx are
linear, .x/ 2 QŒx, and .f1 ; g1 / is a standard pair over Q.
Observe that if we were able to get a contradiction for decompositions of f and g
as demanded in (i) of Theorem 5, then finiteness of the number of integral solutions
.x; y/ of the original Diophantine equation f .x/ D g.y/ is guaranteed.
The proof of Theorem 5 relies on the celebrated ineffective theorem of
Siegel [16] from 1929 on the finiteness of the number of integer solutions of
the equation F .x; y/ D 0, where F .x; y/ is absolutely irreducible. In fact, this
number is finite except when the projective completion of the curve has genus 0
and at most 2 points at infinity. Thus, in principle, one splits f .x/ g.y/ into
irreducible factors in QŒx; y, and for each factor that is irreducible over Q N one
determines the genus and the number of points of infinity. A number of people have
studied the irreducibility of f .x/ g.y/, for instance, Ehrenfeucht, Fried, Lewis,
MacRae, Runge, and Schinzel. The main contribution of Bilu and Tichy was to drop
a condition on the gcd of f and g, so as to obtain the full general result.
Tichy and Stoll [21] used the special form of the leading coefficient ck in (11.5)
and Theorem 5 to prove
Theorem 6 ([21]). Let n and m be distinct integers satisfying m; n 3. Further,

let N max.m; n/ and p1 ; p2 2 Q n f0; 1g. Then the equation
! !
N .p1 ;N / N
P .x/ D Pm.p2 ;N / .y/ (11.25)
m n n
has only finitely many solutions in integers .x; y/.
Despite the generality of Theorem 6, which addresses general Krawtchouk poly-

.p;n/
nomials Pk .x/ (recall (11.3)), it is not possible to extend the proof to remove the
binomial coefficient factors in (11.25). The aim of the present chapter is to outline
a method which uses an ingenious tool from the geometry of polynomials to get a
finiteness result of the same shape for (11.18).
302 T. Stoll
11.4 The Discrete Laguerre Inequality
11.4.1 Introduction and Statement
In order to apply Theorem 5 in the most general form for the binary Krawtchouk
polynomials one has to prove a general decomposition theorem for Pkn .x/ and
to exclude possible decompositions involving the standard pairs. Although this
is rather straightforward for the classical continuous orthogonal polynomials
(Laguerre, Hermite, Jacobi) [20], it has not even been proved for a single family
of discrete classical orthogonal polynomials (Krawtchouk, Meixner, Meixner-
Pollaczek, Hahn, Wilson, Charlier, etc.). At least, due to the similarity to Hermite
polynomials (11.15), one may strongly expect an analogous result for Krawtchouk
polynomials. We use here a method due to Krasikov [9] to get a first result in this
direction. We do not aim to optimize our argument; indeed, in the end, we use
concrete numerical data in place of the general parameters k and n. However, with
more technical effort it is possible to enlarge the parameter sets in our main theorem
and to get a statement for polynomials Pkn .x/ with k D k.n/ as well.
The classical Laguerre inequality states that for any polynomial f 2 RŒx with
only real zeroes there holds f 02 ff 00 0. A higher-degree generalization has
been obtained by Jensen and used by Patrick (see [9] for the references), namely,
m
X f .mj / .x/f .mCj / .x/
Lm .f / D .1/mCj 0: (11.26)
.m j /Š.m C j /Š
j Dm
In 2003, Krasikov [9] showed a surprising difference analogue of (11.26). Let x1 <
x2 < < xn be the zeroes of f .x/ and denote by M.f / the mesh defined by
M.f / D min2i n .xi xi 1 /.
q
6
Theorem 7 ([9]). Let M.f / 4 mC2 , then
m
X f .x j /f .x C j /
Vm .f / D .1/j 0: (11.27)
.m j /Š.m C j /Š
j Dm
The proof of Theorem 7 is elementary. The crucial step is to show that Vm .f /

satisfies some recursion relation and is a quadratic polynomial in x with nonpositive
discriminant provided f satisfies the mesh condition given in the statement.
Relation (11.27) can be used to get explicit inequalities on the size of polynomi-
als, respectively, to bound the extreme zeroes.
11.4.2 Krasikov’s Application to Krawtchouk Polynomials
A nice application to Krawtchouk polynomials has been outlined in [9]. Therein,

Theorem 7 is used with m D 2 to get very sharp envelopes for Pkn .x/ with k < n=2.
As we need these numerical data in our investigations, we recall the method and the
calculations from [9] (we also fix a misprint in (11.29)).
By the difference relation (11.7) it is possible to write V2 .Pkn / only in terms of
Pk .x/ and Pkn .x 1/. Moreover, by (11.12) the mesh condition of Theorem 7 is
n
satisfied. This gives
A.x/t 2 C B.x/t C C.x/

V2 .Pkn / D .P n .x//2 0; (11.28)
12.n x/.n x 1/.x 1/ k
where t D t.x/ D Pkn .x 1/=Pkn .x/ and
A.x/ D x.4x 2 4nx C 4n C m2 4/;

B.x/ D m.4x 2 4nx C 2x C 3n C m2 4/;
C.x/ D 4x 3 8nx 2 C .4n2 C 2n C m2 4/x 2n2 m2 n C 4n m2 ;
with m D n 2k. Note that by (11.10) and (11.14) the denominator in (11.28)
is positive. Having at hand (11.28), it is possible to derive bounds on Pkn .x/ and
Pkn .x 1/ inside the oscillatory region. This is obtained by looking at the ellipse
described by V2 . Define
V2 .Pkn .x C 1// zV2 .Pkn .x//

W .x/ D
.Pkn .x//2
x˛.x/t 2 mˇ.x/t .n x 2/.x/
D ; (11.29)
12.n x/2 .n x 2/.n x 1/.x 1/
where
˛.x/ D .n x 2/.n x/.4x 2 4x n C m2 C 4n 4/z

C .x 1/.4x 3 C .12 8n/x 2 C .4n2 14n C m2 C 8/x
n.m2 2n C 2//;
ˇ.x/ D .n x 2/.n x/.m2 C 3n 4x n C 2x C 4x 2 4/z
C .x 1/.4x 3 C .14 8n/x 2 C .m2 17n C 4n2 C 14/x
n.m2 C 2 3n//;
.x/ D .n x/.4x 3 8x 2 n C .m2 C 4n2 C 2n 4/x C 4n
nm2 m2 2n2 /z .x 1/.4x 3 C .4 8n/x 2
C .m2 8n C 4n2 /x C n2 12k 2 nm2 C 12nk/:
Note that the discriminant m2 ˇ.x/2 C 4x.n x 2/˛.x/.x/ can be interpreted

as a quadratic polynomial in z. We choose z from setting the discriminant equal to
zero, in which case the signs of W .x/ and ˛.x/ coincide. This yields,
304 T. Stoll
p
.x 1/.4.x C 12 / 3S ˙ 6 R/
z1;2 .x/ D ;
.n x 2/4.x/
where (with the abbreviation y D n 2x),
4.x/ D .y 2 .n 1/2 C m2 1/3 2.y 2 C m2 1/2 C m2 y 2

C 2.n 1/2 .n2 2n C 5/;
S D y.y 2/.y 1/2 .n2 2n m2 C 2/2 C 7.n 1/2 ;
R D .n2 y 2 2n C 2y/.n2 m2 /..n 2/2 m2 /..n 1/2
m2 .y 1/2 /:
Recall that 4.x/ < 0 in the oscillatory region [8], provided that
n p
2k< 2 33=4 n: (11.30)
2
Within this range we therefore have
V2 .Pkn .x C 1//
z1 .x/ z2 .x/: (11.31)
V2 .Pkn .x//
As Krasikov points out, one can use V2 .Pkn .n=2// as an initial value in (11.31) to
obtain upper bounds for Pkn .n=2 C i /, i 1, consecutively. For our purpose, we
need explicit upper and lower bounds for the maximum of Pkn .x/ between con-
secutive zeroes, i.e., for real x in the interval Œxi 1 ; xi . This is motivated by the
connection of monotonicity of stationary points to decomposability of polynomials,
which is the subject of the next section.
11.5 Monotonicity of Stationary Points and Indecomposability
11.5.1 Definitions
Polynomial decomposition theory is aimed at a characterization of all repre-

sentations of a given polynomial f D ı h 2 RŒx, where ; h 2 RŒx,
min.deg ; deg h/ 2 and “ı” denotes the functional composition applied for
polynomials.1 The left term is called the left and the right term h the right compo-
nent of the decomposition. Two decompositions f D 1 ı h1 D 2 ı h2 are called
1
More precisely, such a decomposition is called a nontrivial decomposition.
equivalent (and thus regarded as basically the same), if there is a linear polynomial
such that 2 D 1 ı
and h2 D
1 ı h1 . A polynomial f is called decomposable
(over R) if it has at least one nontrivial decomposition with real components.
11.5.2 Decomposition and Orthogonal Polynomials
Orthogonal polynomials – besides having simple real zeroes – have simple sta-
tionary points. A main theme, for instance in approximation theory, is to prove a
monotonicity result for the extremal points of the polynomials under question.
Denote by
ı.f I / D deg gcd.f ; f 0 /; 2 R;
which counts the number of stationary points of f .x/ with equal ordinate value. An
important connection to polynomial decomposition theory is given by the following
fact [3].
Lemma 1 ([3]). Let f D ı h, where ; h 2 RŒx. If deg 2, then there

exists 2 R with ı.f I / deg h: In particular, if ı.f I / s for all 2 R then
deg h s.
According to Lemma 1 we have deg h s 2 Z>0 provided that there are at

most s intervals for which the stationary points of f .x/ are monotone increas-
ing/decreasing on the respective intervals. In that context we recall a result due to
Tichy and the author [20].
Theorem 8 ([20]). Let f .x/ 2 RŒx with only real zeroes satisfy
.x/f 00 .x/ C .x/f 0 .x/ .x/f .x/ D 0; (11.32)
with .x/ D ax 2 C bx C c, .x/ D dx C e and a; b; c; d; e 2 R, ad ¤ 0. Further-

more, suppose that 0 .x/ 2.x/ does not vanish identically. Then ı.f I / 2 for
all 2 R.
The general continuous classical orthogonal polynomials (Laguerre, Jacobi,

Hermite) satisfy (11.32), whereas the Chebyshev polynomials exactly make up the
exceptional case of Theorem 8.2 However, for Krawtchouk polynomials there is no
differential equation of Sturm–Liouville type available, such that one has to use
another method.
2
In fact, it is well known that the standard (nonmonic) Chebyshev polynomials of the first kind
Tk .x/ have all stationary points of equal ordinate value. Moreover, they are decomposable for any
nonprime k by the relation Tm .Tn .x// D Tn .Tm .x// D Tmn .x/.
306 T. Stoll
11.6 Stationary Points of Krawtchouk Polynomials
11.6.1 Iteration of Krasikov’s Bound
The present section is devoted to a detailed study of relation (11.31) which delivers
the needed information to bound ı.Pkn I / for all 2 R. To start with, iterat-
ing (11.31) yields
n
n bxc 1
n o n Y2 n no n
1 .x/ WD V2 Pkn x C z1 x C Ci (11.33)
2 2 2 2
i D0
V2 .Pkn .x//
n
n bxc 1
n o n Y2 n no n
V2 Pkn x C z2 x C C i DW 2 .x/:
2 2 2 2
i D0
Herein, fxg D x bxc denotes the fractional part of x. It may be possible to re-
lax (11.33) in order to improve on our results, but only at the cost of extensive
computational work. In fact, although z1 , z2 are monotone increasing functions in
the oscillatory region, this behaviour changes near the extreme zeroes and one has
to use more tricky arguments (see [7]). Moreover, it is a rather (computationally)
complex task to prove that V2 .Pkn .x// takes its minimal, resp. maximal, value on
Œn=2; n=2C1 at the left, resp. right, point of the interval (one may use (11.8), (11.9),
and (11.28)).
Now, consider (11.28) and the ellipse with
A.x/t 2 C B.x/t C C.x/ D const. (11.34)
The upper bound for maxxi <x<xi C1 Pkn .x/ follows by calculating the major axis
of (11.34). This gives (we omit the details)
A.x/ C C.x/ 1 p
.x/ D A.x/2 2A.x/C.x/ C C.x/2 C B.x/2
2 2
and s
2 .x/
Pkn .x/ DW u.x/; n=2 x xn : (11.35)
.x/
On the other hand, considering the minor axis yields that for all i D 1; : : : ; n there
exists x 2 Œxi 1 ; xi such that
s
1 .x/
Pkn .x/ WD l.x/: (11.36)
C.x/
1e+21
1e+20
1e+19
1e+18
1e+17
1e+16
1e+15
1e+14
1e+13
1e+12
1e+11
1e+10
1e+09
50 60 70 80 90 100
x
Fig. 11.2 jP21

100
.x/j on a logarithmic scale
We illustrate these two bounds in Fig. 11.2 for the case n D 100, k D 21.
Obviously, comparing the upper and lower bound it is possible to get a bound for
the number of stationary points of equal ordinate value.
11.6.2 Admissible Parameter Ranges
We use a very rough criterion to conclude, namely (motivated by (11.12)), if
minf1 j n=2 W l.n=2 C 2j / > u.n=2 C j /g D s (11.37)
then ı.Pkn I / 2s. For every n 100 we have calculated the values for k subject
to (11.30) which satisfy (11.37) with s 3. The data are illustrated in Fig. 11.3.3
From the plot we see that the bounds are most helpful in the vicinity of the bound
in (11.30), which is the upper envelope of the represented points.
According to Lemma 1, for the values .n; k/ given in Fig. 11.3 (which we call
admissible in the sequel) we have that Pnk .x/ D .h.x// with ; h 2 RŒx im-
plies deg h 6. In the next section we deal with these possible decompositions
by a recent method proposed by the author [19]. Observe that the set referred to in
Theorem 4, i.e.,
3
One may considerably improve these estimates for k odd, however, we aim for a more uniform
result.
308 T. Stoll
40
35
30
25
k
20
15
10
20 40 60 80 100
n
Fig. 11.3 Values of .n; k/ with Pnk .x/ having at most six stationary points of equal value
16 n 100; .n/ k .n/ C 10;
with
17 19
.n/ D max 7; n ;
40 2
is a subset of the admissible pairs .n; k/.
11.7 Decomposition of Krawtchouk Polynomials
11.7.1 An Indecomposability Criterion
Given a polynomial f .x/ 2 RŒx, suppose that there is a decomposition of the form
f Dıh (11.38)
with deg h D s being a small number (in our case 6). One way to disprove
that there cannot exist such a decomposition consists in comparing coefficients on
both sides of the decomposition equation (11.38). Since the uppermost coefficients
of f (cf. 11.5) are given, one may try to come to a contradiction while equating
with the parametric coefficients on the right-hand side of (11.38). An algorithmic,
well-organized way of performing this task has recently been given by the author
[18, 19]. We recall the main ingredients. First, a polynomial hO of degree s is
computed which is the only (normed) candidate of degree s which could make up a
right decomposition factor for f (see [19, Algorithm 1]). Using hO we have at hand
a convenient algorithmic criterion for impossibility of polynomial decomposition.
Lemma 2 (Stoll [18]). Let f be monic and s 2 a positive integer. Furthermore,

let
O k C ˇ1 h.x/
f .x/ D h.x/ O k1 C C ˇl h.x/
O kl C R.x/; (11.39)
for some constants ˇj 2 R, 0 l k with deg R sk s and m − deg R. Then f
is indecomposable with right components of degree s.
From a practical point of view, Lemma 2 fits the problem best, when the degree
of hO is small. In fact, given f .x/, one expands f .x/ regarding h.x/
O up to suffi-
ciently large order (indicated by l) such that the remainder polynomial R.x/ has
the wanted properties. Regarding the Krawtchouk polynomials with parameter con-
strictions given in Fig. 11.3, we have to come to a contradiction when considering
right decomposition factors with deg h 6. In the sequel, we give an outline of
these calculations. For more details on the computational aspects (addressing both
the Gröbner bases and the implementation issues) we refer the interested reader
to the article [19].
11.7.2 Application to Krawtchouk Polynomials
The main result which is proved in the remaining part of this section is the following.
Theorem 9. Suppose Pkn .x/ D .h.x// with .x/; h.x/ 2 RŒx and 2 deg h 6.
Then deg h D 2 and the decomposition is equivalent to
O 2 nx/
Pkn .x/ D .x (11.40)
O
for some unique polynomial .x/ 2 QŒx.
n
To start with the proof, let deg h D 2. By (11.11) we see that P2k .x/ D
n
P2k .n x/ from which easily follows that there are unique polynomials 1 .x/;
2 .x/ 2 QŒx with
n

P2k .x/ D 1 .x n=2/2 D 2 x 2 nx ;
which is (11.40).
The only possible candidate of degree 3 (we use the first algorithm given
in [19]) is

O 3 9 2 9 9 3 3 1
h.x/ D x 3 nx 2 C k k n k C n2 C n C x:
2 4 8 4 4 8 2
310 T. Stoll
Taylor expansion with respect to this polynomial (use the second algorithm of [19])
leads to
n
P3k O k 1 nk.18k 2 18k 9nk C 4 C 2n2 C 3n/ h.x/
.x/ D h.x/ O k1
16
9
k.3k 1/.k 1/.48k 2 56k 30k n C 16 C 20n C 5n2 / x 3k4
540
C O.x 3k5 /:
Lemma 2 implies that in the equation above we have Œx 3k4 D 0, giving
1 1p
nDk C 60k 2 C 108k 39:
2 6
The expression under the square root symbol is 0 if and only if
1 13
k < 2;
2 10
a contradiction. Thus, there cannot exist a decomposition of a Krawtchouk polyno-
mial Pkn .x/ with right component of degree three.
The calculations for deg h D 4 are much more involved. First suppose that k 3.
We start with the expansion
n
P4k O k C ˇ1 h.x/
.x/ D h.x/ O k1 C r1 x 4k6 C r2 x 4k7
O k2 C r3 x 4k9 C r4 x 4k10 C O.x 4k11 /;
C ˇ2 h.x/
which yields r1 D r2 D r3 D r4 D 0. The equations for r1 , r2 , r3 are basically the

same (see below), so that we need one further (independent) equation to conclude.
The four equations are
k.k 1/.2k 1/.4k 1/.63488k 3 C 102592k 2 C 46368k 2 n 52528k
51408k n 11340k n2 C 8192 C 13734n C 6615n2 C 945n3 / D 0;
nk.k 1/.4k 1/.2k 1/.2k 3/.63488k 3 C 102592k 2 C 46368k 2 n 52528k

51408k n 11340k n2 C 8192 C 13734n C 6615n2 C 945n3 / D 0;
n3 k.k 1/.k 2/.4k 1/.2k 1/.2k 3/.4k 7/.63488k 3 C 102592k 2

C 46368k 2 n 52528k 51408k n 11340k n2 C 8192 C 13734n
C 6615n2 C 945n3 / D 0;
k.k 1/.k 2/.4k 1/.2k 1/.2k 3/.380764160 C 3731295872k 855679440n

763247100n2 436104900n3 C 226600605n4 C 656537805n5
C 337265775n6 C 49116375n7 C 4552320960k n2 1791912540k n4
8016988320k 2 n3 C 6200551104k n 3051556200k n5 C 2789111160k n3
908730900k n6 49896000k n7 10817991360k 2 n2 C 671101200k 2 n6

C 12474000k 2 n7 16177793280k 2 n 9804833280k 4 n3 C 4726600560k 2 n4
C 612057600k 4 n5 C 12445614720k 3 n3 149688000k 3 n6 12401326080k 4 n2
5779583040k 3 n4 C 4749267600k 2 n5 C 16998812160k 3 n C 14100514560k 3 n2
2907273600k 3 n5 2681733120k 6 n2 C 2964234240k 5 n3 838041600k 5 n4
9931874304k 5 n 1421629440k 4 n C 3492910080k 4 n4 C 7937740800k 5 n2
C 8102150144k 6 3575644160k 7 C 24003993600k 3 18583019520k 4
C 402751488k 5 13733508864k 2 C 5293178880k 6 n/ D 0:
With the aid of the Gröbner-package in MAPLE we get the complete solution set
ffk D 1=4; n D 2g; fk D 1=4; n D 3g; fk D 1; n D 5g; fk D 1=4; n D 6g
fk D 1=2; n D 3g; fk D 1=4; n D ng; fk D 5=4; n D 2g; fk D 1=2; n D 4g;
fk D 1=2; n D ng; fk D 0; n D n; g; fk D 1=4; n D 2=3g; fk D 1; n D ng;
fk D 1=2; n D 2=3g; fk D 1; n D 2=3g; fk D 1=2; n D 8g; fk D 1; n D 6g;
fk D 1=4; n D 8g; fk D 1=2; n D 2g; fk D 1=2; n D 2g; fk D 1=2; n D 6g;
fk D 1=2; n D 3g; fk D 1=2; n D 6g; fk D 3=4; n D 2=3g; fk D 1; n D 8g;
fk D 1; n D 6g; fk D 13=36; n D 50=27g; fk D 1=2; n D 5g; fk D 1=2; n D 4g;
fk D 105057=2998036Z22 C 1848969=2998036Z2 C 1696531=2998036; n D 2g;
fk D 3=2; n D Z3 =3g; fk D 2; n D Z1 g; g:
Herein, Z1 ; Z2 ; Z3 , respectively, satisfy the equations
7Z13 119Z12 C 714Z1 1440 D 0;

105057Z23 C 316794Z22 759285Z2 C 193378 D 0;
Z33 33Z32 C 390Z3 1544 D 0:
No member in the solution set satisfies the integrality constraints for k and n. One
easily comes to a contradiction also for k D 2 by inspecting the single equation
r1 D 0.
Next, assume deg h D 5. We here get the expansion
n
P5k O k C ˇ1 h.x/
.x/ D h.x/ O k1 C r1 x 5k6 C r2 x 5k7 C r3 x 5k8 C O.x 5k9 /;
where
1
ˇ1 D nk.5000k 4 3750nk 3 C 15000k 3 C 4125n2 k 2 1500nk 2
2304
11000k 2 900n3 k 1800n2 k C 1950nk C 3000k
C 180n3 C 195n2 300n 272 C 72n4 / D 0:
312 T. Stoll
Obviously r1 D 0. The equation r2 D 0 does not yield any new information on the
parameters k and n with respect to the first equation. We therefore also need r3 D 0.
More explicitly,
nk.k 1/.5k 1/.5k 6/.740000k 4 C 409500k 3 n C 1254000k 3
535500k 2 n 75600k 2 n2 774800k 2 C 229320k n C 68040k n2
C 4725k n3 C 205440k 19520 32256n 15120n2 2079n3 / D 0;
k.5k 1/.k 1/.11101440 164212480k C 22925952n C 6119568n2
11716488n3 7169715n4 1047816n5 C 377751000k 3 n2 452655000k 4 n3
2641350000k 5 n 3186633600k 3 22680000k 4 n4 850672500k 4 n2
C 4046100000k 4 n 3086382000k 3 n C 77962500k 3 n4 C 604894500k 3 n3
C 1417500k 3 n5 373577400k 2 n3 C 1266640800k 2 n C 5907912000k 4
267948480k n 4309200k 2 n5 22427700k 2 n2 91868175k 2 n4
6278640000k 5 29378400k n2 C 4003020k n5 C 107764020k n3
C 43630650k n4 C 3478800000k 6 740000000k 7 C 631500000k 6 n
222000000k 6 n2 C 754950000k 5 n2 C 122850000k 5 n3 C 990888000k 2 / D 0:
This system of equations has no admissible solution.4

Finally, consider deg h D 6. We use the three coefficient equations Œx 6k7 D
6k8
Œx D Œx 6k9 D 0 to conclude that there is no admissible solution pair .n; k/.
For the sake of completeness, we append the three relevant equations,
k.k 1/.6k 1/.3k 1/.2k 1/.2598912k 4 4133376k 3 1626480k 3 n
C 2393664k 2 C381780k 2 n2 C 1980000k 2 n 39900k n3 317520k n2
585696k 781860k n C 49152 C 1575n4 C 97960n C 64575n2 C 17150n3 / D 0;
n.107773725352722432k 67223682337996800 75805048910774400k 2
8055435775759680k 4 C 30850177972149600k 3 C 1034250n3 k 2
C 80325n4 k 2 175659840nk 9 1495000800nk 7 6300n4 k C 799372800nk 8
4309200n3 k 7 C 41232240n2 k 8 C 1505800800nk 6 171732960n2 k 7
C 285064920n2 k 6 C 170100n4 k 6 567000n4 k 5 244981800n2 k 5
C 16216200n3 k 6 C 1411897888929696k 5 C 13511581833600k 7
696037950720k 8 C 19669174272k 9 168416458660800k 6 23291100n3 k 5
4
Again, we used MAPLE-V11 to perform the computations.
897154020nk 5 C 324647400nk 4 C 16294950n3 k 4 C 118297935n2 k 4
C 675675n4 k 4 5876500n3 k 3 32185440n2 k 3 352800n4 k 3
69737900k 3 n C 8123400k 2 n C 4563405k 2 n2 258300k n2 68600k n3

391840k n/ D 0;
k.k 1/.6k 1/.3k 1/.2k 1/.19660800 C 314930688k 45724800n
19203888n2 C 23587740n3 C 22753500n4 C 6592740n5 C 623700n6
1651985280k 5 n2 C 1648896480k 4 n2 C 1197302040k 4 n3 10152980640k 4 n
C 75592440k 4 n4 537604848k 3 n2 C 7281972720k 3 n 7900200k 3 n5
267899940k 3 n4 1584615780k 3 n3 C 311850k 2 n6 C 945784290k 2 n3
C 113532012k n2 C 568854176k n 147192045k n4 2831232624k 2 n
C 318468150k 2 n4 119138184k 2 n2 C 25467750k 2 n5 883575k n6
24759735k n5 253449185k n3 1802756736k 6 n 322043040k 5 n3
C 7092131904k 5 n C 514584576k 6 n2 C 6836900736k 3 13430568960k 4
9060470784k 6 C 15235057152k 5 2014594176k 2 C 2058338304k 7 / D 0:
Observe that in principle the first and second equations are sufficient to conclude.
However, the Gröbner calculations become much more efficient (and faster) if one
includes an additional polynomial equation.
11.8 Decompositions with Standard Pairs
11.8.1 Introduction
Regarding Theorem 5, we have to treat decompositions of Pkn .x/ involving the stan-
dard pairs given by (11.20)–(11.24). Recall that by Theorem 9 the only nontrivial
O 2 nx/ with k 2 2ZC ,
decomposition of Pkn .x/ is equivalent to Pkn .x/ D .x
provided we assume the parameter restrictions for n and k given in Theorem 4.5 To
begin with, suppose that the Diophantine equation
Pkn .x/ D g.y/
has infinitely many rational solutions .x; y/ with a bounded denominator. Then by
Theorem 5,
Pkn D ı f1 ı
1 and g D ı g1 ı
2 ;
5
Therein, we assume k 7. It is possible to consider the smaller values of k also, however, at the
cost of some more case distinctions.
314 T. Stoll
where
1 ;
2 are some linear polynomials, 2 QŒx, and .f1 ; g1 / is a standard pair
as given by the list in Sect. 11.3. By Theorem 9, we have one of the three cases:
(i) deg D k,
O 2 nx/,
(ii) deg D k 0 with k D 2k 0 and Pkn .x/ D .x
(iii) deg D 1.
11.8.2 Case deg D n
By comparison of degrees, it holds that Pkn D ı

for some linear polynomial
.x/ and thus

g D Pkn ı .
1 ı g1 ı
2 / D Pkn ı gQ
for some nonconstant polynomial gQ 2 QŒx. Obviously, there are infinitely many
solutions with a bounded denominator of Pkn .x/ D Pkn .g.y//.
Q This gives Case (i)
in Theorem 4.
O 2 nx/
11.8.3 Case deg D k with k D 2k0 and Pkn D .x
O
Let Pkn D ı f1 ı
1 and
be the unique linear polynomial such that ı
D .
Then Pk D . ı
/ ı .
ı f1 ı
1 / D O ı l1 and Theorem 9 yields l1 D x nx.
n 1 2
On the other hand,
g D ı g1 ı
2 D . ı
/ ı .
1 ı g1 ı
2 / D O ı l2 ;
where l2 D
1 ı g1 ı
2 . If the equation .x n=2/2 D l2 .y/ C n2 =4 has infinitely
many solutions with a bounded denominator, then by Siegel’s theorem l2 has at most
two zeroes of odd multiplicity. This yields Case (ii).
11.8.4 Case deg D 1
In this case .x/ D 1 x C 0 with 1 ; 0 2 Q. Since is a linear polynomial we

have to treat Pkn D ı f1 ı
1 and g D ı g1 ı
2 , where .f1 ; g1 / is a standard
pair with deg f1 D k. We now have to analyze all decompositions with the special
polynomials of the standard pairs.
First, recall the standard pair of the second kind .x 2 ; .x 2 C ı/v.x/2 / given
in (11.21). Since both k 3 and deg g 3, there cannot exist a decomposition in-
volving .f1 ; g1 / of the second kind. In the same manner we can exclude the standard
pair of the fifth kind (11.24).
Next we want to exclude decompositions with the Dickson polynomials, namely,

the standard pairs of the third (11.22) and fourth kind (11.23),
.f1 ; g1 / D .Ds .x; t /; Dt .x; s //:
Assume that Pkn ı

D ı Ds .x; t / with a linear polynomial
, or in other words,
Pkn .x/ D 1 Ds .˛x C ˇ; t / C 0 : (11.41)
In view of (11.19) here we have to cope with the six variables k, n, 1 , ˛, ˇ, and t .
It is again a straightforward (but involved) computation to come to a contradiction.
In fact, for k 6 we may write down six coefficient equations from (11.41) and
conclude. Here we omit the details.
Finally, consider the standard pair of the first kind given by (11.20), namely
.x q ; x r v.x/q /. The polynomial .Pkn .x//0 has zeroes of multiplicity one. Hence,
for k 7, there cannot be a representation with Pkn .˛x C ˇ/ D 1 x q C 0 . On the
other hand, suppose that
Pkn .x/ D O 1 .ˇ1 x C ˇ0 /r vO .x/q C 0 ; (11.42)
where O 1 D 1 , vO .x/ D v.ˇ1 x C ˇ0 / with ˇ0 ; ˇ1 2 Q and 0 r < q,

gcd.r; q/ D 1, r C deg vO > 0 as demanded in (11.20). Since q 3 by deg g 3, we
here again come to a contradiction by arguing in the same way as above.
This concludes the investigation with linear polynomials .x/ and finishes the
proof of Theorem 4.
In the present chapter we have outlined an analytic method to study the Diophantine
equation
Pkn .x/ D g.y/ (11.43)
in integral variables x; y, where Pkn .x/ denotes a binary Krawtchouk polynomial of
degree k 7 and g 2 QŒx is an arbitrary polynomial of degree 3. Within cer-
tain parameter ranges (informally speaking, k growing like n=2) we have shown
that the Diophantine equation (11.43) only has finitely many integral solutions
x; y (Theorem 4). This Diophantine equation is motivated by the close relation-
ship between integrality of zeroes of Krawtchouk polynomials and the resolution of
reconstruction problems in graphs (Sect. 11.3).
Our machinery ranges from a recent indecomposability criterion due to the author
(Lemma 2) to the discrete Laguerre inequality (Theorem 7) applied to Krawtchouk
polynomials, as obtained and outlined by Krasikov. The method used in this chapter
describes a new approach in the theory of polynomial decomposition, and well fits
316 T. Stoll
the decomposition of discrete orthogonal polynomials. Also, the longstanding ques-

tion, whether the stationary points of discrete orthogonal polynomials – or at least,
a special family like the Krawtchouk polynomials – are convex, could be treated by
this method. On the other hand, convexity results are well known for the continu-
ous orthogonal polynomial families (Laguerre, Hermite, Jacobi), but it would be a
major breakthrough to show such a result for the instance of a discrete family of
polynomials.
The present chapter makes this attempt for certain ranges of the degree k and the
parameter n 100 in (11.43). With more computational work it seems possible to
get a general parametric result, i.e., where the result holds uniformly for all n n0
and k 2 In , where In denotes a set of consecutive integers depending on n.
Acknowledgments The author is a recipient of an APART-fellowship of the Austrian Academy

of Sciences at the University of Waterloo, Canada. He also wishes to express his gratitude to
I. Krasikov for several helpful discussions.
References
1. Bilu Y, Tichy RF (2000) The Diophantine equation f .x/ D g.y/. Acta Arith 95:261–288
2. Bondy JA (1991) A graph reconstruction manual. In: Keedwell AD (ed) Surveys in com-
binatorics. LMS-Lecture Note Series, vol 166. Cambridge University Press, Cambridge,
pp 221–252
3. Dujella A, Tichy RF (2001) Diophantine equations for second-order recursive sequences of
polynomials. Q J Math 52:161–169
4. Ellingham MN (1996) Vertex-switching reconstruction and folded cubes. J Combin Theory B
66:361–364
5. Ellingham MN, Royle GF (1992) Vertex-switching reconstruction of subgraph numbers and
triangle-free graphs. J Combin Theory B 54:167–177
6. Krasikov I (1994) Applications of balance equations to vertex switching reconstruction.
J Graph Theory 18:217–225.
7. Krasikov I (1996) Degree conditions for vertex switching reconstruction. Discrete Math
160:273–278
8. Krasikov I (2001) Nonnegative quadratic forms and bounds on orthogonal polynomials.
J Approx Theory 111:31–49
9. Krasikov I (2003) Discrete analogues of the Laguerre inequality. Anal Appl (Singap)
1:189–197
10. Krasikov I, Litsyn S (1996) On integral zeros of Krawtchouk polynomials. J Combin Theory
A 74:71–99
11. Krasikov I, Litsyn S (2001) Survey of binary Krawtchouk polynomials, Codes and association
schemes. (Piscataway, NJ, 1999), DIMACS Ser Discrete Math Theor Comput Sci 56:199–211.
American Mathematical Society, Providence, RI
12. Krasikov I, Roditty Y (1992) Switching reconstruction and Diophantine equations. J Combin
Theory B 54:189–195
13. Krasikov I, Roditty Y (1994) More on vertex-switching reconstruction. J Combin Theory B
60:40–55
14. Koekoek R, Swarttouw RF (1998) The Askey-Scheme of Hypergeometric Orthogonal Polyno-
mials and its q-Analogue. Report 98-17, Delft, Netherlands
15. Levenshtein V (1995) Krawtchouk polynomials and universal bounds for codes and designs in
Hamming spaces. IEEE Trans Inf Theory 41:1303–1321
16. Siegel CL (1929) Über einige Anwendungen Diophantischer Approximationen. Abh Preuss
Akad Wiss Math Phys Kl 1:209–266
17. Stanley RP (1985) Reconstruction from vertex-switching. J Combin Theory B 38:132–138
18. Stoll T (2008) Complete decomposition of Dickson-type recursive polynomials and related
Diophantine equations. J Number Theory 128:1157–1181
19. Stoll T (2008) Decomposition of perturbed Chebyshev polynomials. J Comput Appl Math
214:356–370
20. Stoll T, Tichy RF (2003) Diophantine equations for continuous classical orthogonal poly-
nomials. Indagat Math 14:263–274
21. Stoll T, Tichy RF (2005) Diophantine equations involving general Meixner and Krawtchouk
polynomials. Quaest Math 28:105–115
22. Szegő G (1975) Orthogonal polynomials, vol. 23, 4th edn. American Mathematical Society
Colloquium Publications, Providence, RI
Chapter 12
Subgraphs as a Measure of Similarity
Josef Lauri
Abstract How similar can two graphs be? The ultimate positive answer to this
question is, of course, when the two graphs are isomorphic. However, how much
internal structure can two nonisomorphic graphs share? We show what the answer
can look like if the measure of similarity between the two graphs is taken to be the
number of isomorphic subgraphs which they share. We see how this notion is re-
lated to the internal symmetries of a graph and that therefore, for most graphs, their
internal structure forces them to be very dissimilar to other graphs. We also indicate
some attempts to find nonisomorphic graphs which are very similar in terms of the
common subgraphs which they share. We also point out some issues of computa-
tional complexity and some possible applications associated with this measure of
graph similarity.
Keywords Graph similarity Isomorphic subgraphs Graph reconstruction

Reconstruction numbers
12.1 Introduction
Defining the similarity, or distance, between mathematical objects in some class is

generally always an important undertaking, and this is no exception for graphs. Ide-
ally we would like to define the similarity between two graphs G, H as a parameter
which is easy to compute, achieves some maximum value if and only if G and H are
isomorphic, and in some sense captures how different G and H are when they are
not isomorphic. In a sense, all graphical parameters can be considered candidates
for such a similarity measure, but no measure which satisfies all these conditions
J. Lauri ()
Department of Mathematics, University of Malta, Tal-Qroqq, Malta

320 J. Lauri
is known. An easily computable parameter which determines when two graphs are
isomorphic would solve the Graph Isomorphism (GI) problem, one of graph the-
ory’s diseases [24]. Easily computable parameters such as the degree sequence and
the spectrum do not always distinguish between nonisomorphic graphs. But devising
measures which are efficiently computable although not always able to distinguish
between nonisomorphic graphs is still an important realm of investigation, espe-
cially in applications. A recent example of work in this field (sometimes called
inexact graph matching [8]) is [9], where the authors derive a hierarchy of similar-
ity measures related to the degree sequence parameter and which can be computed
efficiently. In this paper the authors give experimental results obtained by applying
their similarity measures to more than 400 directed graphs representing web-based
hypertext structures.
In this chapter we focus on measuring the similarity of two graphs in terms of
their subgraphs. Complexity considerations and practical use are only discussed
briefly in the last section. The first paper to study this way of measuring similarity or
distance between graphs was probably [25]. In this paper, motivated by a question
of Vizing, Zelinka defines the distance ı.G; H / between two graphs on n vertices
as the minimum k such that G and H are both induced subgraphs of a graph on
n C k vertices and he shows that ı is a metric on the set of graphs with n vertices.
He also proves the simple result that G and H are induced subgraphs of a graph on
at most n C k vertices if and only if they have a common induced subgraph on at
least nk vertices. We consider a similarity measure which takes into consideration
all induced subgraphs and which is also related to another well-known graph theory
disease.
In the following all graphs are simple and undirected. Let G be a graph and v,
e a vertex and an edge, respectively, of G. Then G v denotes the graph obtained
by deleting from G the vertex v and all the edges incident to v; this is called a
vertex-deleted subgraph of G. More generally, if X is a set of vertices of G then
G X denotes the graph obtained by deleting from G all vertices in X and all
edges incident to at least one vertex in X . The resulting graph G X is said to be
induced by the vertices V .G/ X .
Similarly, G e denotes the graph obtained by deleting the edge e; it is called
an edge-deleted subgraph of G. We are mostly concerned with vertex-deleted sub-
graphs, but we often indicate how the results and questions we present relate to the
edge-deletion case.
The measure of similarity between two graphs which we discuss is the number of
vertex-deleted subgraphs that they possess in common. We define the subgraph sim-
ilarity sim.G; H / between two graphs G and H with the same number of vertices
n as follows. Let D.G/, called the deck of G, be the list of vertex-deleted sub-
graphs of G, where isomorphic subgraphs appear with the appropriate multiplicity.
Similarly let D.H / be the deck of H . Then sim.G; H / is equal to the number of
vertex-deleted subgraphs in D.G/ which are also in D.H /, where a subgraph that
appears more than once in D.G/ is counted as many times as it appears in D.H /.
(Therefore Zelinka’s result quoted above for k D 1 states that G and H are both in
12 Subgraphs as a Measure of Similarity 321
Fig. 12.1 Graphs G, H with

sim.G; H / D 5 G
the deck of some graph if and only if sim.G; H / 1.) To make these definitions
clear note that the two graphs G and H in Fig. 12.1 have sim.G; H / D 5.
All of this is, of course, related to the reconstruction conjecture (RC) which can
now be stated as
Reconstruction Conjecture
If G and H are two graphs on n 3 vertices with sim.G; H / D n then G and H

are isomorphic.
Most results in graph reconstruction can now be stated in this fashion, for example,
if sim.G; H / D n then G and H have the same degree sequence, and the same
characteristic and chromatic polynomials [16, 17]; if sim.G; H / D n and G is in
one of these classes of graphs, then G ' H : regular, disconnected [17], trees [12]
and maximal planar [15]. (For a survey on the RC the reader is referred to [16].)
But the new insight which this point of view brings is that now, new and perhaps
more amenable structural questions about graphs arise. Basically, even if we assume
that the RC is true, we can still ask questions such as how large can sim.G; H / be
when G and H are not isomorphic. This enables us to revisit classes of graphs
for which the question of reconstruction is easily settled but for which the issue of
similarity in terms of subgraphs is still a very interesting unresolved question.
The notion of sim.G; H / is at the heart of two important parameters which have
been studied in the literature on the RC. Both of these parameters indicate how
similar or dissimilar a given graph is to all others, and therefore how easy or difficult
it is to determine it from its deck. The universal reconstruction number 8rn.G/ of
a graph G is defined to be
8rn.G/ D 1 C max fsim.G; H /g:

H 6'G
This means that, given any 8rn.G/ vertex-deleted subgraphs from D.G/, these sub-
graphs determine G uniquely because no other nonisomorphic graph can have all of
them in its deck. This interpretation, which tacitly assumes that RC is true, explains
the name given to this parameter and its notation. This parameter is also often called
the adversary reconstruction number of G [4].
322 J. Lauri
The other reconstruction number 9rn.G/, called the existential reconstruction

number of G, is defined a little differently. Again tacitly assuming the truth of
the RC, 9rn.G/ is defined to be the smallest number of vertex-deleted subgraphs
of G which are not found in the deck of any other graph. This means that there
exist 9rn.G/, and no less, vertex-deleted subgraphs of G which alone determine
G uniquely, and this again explains the name of this parameter and the notation
used. This parameter is also often called the ally reconstruction number or simply
the reconstruction number of G [4]. For reasons which will become clear in the
next section, in this chapter we mostly discuss these reconstruction numbers from
the point of view of finding graphs with a high value for these parameters, that is,
graphs which are in some sense very similar to other graphs. For more results about
these two reconstruction numbers the reader is referred to the survey [4] and the
book [17].
When we discuss the analogous situation with edge-deleted subgraphs we denote
these parameters by the suffix e: sime , 8rne , and 9rne .
It is clear that 9rn.G/ 8rn.G/ but sometimes the two can be equal. For the
two graphs in Fig. 12.1 one can check that 9rn.G/ D 8rn.G/ D 6, 9rn.H / D 3,
and 8rn.H / D 6. It is also clear that 9rn.G/ > 2 because suppose we claim that
9rn.G/ D 2 for some graph G. Let G u and G v be the two vertex-deleted
subgraphs which alone determine G. Construct H as follows. If u and v are adjacent
in G then remove the edge uv, if they are not adjacent then add the new edge uv.
Then, H is not isomorphic to G but it contains the two graphs G u and G v in
its deck.
So the question becomes: how large can 9rn.G/ and 8rn.G/ be? We have seen
that for the graphs in Fig. 12.1 9rn.G/ is as small as it can be and 8rn.G/; 9rn.H /
and 8rn.H / are almost as large as the truth of the RC would allow. We show in the
next section that such large reconstruction numbers are very rare.
12.2 Most Graphs Are Dissimilar
It turns out that most graphs are so dissimilar that their universal reconstruction
number is three; that is, any three vertex-deleted subgraphs of most graphs will
determine the graph uniquely. We shall make this statement more precise and
give the proof in full because it illustrates very well how the concept of subgraph
similarity which we are using depends heavily on the internal structure of graphs.
The proof is based on [2] (Chap. 10).
It is well-known that almost every graph has a trivial automorphism group. How-
ever, a stronger result is possible which will tell us a lot about sim.G; H /, but
we need first to explain what we mean when we say that almost every graph has
some property. So, let P be a graph-theoretic property such as ‘planar’ or ‘vertex-
transitive’. Let rn denote the proportion of labelled graphs on n vertices that have
property P. If limn!1 rn D 1, then we say that almost every (a.e.) graph has
property P. To show that a.e. graph has our desired property we use the simplest
probability space which is set up when studying random graphs. Let G.n; 12 / be the
set of all labelled graphs on the set of vertices f1; 2; : : : ; ng where, for each pair i; j ,
1
P.ij is an edge/ D P.ij is not an edge/ D
2
n
independently. Therefore each graph G in G.n; 12 / has probability . 12 /.2/ , which is,
n
of course, equal to the probability of choosing G randomly from amongst all 2.2/
labelled graphs on n vertices when all are equally likely to be chosen. So, in order to
show that a.e. graph has a particular property P one has to show that the probability
that G 2 G.n; 12 / has property P tends to 1 as n tends to infinity.
The property we are interested in is the following. Let k be fixed. We say that
a graph G has property Ak if all induced subgraphs of G on n k vertices are
mutually nonisomorphic. In other words, G has property Ak means that, if X; Y are
two distinct k-subsets of V .G/, then G X 6' G Y . It is easy to see that if G has
property AkC1 , then it also has property Ak and that if it has property A1 , then it is
asymmetric. Therefore having property Ak is stronger than just being asymmetric.
We show that, for any fixed k, a.e. graph has property Ak .
Lemma 1. Let W V , jW j D t, jV j D n, and let W W ! V be an injective
function that is not the identity. Let g D g./ be the number of elements w 2 W
such that .w/ 6D w. Then there is a set I of pairs of (distinct) elements of W ,
containing at least 2g.t 2/=6 pairs, such that I \ .I / D ;.
Proof. Consider those pairs v; w 2 W such that at least one
is moved. (All pairs are
taken to contain distinct elements.) There are g.t g/C g2 such pairs. For all but at
most g=2 of these pairs, fv; wg 6D f.v/; .w/g (the exceptions are when .v/ D w
and .w/ D v). Let E be the set of all such pairs. Then
!
g g g t
jE j g.t g/ C Dg t 1 g 1 :
2 2 2 2
Define a graph H with vertex-set the pairs in E and such that each pair fv; wg
is adjacent to the pair f.v/; .w/g. In H , all degrees are at most 2. Degrees equal
to 1 could arise because f.v/; .w/g could contain an element not in W , and so
the pair would not be in E . Degrees equal to 2 could arise because fv; wg could be
adjacent to both f.v/; .w/g and f1 .v/; 1 .w/g.
Therefore the components of H are isolated vertices, paths, or cycles. Let I be
a set of independent (that is, not adjacent) vertices in H . Therefore, for any pair
fv; wg 2 I , f.v/; .w/g is not in I .
Now, all isolated vertices in H are independent, at least half of the vertices on
a path are independent, and at least one third of the vertices on a cycle are indepen-
dent, the extreme case here being a triangle. Therefore
2g.t 2/
jI j jE j=3 ;
6
as required. t
u
324 J. Lauri
Corollary 1. Let G 2 G.n; 12 /, W V D V .G/, and jW j D t. Let W W ! V be

an injective function that is not the identity. Let g D g./ be the number of elements
w 2 W such that .w/ 6D w. Let S be the event
“ gives an isomorphism from GŒW to GŒ.W /”.
Then 2g.t 2/=6

1
P .S / :
2
Proof. Let I be the set constructed in the previous lemma. Now, for a given pair
fv; wg 2 I , the event
“fv; wg and f.v/; .w/g are both edges or nonedges”
has probability 1=2. These events, as they range over all pairs fv; wg 2 I , are
mutually independent, because they involve distinct pairs. But S requires all these
events simultaneously. Therefore, by independence,
jI j 2g.t 2/=6
1 1
P .S / ;
2 2
as required. t
u
The result of this corollary is the crux of the matter. There are too many indepen-
dent correct ‘hits’ required for to be an isomorphism, and the probability therefore
becomes small as n increases.
Theorem 2 ([6, 14, 21]). Let k be a fixed nonnegative integer and let G 2 G.n; 12 /.
Let pn denote the probability that
9W V .G/ D V D f1; 2; : : : ; ng;
with jW j D n k and such that
9 W W ! V; 6D id; is an isomorphism from GŒW to GŒ.W /:
Then, limn!1 pn D 0.
Hence, a.e. graph has property Ak .
n
Proof. Pick a particular W V with jW j D nk. This can be done in nk ways,
and !
n n.n 1/ .n k C 1/
D < nk :
nk kŠ
Let t D n k. Let W W ! V be injective and not the identity, and let g D g./
be the number of vertices of W that are moved by . Let S be the event defined in
the previous corollary.
Now, for a given value of g between 1 and t, how many functions are there such
that g./ D g? Such a function is determined by the set fw W .w/ 6D wg and by the
values it takes on this set. Therefore, there are less than n2g such . Therefore, for a
given fixed W , the probability of a nontrivial isomorphism is given by
X t
X X
P .S / D P .S /
6Did gD1 Wg./Dg
t
X 2g.t 2/=6
1
n2g
gD1
2
t h
X ig
D n2 2.2t /=3
gD1
t h
X ig
< 41=3 n2 2t =3 :
gD1
Now t D n k > 12.k C 1/ lg n for sufficiently large n. Therefore
41=3 n2 2t =3 < 41=3 n2 24.kC1/ lg n

41=3 n2
D
n4.kC1/
41=3
2.kC1/
n
1
< kC1
n
where the last inequality follows if 41=3 < nkC1 .
Therefore
X Xt g
1
P .S / <
gD1
nkC1
6Did
Xn g
1
<
gD1
nkC1
nn.kC1/ 1
D :
nn.kC1/ .nkC1 1/
But all this is for fixed W . Therefore the required probability is
nn.kC1/ 1
pn < nk ;
nn.kC1/ .nkC1 1/
and this tends to 0 as n tends to infinity. t
u
326 J. Lauri
Now the following theorem explains the relationship between property Ak and
the subgraph similarity between graphs which we have been discussing.
Theorem 3 ([6, 21, 22]). Let G have property A3 . Then G can be uniquely deter-
mined from any three vertex-deleted subgraphs in its deck. That is, sim.G; H / 2
for any graph H not isomorphic to G and 8rn.G/ D 3.
Proof. Let u; v; w 2 V .G/. We show that G is uniquely determined from just G u,

G v, and G w.
Note first that v is identifiable in Gu and u is identifiable in Gv; because G has
property A3 (and hence A2 ), the only pair of vertices x 2 V .G u/, y 2 V .G v/
such that G u x ' G v y are x D v and y D u. Let X D G u x and
Y D G vy. There can only be one isomorphism from X to Y . For suppose ˛ and
ˇ are two such isomorphisms. Let z 2 V .X / such that ˛.z/ 6D ˇ.z/. Then X z '
Y ˛.z/ ' Y ˇ.z/, contradicting property A3 . Therefore we can label X and Y
uniquely, and, from X D G u, we can determine uniquely all of the neighbours
of v in G, except possibly u. All we need to know is whether u and v are adjacent.
To determine this we repeat the above procedure with G w instead of G u. u t
From Theorem 2 and this lemma the following surprising result is immediate.
Theorem 4. Almost every graph G has sim.G; H / 2 for any graph H 6' G and
therefore 8rn.G/ D 3.
In an analogous manner one prove this result on edge-deleted subgraphs.
Theorem 5. Almost every graph G has the property that any two edge-deleted sub-
graphs from its edge-deck determine it uniquely, that is, sime .G; H / 1 for any
graph H 6' G, and 8rne .G/ D 2.
12.2.1 Empirical Evidence
The data in Table 12.1, obtained by McMullen and Radziszowski [18], give a very
good idea of how strong Theorem 4 really is. Out of more than 12,000,000 graphs
on ten vertices, only 12 have 9rn greater than the minimum possible value of 3. This
Table 12.1 Number of graphs with given order and given 9rn
Order
9rn 3 4 5 6 7 8 9 10
3 4 8 34 150 1044 12;334 274;666 12;005; 156
4 3 4 8 6
5 2 2 2 4
6 2
7 2
situation sets the scene for the search of graphs with large values of 9rn and 8rn,
and sometimes even a value of four can be considered large and graphs with this
value could be difficult to find. In the next section we look at some results which
have been obtained in this vein.
12.3 Graphs with Large Subgraph Similarity
We look at the problem of finding graphs with large subgraph similarity from two
angles, that of the existential reconstruction number 9rn and the universal recon-
struction number 8rn.
12.3.1 Large Values of 9rn
The first graphs for which 9rn were studied were disconnected graphs. Myrvold [23]
and Molina [20] showed the following.
Theorem 6. A disconnected graph with nonisomorphic components has 9rn equal

to 3. A disconnected graph with all components isomorphic each having c vertices
has 9rn c C 2.
So here it seems that we have a rich supply of graphs with large 9rn. The example
which Myrvold gave of disconnected graphs with 9rn D c C 2 was the graph G
consisting of disjoint copies of the complete graph Kc . The graph G in Fig. 12.1 is
the special case K4 [ K4 . However, Asciak and Lauri [5] showed that in fact these
are the only examples of disconnected graphs with 9rn D c C 2 and that there are
no disconnected graphs with 9rn D c C 1. The computer searches of McMullen and
Radziszowski [18] amongst all graphs on at most ten vertices unearthed only two
examples of disconnected graphs with 9rn > 3. These are the graph made up of two
disjoint copies of the cycle on four vertices and the graph made up of two disjoint
copies of the path on four vertices. Both have 9rn D 4 and no other disconnected
graphs with 9rn > 3 are known. The big gap between 9rn D 4 and 9rn D c is
waiting to be explored.
The situation with regular graphs is somewhat similar. Myrvold [22] has shown
that r-regular graphs have 9rn at most r C 3 but Asciak [3] has shown that again the
disconnected graph consisting of disjoint copies of KrC1 is the only r-regular graph
with 9rn D r C 3. Here too, knowledge about the gap between 9rn D 4 and 9rn D
r C 2 is very scant. The computer searches of McMullen and Radziszowski led
them to this construction. The graph RCCn;j is obtained as follows (RCC stands for
redundantly connected cycles). Take n 2 disjoint copies of cycles each of length
j 3. Let vc;i ; i 2 f0; 1; : : : ; j 1g denote the i -th vertex of the c-th cycle. For each
c 6D d join the vertices vc;i and vd;i C1, where addition is modulo j . The resulting
graph RCCn;j is regular and McMullen and Radziszowski prove the following.
328 J. Lauri
Theorem 7. 9rn.RCCn;j / > n C 1, for all n 2 and j 3.
However, in their computer searches, McMullen and Radziszowski found no

other regular graphs with 9rn > 3, apart from pKn and their complements. And
as they say, there seems to be no clear idea on how to establish in general the exact
value of 9rn.RCCn;j / for all n; j .
These cases illustrate the new set of problems which the notion of reconstruction
numbers creates. The classical reconstruction of regular graphs is trivial and that
of disconnected graphs is an easy exercise [17]. But even finding examples with
9rn > 3 is a difficult task. The reader who is interested in finding out more about
graphs with large 9rn is invited to read [18].
12.3.2 Large Values of 8rn
The definition of 8rn is more closely related to that of sim.G; H /, and it seems
more difficult to tackle. It certainly seems easier to find disconnected graphs with
large 8rn than ones with large 9rn. For example, Hemaspaandra et al. [11] observe
that since
sim.Kt C1 [ Kt 1 ; 2Kt / D t C 1
then 8rn.Kt C1 [ Kt 1 / and 8rn.2Kt / are both at least t C 2 and therefore greater
than the corresponding 9rn numbers which are both three. However, the proof in
[11] that these two 8rn numbers are actually t C 2 is not simple, even for such
straightforward graphs; determining 8rn seems to be quite difficult in general. Also,
it is not clear that these and the other two examples given in [11] are not exceptional
cases similar to the usual suspects: the graphs pKn with large 9rn. Therefore the
question of finding disconnected graphs with large 8rn might be as open as it is for
finding disconnected or regular graphs with large 9rn.
Until recently, most of the results obtained about 8rn and sim.G; H / were found
in [10, 22]. An early result was the following.
Theorem 8 ([22]). Let G and H be two graphs on n vertices and with sim.G; H /
D n 1. Then G and H have the same degree sequence.
Again we see that what is an easy exercise in reconstruction [17] becomes a

difficult result when seen in terms of the subgraph similarity between graphs. The
obvious, and difficult, question here is: for given n, what is the largest value of k
such that there exist graphs G and H on n vertices with sim.G; H / D k but with
different degree sequences?
Of course, the most general problem here is to determine the largest value of
sim.G; H / for nonisomorphic graphs on n vertices. But since this would solve
the RC, all authors have attempted this question by restricting G and H to par-
ticular classes and generally trying to determine the maximum possible value of
sim.G; H /.
Significant advances in this direction have recently been reported by Bowler et al.
in [7]. For example, they show the following.
Theorem 9. Let G be a tree and H a unicyclic graph on n vertices (n 19). Then

2
sim.G; H / .n C 1/ :
5
Moreover, this bound is attained.
From this result and other work in [22] the following holds.
Theorem 10. Let G and H be two graphs on n vertices (n 19) and such that
jnk
sim.G; H / C 1:
2
Then if G is a tree H must also be a tree.
Francalanza [10] also considered the number of edge-deleted subgraphs in com-

mon between a tree and a unicyclic graph plus an isolated vertex. She proved the
following.
Theorem 11. Let G be a tree and H a unicyclic graph with an isolated vertex, both
on n vertices. Then
n
sime .G; H / C 1:
2
Bowler et al. make a conjecture that if G is a tree and H is a unicyclic graph plus
an isolated vertex, both on n vertices, then in fact
n
sime .G; H / :
2
The structures of the trees and the unicyclic graphs which attain large subgraph
similarity between them are very particular. The trees are caterpillars, that is, trees
the deletion of whose endvertices gives a path, and the unicyclic graphs are what
Myrvold and Francalanza call sunshine graphs, that is, unicyclic graphs the deletion
of whose endvertices gives a cycle.
The main question which these researchers would like to answer here is certainly
the following: What is the largest possible value of sim.G; H / when G and H are
two nonisomorphic trees on n vertices?
This construction from [7] gives a family of pairs of nonisomorphic trees with
large subgraph similarity. Let
G D K1;p1 [ K1;pC1 [ K1;pC1

H D K1;p [ K1;p [ K1;pC1 :
330 J. Lauri
Let G be the tree obtained from G by adding a new central vertex and three new
edges joining the new vertex to the three cutvertices of G . Similarly, construct H
from H . These two trees are nonisomorphic, have n D 3p C 5 vertices, and
2
sim.G; H / D 2p D .n 5/:
3
This family of tree pairs has the highest known subgraph similarity between non-
isomorphic trees. A similar construction in [7] gives examples of pairs G; H of
nonisomorphic trees on n vertices with the same degree sequence and
2 p
sim.G; H / D .n C 1 2 3n 6/:
3
The best result known to date regarding the highest possible value of sim.G; H / for
general graphs is again found in [7]. First we require a definition. A 2UC graph pair
is a pair of nonisomorphic graphs, G and H , on n vertices, at least one of which is
disconnected, such that in G or in H there are at least two components which cannot
be matched with the components of the other graph by isomorphism. A particular
example is when G is connected and H is disconnected. (2UC stands for Two Un-
matched Components.) The motivation behind this definition is that if A and B are
two nonisomorphic connected graphs with the same deck (hence counterexamples
to the RC) and on n 1 vertices, then sim.A [ K1 ; B [ K1 / D n 1. Bowler et al.
prove the following theorem.
Theorem 12. Let G and H be two 2UC graphs. Then

1
sim.G; H / 2 .n 1/ :
3
For n 22 and n 1.mod 3/, they also give the following infinite family of
pairs of 2UC graphs attaining this bound:
G D Kp1 [ KpC1 [ KpC1

H D Kp [ Kp [ KpC1 :
They also show that this pair is unique for the given values of the parameter n. Note
that although G and H are disconnected, their complements are connected and also
have the same subgraph similarity.
More examples are given in [7] including uniqueness of some families of pairs
attaining the upper bound in Theorem 12. Their work also gives an example of
pairs G; H of 2UC graphs with n D 3p 2 2; .p 3/, having the same degree
sequence, and
2 p
sim.G; H / D .n C 5 2 3n C 6/:
3
This number is smaller than the upper bound in Theorem 12. Therefore it seems
natural to ask what is the maximum possible value of sim.G; H / when G; H are
two nonisomorphic 2UC graphs on n vertices with the same degree sequence.
Motivated by Theorem 12, Bowler et al. make the following conjecture which,
of course, is a considerable strengthening of the RC.
Strong Reconstruction Conjecture
Let G and H be nonisomorphic graphs on n vertices. For large enough n,

1
sim.G; H / 2 .n 1/ :
3
Therefore for any graph G on n vertices and sufficiently large n,

1
8rn.G/ 2 .n 1/ C 1:
3
Finally, what about 8rne .G/, the universal edge-reconstruction number? In clas-
sical graph reconstruction, determining G from edge-deleted subgraphs is always
easier than determining it from vertex-deleted subgraphs. However, the relationship
between the vertex and the edge versions of the parameters which we have been
discussing in this chapter does not seem to be so straightforward (see [4] for more
on this). Sometimes the edge parameter is larger than the corresponding vertex pa-
rameter, and often determining the former is at least as difficult as finding the latter.
Certainly, very little work, if any, has been done on 8rne .G/, especially the search
for graphs with large 8rne , so this is a field wide open for investigation.
12.4 Algorithmic and Other Issues
The RC is not an algorithm question. The issue is not whether there is an efficient
way of obtaining G from its deck but it is a question of uniqueness: is there more
than one graph with the given deck? However, a few variants of the RC have been
adapted into questions of algorithmic complexity. Subgraph similarity and recon-
struction numbers, being so closely related to the GI problem and the subgraph
isomorphism problem which is known to be NP-complete [13] are perhaps the most
natural variants of the reconstruction problem to be treated algorithmically.
In [11], the authors define these four decision problems:
1. EXIST-VRN D fhG; kij9rn.G/ kg:

2. UNIV-VRN D fhG; kij8rn.G/ kg:
3. EXIST-ERN D fhG; kij9rne .G/ kg:
4. UNIV-ERN D fhG; kij8rne .G/ kg:
332 J. Lauri
p
They remark that it is easy to see that EXIST-VRN 2 ˙2 (since GI is low for
˙2p ), UNIV-RN 2 coNPGI , EXIST-ERN 2 NPGI , and UNIV-ERN 2 coNPGI and
they suggest that obtaining tight, or tighter, bounds on the complexity of these prob-
lems should be interesting. (For explanations of the above complexity terms the
reader is referred to [13].)
And finally, what about possible applications? Any measure of similarity be-
tween mathematical objects is bound to have some relevance in situations modeled
by the objects, and graphs are certainly amongst the mathematical structures most
often used as models. One in which notions that relate to the concept of subgraph
similarity seem to be useful is in systems biology. The way a cell processes informa-
tion from its environment in order to determine the rate of production of the proteins
it requires is often modeled by what are called transcription networks, which are
basically directed graphs [1]. Biologists try to identify particular subgraphs of tran-
scription networks in order to explain their functionality. These network motifs are
often identified as those subgraphs in the transcription network which appear sig-
nificantly more often than they do in a random graph of the same size. This seems
quite reminiscent of the notion we have been discussing of comparing two graphs
by counting the number of subgraphs they have in common. Here, the comparison
is usually between the given transcription network and the general random graph.
In this comparison, the number of symmetries of the network motif (the size of
its automorphism group) often plays an important part. The notion of how a sub-
graph embeds in a graph, a notion which involves the number of appearances of
the subgraph and the size of its automorphism group, seems to be the central issue
in the reconstruction problem (see, for example, Chap. 10 and especially Chap. 11
in [17]). An investigation of how these ideas from subgraph similarity and graph
reconstruction might apply to the study of network motifs in transcription networks
could therefore be very useful.
Similar ideas have cropped up in the unlikely area of counterterrorism. Interac-
tions between agents in a society (conversations, emails, telephone calls, etc.) can be
modeled by a graph. Within this “transactional noise” one would like to detect the
emergence of unlikely configurations (subgraphs) which could signify the existence
of networks of terrorist activities [19]. Again, this is done by comparing the trans-
actional network with some appropriate random graph model to detect subgraphs
which appear more frequently than expected by the model. The similarities with the
previous application and what we have been discussing is clear.
It is, after all, not surprising that such applications should exist. With the ability
to collect and handle ever larger amounts of data in various fields from biology to
sociology comes the need of modeling situations with large graphs. And very often
a natural way to investigate certain aspects of the internal structure of such graphs is
through smaller subgraphs which are more manageable. And these applications are
often closely related to issues of algorithmic complexity. When tackling empirically
questions about subgraphs in common between two graphs one cannot escape from
the Graph Isomorphism problem in some guise or another.
12.5 Conclusion
We have discussed a way of measuring similarity between graphs in terms of sub-

graphs which does not simply give an alternative framework for wording the RC. It
raises simple questions which are difficult to solve about graphs which are very eas-
ily reconstructible, and it gives some new twists to old ideas, such as the relationship
between vertex-reconstruction and edge-reconstruction. Independently of the status
of RC, finding classes of graphs with large subgraph similarity or reconstruction
number is an interesting nontrivial problem. And the notion of comparing graphs in
terms of the number of common subgraphs of some type or another that they share
seems to be a promising area of modern applied graph theory, which is closely con-
nected to algorithmic complexity issues related to reconstruction numbers, which
are in turn of important theoretical interest. It seems that subgraph similarity has a
lot to offer to graph theorists with different interests and tastes.
Note added in proof: Bowler, Brown, Fenner and Myrvold have recently shown that
if G is a connected graph and H a disconnected graph, then sim.G; H / bn=2cC1
and they have also characterised those pairs of graphs that achieve this bound.
References
1. Alon U (2007) An introduction to systems biology: design principles of biological circuits.

Chapman & Hall, London
2. Alon N, Spencer JH (1992) The probabilistic method. Wiley, New York
3. Asciak KJ (1998) On certain classes of graphs with large reconstruction number. Master’s
thesis, University of Malta
4. Asciak KJ, Francalanza MA, Lauri J, Myrvold W (2010) A survey of some open questions in
reconstruction numbers. Ars Combinatoria (to appear)
5. Asciak KJ, Lauri J (2002) On disconnected graphs with large reconstruction number. Ars Com-
binatoria 62:173–181
6. Bollobás B (1990) Almost every graph has reconstruction number 3. J Graph Theory 14:1–4
7. Bowler A, Brown P, Fenner T. Families of pairs of graphs with a large number of common
cards. Preprint
8. Bunke H (2000) Recent developments in graph matching. In Proceedings of the 15th interna-
tional conference on pattern recognition, Spain, vol 2
9. Dehmer M, Mehler A (2007) A new method of measuring similarity for a special class of
directed graphs. Tatra Mt Math Publ 36:39–59
10. Francalanza MA (1999) The adversary reconstruction of trees: the case of caterpillars and
sunshine graphs. Master’s thesis, University of Malta
11. Hemaspaandra E, Hemaspaandra LA, Radziszowski SP, Tripathi R (2007) Complexity results
in graph reconstruction. Discrete Appl Math 155:103–118
12. Kelly PJ (1957) A congruence theorem for trees. Pac J Math 7:961–968
13. Köbler J, Schöning U, Torán J (1993) The graph isomorphism problem: its structural
complexity. Birkhäuser, Switzerland
14. Korshunov AD (1971) Number of nonisomorphic graphs in an n-point graph. Math Notes Acad
Sci USSR 9:155–160
15. Lauri J (1981) The reconstruction of maximal planar graphs, II: reconstruction. J Combin
Theory B 30:196–214
334 J. Lauri
16. Lauri J (2004) The reconstruction problem. In Gross JL, Yellen J (eds) Handbook of graph
theory. CRC Press, Boca Raton, FL, pp 79–98
17. Lauri J, Scapellato R (2003) Topics in graph automorphisms and reconstruction. Cambridge
18. McMullen B, Radziszowski SP (2005) Graph reconstruction numbers. J Combin Math Combin
Comput 62:85–96
19. Mifflin T, Boner C, Godfrey G, Greenblatt M (2006) Detecting terrorist activities in the twenty-
first century: a theory of detection for transactional networks. In Popp RL, Yen J (eds) Emergent
information technologies and enabling policies for counter-terrorism. Series on computational
intelligence. IEEE Press, New York, pp 349–365
20. Molina R (1995) Correction of a proof on the ally-reconstruction number of a disconnected
graph. Ars Combinatoria 40:59–64
21. Müller V (1977) The edge reconstruction hypothesis is true for graphs with more than n log2 n
edges. J Combin Theory B 22:281–283
22. Myrvold W (1988) Ally and adversary reconstruction problems. PhD thesis, University of
Waterloo, ON, Canada
23. Myrvold W (1989) The ally-reconstruction number of a disconnected graph. Ars Combinatoria
28:123–127
24. Read RC, Corneil DG (1977) The graph ismorphism disease. J Graph Theory 1:339–363
p̆est Mathematiky 100:371–373
Chapter 13
A Chromatic Metric on Graphs
Gerhard Benadé
Abstract In this chapter, we introduce the concept of relatedness of graphs, based

upon the generalized chromatic number. This allows the definition of a graph metric.
It is proved that the distance between any two graphs is at most three.
Keywords Graphs Chromatic number Generalized graph coloring Graph

distance Metric
13.1 Introduction
Ever since the four-color conjecture was formulated over a century ago, the study
of graph coloring played an active and vital part in this graph theory. The ideas
and techniques developed there, and the problems and questions generated by the
research provided a stimulus to much of nonchromatic graph theory. An abundance
of parameters associated with various ways of partitioning the vertex set of a graph
has been studied over the years.
In 1977, Harary [16] gave a very broad definition of a vertex coloring which
subsumed most of the sometimes quite disparate concepts defined previously. If P
is any class of graphs, satisfying only the condition that it must contain the one-
vertex graph, then a P -coloring of a graph is a partition of the vertex set of the
graph for which the subgraph induced by each partition class is an element of P .
The corresponding parameter is the P -chromatic number, defined as the smallest
number of partition classes in any P -coloring of a graph.
G. Benadé ()
School of Computer Science, Statistics and Mathematics, North-West University,
Potchefstroom, South Africa

336 G. Benadé
This definition opened up the theory of generalized graph coloring, which has
experienced a high level of activity in subsequent years. In this field, one endeav-
ors to uncover the essential structure underlying chromatic theory. This has proved
to be a quite difficult task; the very generality of the setting implies a concomi-
tant dearth of available knowledge.
S For example, some very easily stated questions,
such as determining the .P Q/-chromatic number of a given graph, are still un-
solved (and perhaps unsolvable!). Nevertheless, some remarkable results have been
proved, for instance, Folkman’s theorem [13], asserting that, for every positive in-
teger k and for some classes P of graphs, there exists a graph Gk such that the
P -chromatic number of Gk is k, and the theorem of Bollobás and Thomason [5]
about the existence of uniquely P -colorable graphs for some general classes P of
graphs.
A concept that seems to strike a good balance between generality and tractabil-
ity is the notion of F -free coloring. This special case of a P -coloring is defined
as follows. For any graph F which is not the one-vertex graph, an F -free coloring
of some graph is a partition of the vertex set of that graph in such a way that F
does not occur as an induced subgraph in the subgraph induced by any of the par-
tition classes – in other words, the partition classes induce F -free subgraphs. The
parameter corresponding to the P -chromatic number defined above is defined in
the same way and is called the F -free chromatic number. Many well-known vertex
partitioning parameters are in fact F -free chromatic numbers, the most well-known
certainly being the usual chromatic number , which corresponds to F D K2 , the
complete graph on two vertices. Notable exceptions are the cochromatic number
and the vertex arboricity; they are accommodated only under the general definition
of the P -chromatic number.
Using the notion of an F -free coloring, we introduce a relation on the class of
graphs that ultimately leads to a metric. Two graphs F and G are called related,
denoted by F G, if, for every positive integer k, there exists a graph for which
both the F -free and the G-free chromatic numbers are equal to k. They are called
n-distantly related, for some integer n, if there exist graphs R0 , R1 ; : : : ; Rn such
that F Š R0 R1 Rn Š G, and they are called distantly related if
there is some integer n for which they are n-distantly related. Making essential use
of Folkman’s theorem, it is proved that any two graphs are distantly related. This
means that the metric, defined for two graphs F and G as the minimum number
n for which F and G are n-distantly related, assumes some finite value for any
pair of graphs. It is a rather remarkable fact that, indeed, this value does not exceed
three.
In Sect. 13.2, we introduce the notion of relatedness for general classes of graphs,
then confine our attention to graph relatedness in Sect. 13.3. In Sect. 13.4, various
conjectures giving sufficient conditions for relatedness to hold between two graphs
are discussed. Relatedness between specific graphs types are given in Sect. 13.5. In
Sect. 13.6, a transitive relation is defined, leading to the definition of the chromatic
metric in Sect. 13.7.
13 A Chromatic Metric on Graphs 337
13.2 Relatedness of Classes
Although the main results on relatedness are about relatedness of graphs rather than
of classes, the concept can equally naturally be defined for classes and some inter-
esting general results may be deduced. Recall that the meaning of class is restricted
to exclude the class of all graphs and to always include the empty graph and the
one-vertex graph.
Definition 1. Two classes P and Q are called n-chromatically related for some
positive integer n, denoted by P n Q, if there exists a graph Mn such that
.Mn W P / D .Mn W Q/ D n:
If P n Q for every positive integer n, then P and Q are called chromatically

related, denoted by P Q. Furthermore, should P and Q not be chromatically
related (P 6 Q), they are called chromatically alien.
Often, the word “chromatically” in the above definition is dropped when it can
unambiguously be inferred from the context, and we simply refer to n-related, re-
lated, and alien classes.
Two classes are thus called related if, for each possible value of the chromatic
numbers defined by them, a graph exists for which these two chromatic numbers
both have this value. The chromatic numbers defined by two alien classes, on the
other hand, may well coincide for some values in the spectrum of possible values,
but there will be at least one integer n for which, when applied to any graph, they
will not both be n.
Example 1. The concepts of n-relatedness and relatedness are different, at least for
classes of graphs. An example is furnished by the classes Ql , consisting of all
graphs with order less than l, for some l 3. It follows that .G W Ql / D d v.G/
l1 e.
Now, for some integer l 3, Ql n QlC1 if and only if n < l.
Note that Ql l QlC1 if and only if there is a graph G of order p such that
p
d l1 e D n D d pl e, that is, n 1 < pl and l1p
n. Such a p exists if and only if
nl l < p nl n; that is, n < l.
This means that, for all integers l 3, the classes Ql and QlC1 are not n-related
for all n l and hence that they are alien.
Example 2. The relations n and are not equivalence relations, since, although
they are symmetric and reflexive, they are not transitive. Again, the classes Ql sup-
ply an example. Suppose we take a class of graphs P such that, for any pair of
positive integers n and k with k n, there is a graph G of order k and with
P -chromatic number n. (An example of such a class is the class of null graphs.)
Then Ql P and QlC1 P : For each integer n, a P n-chromatic graph of order
n.l 1/ will have Ql -chromatic number equal to n too, whereas a P n-chromatic
graph of order nl will have QlC1 -chromatic number n too. Thus Ql and QlC1 are
both related to P , but by the previous example they are alien.
338 G. Benadé
Example 3. Another example showing that the relation is not transitive is the
following. It is later proved that the classes K2 and P3 are related, and also P3
and K3 , but that K2 and K3 are alien.
A few elementary properties of these relations are now listed. In the first of these,
1-relatedness is established between any two classes. Thus, showing that two classes
are n-chromatically related for n 2 is sufficient to prove that they are chromati-
cally related.
Remark 1. Any two classes P and Q are 1-chromatically related.
Proof. Since it was assumed that K1 is an element of any class, the one-vertex graph
K1 can be both P 1-colored and Q 1-colored for any two classes P and Q. t
u
Remark 2. Let P and Q be classes. Then, if for some positive integer n, P and Q
are n-chromatically related, so are P and Q. Also, if P and Q are related, then so
are P and Q.
Proof. Recall that the complement of a class P consists of the class of the comple-
ments of the graphs in P . Let P n Q for some n. Let Mn be a graph establishing
this; in other words, .Mn W P / D .Mn W Q/ D n. Then, using Remark 3.2.7 of
[1], it follows that .Mn W P / D .Mn W Q/ D n and hence the graph Mn estab-
lishes n-relatedness between P and Q. Should P and Q be n-related for all n 2,
this proves that their complements will also be, hence P Q implies P Q. u t
The next result is a corollary to Theorem 2.3.3 of [1], and shows that there are in
fact many pairs of chromatically alien classes.
Remark 3. Let P and Q be classes of graphs and let Q 2 denote the class of all
graphs having Q-chromatic number at most 2. Then Q2 P implies that P 6 Q.
Proof. Recall the condition in the above-mentioned theorem, holding for two clas-
ses P and Q and an integer k: Every graph I , with .I W Q/ k, is in P . This
condition, with k D 2, is equivalent with Q 2 P , thus the theorem may be ap-
plied and hence the following inequality holds between the two chromatic numbers,
defined by P and Q, of any graph H :

.H W Q/
.H W P / :
2
This implies that P and Q are alien. t

u
Note that Q Q2 for any class of graphs Q. This result thus asserts that two
classes of graphs are alien whenever their sizes differ too much. This provides an
intuitive way to think about the relations “is alien to” and “is related to” in set-
theoretic terms.
The converse of this result does not hold. It is possible for two classes P and
Q that the condition Q 2 P fails, but that they still are alien. This happens, for
instance, in the case of the two classes Ql and QlC1 discussed above. They are
alien, but there are Ql 2-chromatic graphs that do not occur in QlC1 ; any graph
with order at least l C 1 and at most 2l 2 falls into this category. Thus .Ql /2
6 QlC1 .
Remark 4. Let P and Q be classes with P Q and let P n Q for some n 2.

Let P n R n Q . Also, if P Q and R is any class with P R Q, then
P R Q.
Proof. Let P and Q be n-related for some n 2, and let Mn be a graph such that
.Mn W P / D .Mn W Q/ D n. Then, by Remark 2.3.2 of [1], n D .Mn W P /
.Mn W R/ .Mn W Q/ D n. This implies that all three of these classes are
mutually n-related. This proof holds for any integer n 2, thus the corresponding
statement for chromatic relatedness is also true. t
u
The following result gives sufficient conditions for n-relatedness to imply m-

relatedness, for some positive integers m and n.
Remark 5. Let P and Q be classes of graphs and let m and n be positive integers.
If P Q, then P n Q implies that P m Q for all m n.
Proof. Consider any P -coloring in n classes of a graph Mn establishing the given

n-relatedness between P and Q. Let Mn1 be a subgraph of Mn induced by any
n 1 of the color classes; say V is the omitted color class. Then the P -chromatic
number of Mn1 is n 1. Since P Q,
.Mn1 W Q/ .Mn1 W P / D n 1:
Furthermore, equality must hold, since Mn1 is n 1-chromatic: Suppose that

.Mn1 W Q/ D n 2. Then a Q-coloring for Mn in n 1 colors can be ob-
tained by using any Q n 2-coloring for Mn1 and adding the P -color class V ,
which is also a Q-color class by the assumption on P and Q. This contradicts the
fact that Mn is Q n-chromatic.
Thus there exists a graph for which the Q- and the P -chromatic numbers are
both equal to n 1, proving that P n1 Q. By iterating this procedure another
n 2 times, the result is obtained. t
u
13.3 Relatedness of Graphs
A special case of relatedness of classes is obtained if one considers only classes

F for some graph F . In this case, the relatedness will be said to hold between the
graphs.
Definition 2. Two graphs F and G are called n-chromatically related for some
positive integer n, denoted by F n G, if F n G, and they are called
340 G. Benadé
chromatically related, denoted by F G, if F G. Furthermore, should

F and G be not chromatically related, they are called chromatically alien, denoted
by F 6 G.
Thus, F and G are n-chromatically related if there exists a graph Mn such that
.Mn W F / D .Mn W G/ D n; and they are chromatically related if F n G
for all integers n 1. Also, for two chromatically alien graphs F and G there exists
an integer n 2 such that for no graph H , the F -free chromatic number of H and
the G-free chromatic number of H are both equal to n.
As before, when referring to these concepts further on, the word “chromatically”
might sometimes be omitted if the meaning is sufficiently clear from the context.
Note also that whenever a graph appears in any of these relations, it has been used
to define a chromatic number and thus the convention requiring such graphs to have
at least two vertices applies.
The following few remarks reinterpret the previous section’s results for graphs.
Remark 6. Any two graphs are 1-chromatically related.
Remark 7. Let F and G be graphs. If, for some positive integer n, the graphs F
and G are n-chromatically related, then so are F and G. Likewise, if F and G are
chromatically related, F and G are also chromatically related.
The next result gives a necessary condition for n-relatedness to hold between two
graphs using the chromatic number of the one in terms of the other, and plays an
important role in the sequel.
Remark 8. Let F and G be graphs. If F n G for some integer n 2, then

.F W G/ 2 and .G W F / 2.
Proof. Suppose that .G W F / 3. Then it follows from Corollary 3.2.9 of [1]
that the G-free chromatic number of any graph H and the F -free chromatic number
of H cannot both be equal to n, contradicting F n G. Since this assumption is
symmetric with respect to the positions of F and G (due to the fact that the relation
n is reflexive), the other inequality immediately follows. t
u
Now, for any pair F and G of graphs, it holds that .F W G/ 2 or
.G W F / 2. The added requirement that F and G are related now forces
both these chromatic numbers down to at most two. Intuitively speaking, this means
that related graphs lie closely together in the sense that the chromatic number of
one in terms of the other and vice versa cannot be too large. These matters are
elaborated upon later.
The following result is derived from the above remark by taking G equal to K2 .
In this case, relatedness of a graph F with K2 is shown to have direct implications
for the structure of F .
Corollary 1. Let F be a graph. If F n K2 for some integer n 2, then F is

bipartite.
Proof. Applying Corollary 8 with G D K2 yields .F / 2, which is equivalent to

F being bipartite. Note that the other statement, .K2 W F / 2, is trivial in this
situation, since for all graphs F other than K2 itself, the F -free chromatic number
of K2 is 1 in any case. t
u
It is later shown that the complete bipartite graphs are all related to K2 . Although
this could not be proved for general bipartite graphs, no example of a bipartite graph
alien to K2 has yet been found, and we strongly suspect that relatedness with K2
characterizes the property of being bipartite. Implications of this conjecture are ex-
amined in Sect. 13.4.
The following corollary to Remark 4 is a useful “pinching” result: If a graph is
wedged (in terms of the induced subgraph relation) between two others, and the
outer graphs are related, then all three are mutually related.
Remark 9. Let F and H be graphs with F G H and let, for some n 2, F n H .

Let G be any graph with F G G G H . Then F n G n H . Also, if F H and G
is a graph with F G G G H , then F G H .
Let H be a nontrivial graph related to K2 . Then the remark applies, with

F D K2 . The statement then becomes the following. Every induced subgraph G
of a graph H , which is related to K2 , is related to H (and, of course, also to K2 ). In
this case, we know that H must be bipartite and infer that any induced subgraph of
H – which must again be bipartite – must be related to K2 .
Under certain circumstances, relatedness between graphs can survive disjoint
unions of the graphs in the following sense. If a graph F is related to some graphs
Gi , then F is also related to the disjoint union of the Gi . Theorem 1 gives the con-
ditions for this to happen.
Theorem 1. Let F and G be connected graphs, with F n G for some integer

n 2. Let Gi be a graph with Gi G G, for each i D 1; 2; : : : ; k, and let G D
S S
. kiD1 Gi / G. Then F n G.
Proof. Let Hn be a graph establishing the n-chromatic relatedness between F

and G. Let H D .k.n 1/ C 1/Hn . Then it follows from Remark 3.4.2 of [1]
that .H W F / D n, since F is connected. The same is now shown for the G-free
chromatic number of H :
Suppose that .H W G/ n 1 and let a G-free coloring fV1 ; V2 ; : : : ; Vn1 g in
n 1 colors be given for H . Let fV1l ; V2l ; : : : ; Vn1
l
g be the induced n 1-coloring
on each Hn , for l D 1; 2; : : : ; k.n 1/ C 1. Since .Hn W G/ D n, this is not a
G-free coloring, hence a copy of G occurs in at least one color class. This happens
for each copy Hn in H . Should more than k copies of G occur in any given color
class Vj of H , a monochromatic copy of G would be induced, since G contains all
the graphs Gi as induced subgraphs. There are n 1 color classes, hence at most
k.n 1/ copies of G can occur in any color class without inducing a copy of G.
However, there are k.n 1/ C 1 copies of Hn in G, making the occurrence of at
least one monochromatic copy of G inevitable.
342 G. Benadé
This proves that .H W G/ n. To prove equality, a G-free coloring for H
in n colors is given: color each Hn G-freely in n colors. An n-coloring of H is
obtained by taking the union of the j t h color classes, for each j D 1; 2; : : : ; n. This
coloring is G-free, for suppose a copy of G occurs in some color class. Since G G G,
a copy of G also occurs in this color class. However, this is impossible. Due to the
connectedness of G, if it occurs somewhere, it has to be completely contained in
one of the copies of Hn , whereas the fact that the coloring for each Hn is G-free
prevents the monochromatic occurrence of G in Hn . Hence
.H W G/ D .H W F / D n;
and thus F and G are n-chromatically related. t

u
Corollary 2. Let F and G be connected graphs and let F G. Let Gi be a graph
S S
with Gi G G, for each i D 1; 2; : : : ; k, and let G D . kiD1 Gi / G. Then F G.
Corollary 3. Let F be a connected graph and let k 2 be some integer. Then
F kF .
Corollary 4. Let F and G be connected graphs and let k 2 be some integer. If
F G, then F kG.
In the first part of the proof of this theorem it was not necessary to know that the
graph G forms part of the disjoint union. However, to find a coloring for H in n
colors, it was necessary for G to be an induced subgraph of G and for this, G has to
be in the union.
A result similar to the previous theorem holds for the join of graphs. This is
given next.
Corollary 5. Let F and G be graphs not having some property of graphs of the
form M C N . Let F n G for some integer n 2. Let Gi G G, for each i D
P
1; 2; : : : ; k, and let G D . kiD1 Gi / C G. Then F n G.
Proof. Consider the graphs F and G. They are connected; they are n-related, and
the graphs Gi are induced subgraphs of G for all i . Theorem 1 can thus be applied to
S S
deduce that F is n-chromatically related to . kiD1 Gi / G. Taking complements
again, we find that F n G. t
u
The reader is referred to the examples concluding Sect. 3.4 of [1] for examples
of the property that occurs in this corollary. One obvious property is that of discon-
nectedness, which emphasizes the complementarity between the theorem and the
corollary.
Example 4. The requirement in Theorem 1 that the graphs F and G be connected,
is necessary. An example showing this is furnished by the following facts about null
graphs to be proved later: Nn is related to N2n2 , but Nn is chromatically alien to
2N2n2 . Another example is Kn , being related to K2n2 but not to K2n2 CK2n2 .
This shows the necessity in the corollary for requiring the graphs not to have some
property of graphs of the form M C N .
In the following results, conditions are given for n-chromatic relatedness between
graphs to imply m-chromatic relatedness for integers m and n with m n or m n.
The first is deduced from the general result, Remark 5, holding for classes of graphs.
Remark 10. Let F and G be graphs. If F G G, then F n G implies that F m G

for every m n.
Proof. Since F G G if and only if F G, the remark can be applied to prove
the result. t
u
Recall that the concepts n-relatedness and relatedness were different for classes
of graphs. There exist classes of graphs that are n-related, but not m-related for some
integer m ¤ n. However, an analogous example could not be found for graphs, so
that it is possible that, at least for graphs, these concepts coincide. In this event, the
conclusion of the above result would of course follow without any condition having
to be met. A full discussion of this possibility is deferred to Sect. 13.4.
A result that deduces m-relatedness in the other direction can be proved using
other conditions on the graphs. Recall that a graph with the girth-endvertex property
has girth at least five and no two endvertices have a common neighbor.
Theorem 2. Let F and G be connected graphs with the girth-endvertex property

and let F 6 G G and G6 G F . Let n 1 be some integer. Then F n G implies that
F m G for every m n.
Proof. By assumption, a F n-chromatic and G n-chromatic graph Gn exists,

establishing the n-relatedness between F and G. Let
GnF D F ŒK1 ; Gn ; : : : ; Gn :
Then .GnF W F / D n C 1 by Lemma 3.5.6 of [1]. Furthermore, we also have

.GnF W G/ D n. A G n-coloring of GnF is obtained by coloring each copy of
Gn in GnF G-freely in n colors and using any of these colors to color the single
vertex K1 . By the same lemma, this coloring is indeed G-free, since G6 G F .
Analogously, a graph GnG can be constructed with the properties that
.GnG W F / D n and .GnG W G/ D nC1. But then the graph GnC1 D GnF [GnG
is a graph for which the following holds. .GnC1 W F / D .GnC1 W G/ D n C 1
by Remark 3.4.2 of [1]. This means that F and G are n C 1-related. Thus, for any
integer m n, m n applications of this procedure will show that the graphs F
and G are m-related. t
u
This result has the following important implication.
Corollary 6. For any two connected graphs F and G with the girth-endvertex prop-
erty and satisfying F 6 G G and G6 G F , F is chromatically related to G.
Proof. By induction: K1 is a graph establishing 1-chromatic relatedness between

F and G. By the theorem, if F and G are n-chromatically related for some integer
n 1, they are also n C 1-chromatically related. t
u
344 G. Benadé
The following relatedness can, for example, be deduced from this result. All
cycles on at least five vertices, all paths on at least four vertices, and all trees satis-
fying the condition that no two endvertices have a common neighbour, are pairwise
related to each other.
13.4 Towards a Characterization of Relatedness
In Remark 8, a necessary condition for two graphs F and G to be n-related for some
n 2 was deduced: If F n G for some integer n 2, then .F W G/ 2 and
.G W F / 2. Let us consider in detail what it means for two graphs F and G
to satisfy .F W G/ 2 and .G W F / 2. Only the following four options are
open:
.F W G/ D 1 and .G W F / D 1, which means that G6 G F and F · G.
Although this may surely hold for structurally quite different graphs, additional
conditions on F and G may ensure that F and G are related.
.F W G/ D 1 and .G W F / D 2. Then G6 G F and F G G, but F does not
occur in G as an induced subgraph to any great extent, since a partition of V .G/
in two color classes is sufficient to avoid monochromatic copies of F .
.F W G/ D 2 and .G W F / D 1. This is the same as the previous case, with
the roles of F and G interchanged: Now G G F and F 6 G G.
.F W G/ D 2 and .G W F / D 2. In this case, both G G F and F G G, which
means that F Š G.
Only from the last case does the converse of the implication in the above men-
tioned corollary follow easily – two isomorphic graphs are of course always related.
Corollary 6 provides a partial converse in the first of the above cases. If F 6 G G and
G6 G F , and, additionally, F and G both satisfy the girth-endvertex property, then
they are related.
The question whether the condition on the graphs F and G that .F W G/ 2
and .G W F / 2 is also a sufficient condition for relatedness to hold between
F and G, has a bearing on two other open questions:
Firstly, as a special case of the result quoted above, relatedness of a graph with
K2 implies that it is bipartite. No examples have been found to prove that the con-
verse does not hold, and it is conjectured that being bipartite is indeed equivalent to
relatedness with K2 .
Secondly, requiring that two graphs F and G be related is a seemingly much
more severe condition than requiring only n-relatedness to hold between them for
some n 2; however, no pair of alien graphs has as yet been found for which
n-relatedness holds for some n 2. Again, one is led to conjecture that these two
concepts may be equivalent.
The following interrelationships can be established between these three state-
ments. For ease of reference, we quote them as
Conjecture 1. If F and G are graphs and n 2 is an integer such that F n G,

then F G.
Conjecture 2. If F and G are graphs with .F W G/ 2 and .G W F / 2,

then F G.
Conjecture 3. If G is a bipartite graph, then G K2 .
Theorem 3. Conjecture 1 is equivalent to Conjecture 2 for connected graphs.
Proof. Let .F W G/ 2 and .G W F / 2. Then the graph F [ G establishes
2-relatedness between F and G. Since F is connected,
.F [ G W F / D maxf.F W F /; .G W F /g D maxf2; 2g D 2
and similarly, .F [ G W G/ D 2. Now, Conjecture 1 can be invoked to deduce

that F G.
For the converse, let F n G for some integer n 2. Then, by Corollary 8,
.F W G/ 2 and .G W F / 2 and Conjecture 2 implies that F G. t
u
Theorem 4. Conjecture 2 implies Conjecture 3.
Proof. Let G be bipartite. Then .G/ D .G W K2 / 2. Also, .K2 W G/ D 1
for any bipartite graph G except K2 ; in that case, the value is 2. Thus Conjecture 2
implies that G K2 . t
u
13.5 Some Specific Relatednesses
Relatedness of the complete graphs will be basic to the main results of this chapter.
These graphs exhibit a clustering behavior, the graphs in each cluster being mutually
related and the size of the cluster depending on the order of the smallest graph
contained in it.
The following inequality, valid for all integers n 2,

.G W Kn /
.G W K2n1 /
2
shows that two complete graphs are alien if the difference in their orders is large
enough. From this result, nothing can be inferred about the relatedness or non-
relatedness of the graphs in between. If it were known that two complete graphs
are related, then Remark 9 could be used to show that all complete graphs with
orders lying between these two are also related to them and each other. It is now
shown, using a result of Broere and Frick (Corollary 5 of [6]) that all complete
graphs whose orders remain inside these limits are indeed chromatically related.
346 G. Benadé
Theorem 5 ([6]). Let n, k, and r be positive integers with n r 2 and

k 2. Then there exists a graph G such that
.G W Kr / D .G W KrC1 / D D .G W Kn / D k
if and only if n 2r 2.
Corollary 7. Let n; k and r be positive integers with n r 2 and k 2. Then

the graphs Kr , KrC1 , : : : , Kn are all mutually k-chromatically related if and only
if n 2r 2.
Corollary 8. Let n and r be positive integers with n r 2. Then the graphs Kr ,

KrC1 , : : : , Kn are all mutually chromatically related if and only if n 2r 2.
This shows that the above inequality is the best possible. A useful reformula-
tion of this result is the following characterization of relatedness between complete
graphs.
Theorem 6. Let m and n be positive integers. Then Km Kn if and only if there

exists an integer r 2 such that r m 2r 2 and r n 2r 2.
Taking complements, the corresponding result for the null graphs is immediately
apparent.
Corollary 9. Let m and n be positive integers. Then Nm Nn if and only if there

exists an integer r 2 such that r m 2r 2 and r n 2r 2.
If n is taken to be 2 in these results, we get K2 K2 and the corresponding

triviality for N2 . For n D 3, the statement is that K3 K4 , and of course K2 and
K3 have to be alien, since their orders are too far apart to satisfy the condition of the
theorem. Thus the first two clusters consist of K2 only, and K3 and K4 .
The next type of graph for which relatedness is considered, is the class of com-
plete m-partite graphs for some integer m 2. Such a graph is proved to be related
to the complete graph with order m.
Theorem 7. Let n1 ; n2 ; : : : ; nm , with m 2, be positive integers. Then

Kn1 ;n2 ;:::;nm Km .
Proof. For each integer l 2, define the graph Gl D Kp.n/ , the complete p-partite
graph with n vertices in each partition class, where we define
p D .m 1/.l 1/ C 1
n .l 1/a
a D maxfn1 ; n2 ; : : : ; nm g:
Then .Gl W Km / l: A Km l-coloring for Gl is obtained by gathering the p

partition classes of Gl in groups of m 1 and taking these groups as color classes.
In this manner, l.m 1/ partition classes can be colored with l colors without in-
ducing a monocolored Km . Since l.m 1/ D lm l lm m l C 2 D
.m 1/.l 1/ C 1 D p (recall that m 2), this is a coloring of all the vertices of
Gl . Also, .Gl W Kn1 ;n2 ;:::;nm / l.
Suppose that a Kn1 ;n2 ;:::;nm -free coloring in l 1 colors is given for Gl . Denote
the p partition classes of Gl by W1 ; W2 ; : : : ; Wp , and the l 1 color classes in this
coloring by V1 ; V2 ; : : : ; Vl1 . Then the coloring induces a partition of each partition
class Wi in l 1 parts. Of these parts, at least one will contain at least a vertices,
since jWi j D n .l 1/a for every i . Thus, the first .m 1/.l 1/ partition
classes Wi each contains at least a vertices all having the same color. However, no
more than m 1 such sets of a vertices can occur in a given color class, else a
monochromatic copy of Ka;a;:::;a will be induced, and hence also a monochromatic
copy of Kn1 ;n2 ;:::;nm . (This follows from the definition of a.)
Now there are exactly .m 1/.l 1/ such sets of a vertices each and l 1 colors;
therefore each color class has to contain exactly m 1 of these sets. The partition
class Wp , however, also contains a monochromatic set of a vertices, occurring say
in the color class Vi . In this color class now a monochromatic copy of Ka;a;:::;a is
induced, which contradicts the assumption that the partition V1 ; V2 ; : : : ; Vl1 is a
Kn1 ;n2 ;:::;nm -free coloring of Gl .
This proves that .Gl W Kn1 ;n2 ;:::;nm / l. Since Km G Kn1 ;n2 ;:::;nm , we have
l .Gl W Km / .Gl W Kn1 ;n2 ;:::;nm / l;
and equality holds throughout. Hence, Km l Kn1 ;n2 ;:::;nm holds for all integers
l 2 and this establishes relatedness between Km and Kn1 ;n2 ;:::;nm . t
u
By taking complements in this theorem, a null graph with order m is found to be

related to any disjoint union of m complete graphs, for any integer m 2.
Corollary 10. Let n1 ; n2 ; : : : ; nm , with m 2, be positive integers. Then Kn1 [

K n2 [ [ K nm N m .
By taking complements throughout, the results proved for complete graphs were
translated to the corresponding results about null graphs. The following rather sur-
prising theorem connects these two classes of graphs by establishing relatedness
between any complete graph and the null graph with the same order.
Theorem 8. For all integers m; n 2, Nm Kn .

l
Let l 2 be any integer. The graph Gm;n establishing the desired l-chromatic
l
relatedness is defined as follows. Gm;n consists of two copies of K.l1/.n1/ and
two copies of N.l1/.m1/ , together with all edges between vertices of the two
null graphs and all edges between the vertices of the pair of graphs K.l1/.n1/
l
and N.l1/.m1/ , for both pairs. Now !.Gm;n / D .l 1/ .n 1/ C 1. Thus,
l .l1/.n1/C1
.Gm;n W Kn / d n1 e D l. For the reverse inequality, we observe that
348 G. Benadé
l
a Kn -free coloring of Gm;n in l colors exists. Color the copies of K.l1/.n1/ Kn -
freely in l 1 colors and the two null graphs in the l t h color. This proves that
l
.Gm;n W Kn / D l.
l . This is the graph G l , obtained by interchanging
Now consider the graph Gm;n n;m
l
the numbers m and n in the above definition of Gm;n . By the same arguments as
l
above, .Gn;m W Km / D l. By taking complements in this equation, one obtains
l l l
that .Gn;m W Nm / D .Gm;n W Nm / D l. Thus Gm;n is a graph for which the
Kn -free and the Nm -free chromatic numbers are both l, proving that Kn and Nm
are related.
To conclude the section, we prove the main result relating any connected non-
complete graph to some complete graph.
Theorem 9. G Kn for every connected noncomplete graph G and every integer
n > !.G/.
Proof. For any m 2, we know from Folkman’s theorem that there is a graph
Gm with .Gm W G/ D m and !.Gm / D !.G/. Let Hm D Gm [ Kr , where
r D .m 1/.n 1/ C 1. Since .Kr W G/ D 1 and G is connected, it follows
from Remark 3.4.2 of [1] that
.Hm W G/ D maxf.Gm W G/; .Kr W G/g D m
Also,
.Hm W Kn / D maxf.Gm W Kn /; .Kr W Kn /g

D maxf1; .Kr W Kn /g
n l r mo
D max 1;
n1
D maxf1; mg
D m:
Here, the second equality follows from n > !.G/ D !.Gm /, the third from
Remark 3.3.2 of [1], and the fourth from the choice of r. Thus we have m-chromatic
relatedness between G and Kn for all m 2, proving chromatic relatedness. t
u
Corollary 11. G Nn for every nontrivial graph G for which the complement G
is connected and for every integer n > ˇ.G/.
Proof. Let G be nontrivial and let G be connected, with n > ˇ.G/. Then G is
noncomplete and !.G/ D ˇ.G/ < n. The theorem then yields G Kn and thus
G Nn . t
u
In this theorem, relatedness of a graph with Kn is deduced whenever the clique
number of the graph is less than n. This condition is not necessary, however, since
there do exist (noncomplete) graphs that are related to complete graphs with order
both equal to and less than their clique numbers.
Example 5. In the next section it is proved that P3 K2 , whereas !.P3 / D 2.
Example 6. An example of a noncomplete graph G with G Kn and n < !.G/,

is G D Kn [ KnCj for any 1 < j n 2: By Theorem 6, Kn KnCj , and since
Kn G KnCj , it follows by Corollary 2 that Kn Kn [ KnCj . However, the clique
number of KnCj is strictly greater than n.
The following result gives a partial converse of Theorem 9. A bound on the

clique number is derived if the graph is known to be related to a complete graph.
Theorem 10. Let G be a graph with G Kn for some integer n 2. Then !.G/
2n 2.
Proof. Let .Hl W G/ D .Hl W Kn / D l for some graph Hl , for each inte-
ger l 2. Suppose that !.G/ > 2n 2. Then, as K!.G/ G G, it follows that
.Hl W G/ .Hl W K!.G/ /. Furthermore, since !.G/ > 2n 2 n, we also
deduce that Kn GK!.G/ . Thus .Hl W K!.G/ / .Hl W Kn /. From this it follows
for each l that .Hl W Kn / D .Hl W K!.G/ / for each l, and hence Kn K!.G/ .
Now, applying Theorem 6, the existence of an integer r 2 is inferred for which
r n; !.G/ 2r 2. This is a contradiction. Thus !.G/ 2n 2. t
u
In the special case of n D 2, if G K2 , one gets !.G/ 2 on applying the

theorem. This means that such graphs G are triangle-free, corroborating the known
fact that relatedness with K2 implies that the graph is bipartite.
One may ask whether a small difference between the clique numbers of two
graphs is necessary or sufficient for them to be related. That this is not true is seen
by referring to Theorem 8. There, for all integers m; n 2, Kn was found to be
related to Nm . By making n arbitrarily large, the clique number of Kn can be made
arbitrarily large, whereas the clique number of Nm is fixed at 1.
13.6 Distantly Related Graphs
The relations considered up till now are not transitive. In the following definition the
transitive closure of the chromatic relatedness–relation is taken to obtain a relation
which is transitive and therefore an equivalence relation on the class of graphs.
Definition 3. Let k 0 be an integer. Two classes P and Q are called k-distantly

related, denoted by P k Q, if there exist classes R0 ; R1 ; : : : ; Rk such that
P D R0 R1 : : : Rk D Q:
P and Q are called distantly related if P k Q for some k, denoted by P Q.
It is not immediately evident that such a chain of relatednesses linking any two
classes exists. However, if attention is restricted to classes of the form F for some
350 G. Benadé
graph F , then it is proved that, for an arbitrary pair of classes, even a finite number
of classes can be found that constitutes a link in this manner. Although the following
general remarks may also be formulated for classes, henceforth the theory is devel-
oped for this special case only. Applying the above definition to classes of the form
F , the term distant relatedness is defined for graphs.
Definition 4. Let k 0 be an integer. Two graphs F and G are called k-distantly

related, denoted by F k G, if there exist graphs R0 ; R1 ; : : : ; Rk such that
P Š R0 R1 : : : Rk Š Q:
F and G are called distantly related, denoted by F G, if F k G for some k.
If F and G are 0-related, they are isomorphic; if they are 1-related, they are
related; being 2-related and not 1-related implies that they are alien.
As remarked above, the main goal of this section is to prove that any two graphs
on at least two vertices are distantly related. Keeping in mind that the relation is
an equivalence relation, another way of formulating this is to say that such graphs all
lie in the same equivalence class of ; this means that there is only one equivalence
class, being the class G n fK1 ; ;g. (Recall that none of the definitions of relatedness
makes sense for the graphs K1 and ;.) To prove this assertion, distant relatedness
between any two complete graphs is first established. Then, using Theorem 9, dis-
tant relatedness is established between connected graphs and complete graphs. By
taking complements, the corresponding result holds for disconnected graphs and
null graphs. Finally, the link given by Theorem 8 between the complete graphs and
the null graphs completes the chain of relatednesses.
Remark 11. If two graphs F and G are k-distantly related for some integer k, then
they are l-distantly related for all integers l k, since the chain of relatednesses
between F and G may be lengthened to an arbitrary length by inserting isomorphic
copies of some graph in the chain.
Remark 12. If F and G are graphs and F G, then F 1 G and Remark 11

implies that F k G for every k 1.
We now start on the program outlined above by proving that distant relatedness
holds between any two complete graphs.
Lemma 1. Let m and n be integers with m; n 3. Then Km Kn .
Proof. By Theorem 6, Kr Ks for any two integers r and s with r 2 and

2 s 2r 2. Hence Kn KnC1 for every n 3 and a (finite) chain of
relatednesses can thus be found between any two complete graphs with order at
least three. t
u
This does not include the case where one of the complete graphs is K2 , as K2 is in
a “cluster” of its own: Theorem 6 links it to no other complete graph by relatedness;
in fact, this theorem asserts that it is alien to all the larger complete graphs. However,
K2 is 2-distantly related to K3 and thus, by the lemma, distantly related Kn for

n 3. From the next two results, a chain establishing this 2-distant relatedness is
seen to be K2 P3 K3 .
Lemma 2. K2 P3 .
Proof. Let m 1 be an integer. The graph establishing m-chromatic relatedness
is a complete m-partite graph Kn1 ;n2 ;:::;nm . By Remark 3.3.1 of [1], the K2 -free
chromatic number of this graph is given by
l m m
.Kn1 ;n2 ;:::;nm W K2 / D Dm
21
and by Theorem 3.3.10, the P3 -chromatic number of the same graph is
.Kn1 ;n2 ;:::;nm W P3 / D min fm; m j C nj g:

1j m
Hence, it is sufficient to choose the numbers n1 ; n2 ; : : : nm in such a way that

m j C nj D m. This is achieved by letting nj D j for j D 1; 2; : : : ; m. Then,
for all m 1, .Kn1 ;n2 ;:::;nm W P3 / D .Kn1 ;n2 ;:::;nm W K2 / D m: t
u
Lemma 3. K3 P3 .
Proof. Let p be an even, positive integer. Again,
l p m p
.Kn1 ;n2 ;:::;np W K3 / D D
31 2
and
.Kn1 ;n2 ;:::;np W P3 / D min fp; p j C nj g:
1j p
p
These two chromatic numbers will be equal if p j C nj 2
, with equality for
some j . Let
p
nj D j if 1 j
2
p p
nj D j if <j p
2 2
Then p j C nj D p2 for all j > p2 , thus we obtain the value p2 for the P3 -free
chromatic number of Kn1 ;n2 ;:::;np for every even p 4. By choosing m D p2 for
all even p 4, we get
.Kn1 ;n2 ;:::;np W P3 / D .Kn1 ;n2 ;:::;np W K3 / D m
for all m 2. Therefore the graphs P3 and K3 are chromatically related. t

u
The preceding lemmas are now summarized as Theorem 11. By taking comple-
ments, the corresponding result about the null graphs is also obtained.
352 G. Benadé
Theorem 11. Km Kn for all m; n 2.
Corollary 12. Nm Nn for all m; n 2.
Considering Theorem 9 and its corollary together with the above results, thus far
any two connected graphs have been proved distantly related through the complete
graphs and any two disconnected graphs are distantly related using the null graphs.
The link between the complete graphs and the null graphs, establishing distant rela-
tionship between any two graphs, is given by Theorem 8. This proves the final result
of this section.
Theorem 12. Let F and G be any two graphs with order at least two. Then F
and G are distantly related.
13.7 The Chromatic Metric
By Theorem 12, a finite chain of relatednesses exists between any two graphs. It now
makes sense to try to determine the length of a shortest such chain, which could be
called a chromatic distance between the two graphs. This motivates the following
definition.
Definition 5. Let F and G be graphs of order at least two. The chromatic distance
between F and G, denoted by dc .F; G/, is the smallest number k for which F and
G are k-distantly related.
By Theorem 12, this is a well-defined function on the class of all pairs of graphs
of order two or more, taking integer values k for k 0. If, for two graphs F and G,
the chromatic distance between them is 0, they are isomorphic; if it is 1, F and G
are related; and for values of dc .F; G/ larger than 1 F and G are alien.
Since applying this distance function to any two graphs presupposes that they can
be used to define chromatic numbers, the convention agreed upon earlier still holds
and, in particular, any graph occurring as an argument of dc will be assumed to
have at least two vertices.
Remark 13. The chromatic distance is a metric on the class of all graphs of order at
least two.
Proof. Let F; G and H be graphs. Then dc .F; G/ D 0 if and only if F and G are
isomorphic; dc .F; G/ D dc .G; F / (the function dc is symmetric); and the triangle
inequality holds: dc .G; H / dc .G; F / C dc .F; H /. t
u
On the strength of this remark, the chromatic distance function is also called the
chromatic metric.
Remark 14. Let F and G be graphs, with dc .F; G/ D n for some integer n. Then
dc .F ; G/ D n.
Proof. If dc .F; G/ D n, then there exist graphs R0 , R1 ; : : : ; Rn satisfying F Š

R0 R1 Rn Š G.
By taking complements in this chain of relatednesses, one obtains F Š R0
R1 Rn Š G. This proves that dc .F ; G/ n. Since n is the smallest
integer for which such a chain of relatednesses of length n exists, if S0 ; S1 ; : : : ; Sm
is a sequence of graphs with m < n and F Š S0 ; Sm Š G, then there must an index
i 2 f1; 2; : : : mg for which Si 1 6 Si . Suppose now that dc .F ; G/ < n. By taking
complements in a chain of relatednesses of length less than n linking F and G, a
sequence S0 ; S1 ; : : : ; Sm as above is obtained, linking F and G. Thus, for some
index i , non-relatedness must hold between Si 1 and Si , and thus a non-relatedness
is also found in the chain of relatednesses linking F and G. This is a contradiction,
proving that n is the length of a shortest such chain between F and G. t
u
We now combine our previous results by proving that dc .F; G/ 3 for all graphs
F and G of order at least two.
Theorem 13. Let F and G be graphs and let m; n 2 be integers. Then the fol-
lowing hold.
8
ˆ
ˆ 0 if n D m
<
dc .Km ; Kn / 1 if n ¤ m and there is an r such
(1) D :
dc .Nm ; Nn / ˆ that r m; n 2r 2:
:̂
2 if m > 2n 2 or n > 2m 2
(2) dc .Km ; Nn / D 1:
(3) If F is connected and noncomplete, then
8
< D 1 if !.F / < n
dc .F; Kn / 2 if n !.F / 2n 2 :
:
3 if 2n 2 < !.F /
(4) If F is connected and F is nontrivial, then

8
< D 1 if ˇ.F / < n
dc .F; Nn / 2 if n ˇ.F / 2n 2 :
:
3 if 2n 2 < ˇ.F /
(5) If both F and G are connected and noncomplete, or if they are both nontrivial
and have connected complements, then dc .F; G/ D 2:
(6) If F is noncomplete and G is nontrivial and F and G are connected, then
dc .F; G/ 3:
Proof. (1) These equalities follow directly from Theorem 6 and its corollary.
(2) By Theorem 8, Km and Nn are related for all integers m; n 2.
(3) Let F be connected and noncomplete. Then F Kn for any integer n for
which !.F / < n. In the second case, the graph K!.G/C1 may act as a link
between Kn and F , because Kn K!.F /C1 and F K!.F /C1 . Lastly, any
connected and noncomplete graph with clique number less than some integer n
354 G. Benadé
is related to Kn and also to K!.F /C1 , which is again related to F . In this case,
also, dc .Kn ; F / 2, since Kn F implies that !.F / 2n 2 (Theorem 10).
(4) By taking complements in the previous statement, the corresponding result for
nontrivial graphs with connected complements is obtained.
(5) If F and G are connected and noncomplete, then each is related to some com-
plete graph with order more than its clique number. Hence a complete graph on
any number of vertices more than the maximum of the clique numbers of F and
G is chromatically related to both graphs, and the distance between them is two
if they are not related. Taking complements yields the corresponding statement
for nontrivial graphs with connected complements.
(6) For the last case, consider a connected noncomplete graph F and a nontrivial
graph G of which the complement is connected. Then it is possible to find an
integer n such that F Kn and G Nn : simply choose n to be more than the
maximum of the two numbers !.F / and ˇ.G/. Since n 2, it follows from
Theorem 8 that Kn Nn , thus the chain F Kn Nn G of relatednesses
exists between F and G. This proves the upper bound of three for the distance
between F and G. t
u
Recall that, for all graphs F and G, at least one of the two numbers .F W G/
and .G W F / will be at most 2. It was conjectured that if both are at most 2,
then F and G are related; that is, dc .F; G/ D 1. It might thus seem possible that
a sufficiently large value for one of these two numbers might result in the distance
between F and G also increasing. This theorem now shows that the distance can
increase to at most 3, and indeed there are graphs for which the chromatic number
of one in terms of the other can be made arbitrarily large, whilst the chromatic
distance between them is 2:
For a suitable choice of positive integers m and n, the chromatic number
m
.Km W Kn / D d n1 e can be made arbitrarily large, whereas dc .Km ; Kn / 2.
Furthermore, although this metric certainly does assume the value 2, so far it is
not known whether there exist graphs F and G for which dc .F; G/ D 3. By this
theorem, such graphs, if they do exist, are in one of the following three categories:
F is connected and noncomplete and G D Kn for some integer n with !.F / >
2n 2.
F is connected and F is nontrivial and G D Nn for some integer n with ˇ.F / >
2n 2.
F and G are connected.
However, we suspect that such a pair of graphs does not exist and therefore sur-
mise that the following is true.
Conjecture 4. For all graphs F and G of order at least two, dc .F; G/ 2.
Translating this statement to relatednesses, we have that, for any pair of graphs F
and G, there exists a graph H such that F H G. This implies the following:
For any two graphs F and G there exists a graph H such that all four of the
chromatic numbers .F W H /, .H W F /, .H W G/; and .G W H / are at
most 2.
The converse is not known to hold – that it does, would follow from Conjecture 2
– so this may be a weaker condition on a pair of graphs F and G than requiring
that dc .F; G/ 2. However, proving the conjecture via this weaker version and
Conjecture 2 might turn out to be a more tractable option. Furthermore, as in a
direct proof of the conjecture, here also only graphs from the above three categories
need to be considered. It now transpires that this weaker condition is indeed true for
all graphs F and G, thus making the conjecture a direct corollary to Conjecture 2.
Lemma 4. For any two graphs F and G there exists a graph H such that
.F W H / 2, .H W F / 2, .H W G/ 2, and .G W H / 2.
Proof. For all graphs F and G not in one of the three categories mentioned above,
it follows from Theorem 13 that dc .F; G/ 2 and hence that there exists a graph
H such that F H G. This implies that these four chromatic numbers are at
most two.
Now consider graphs from these three categories (where the third category is
dealt with in three cases):
Let F be a noncomplete and connected graph and let G D Kn for some
integer n 2 with 2n 2 < !.F /. Let H D Nk , where k D v.F /.
Then H 6 G F , F 6 G H , G6 G H , and H 6 G G and therefore all four of the chromatic
numbers .F W H /, .H W F /, .H W G/, and .G W H / are 1.
Let F be nontrivial and F connected, and let G D Nn for some integer n 2
with 2n 2 < ˇ.F /. Taking complements in the previous situation, it is seen
that H D Kk , for k D v.F /, is a graph with the desired properties.
Let F be noncomplete and let F and G be connected. Let H D Kk with k >
v.F /; v.G/. Then again, H 6 G F , F 6 G H , H 6 G G, and G6 G H .
Let F be complete, G nontrivial, and G connected. Suppose that F D Kn for
some integer n 2. If H D Nk , where k > v.F /; v.G/, the relevant chromatic
numbers are again all equal to 1.
Let F be complete and G trivial. This is item (5) of the previous theorem;
accordingly, dc .F; G/ D 1 and the requirement of the lemma is satisfied.
Thus, in all the cases there exists a graph satisfying the conditions of the lemma,
and the proof is complete. t
u
Theorem 14. Conjecture 2 implies Conjecture 4.
13.8 Conclusion
The preceding sections culminate in the definition of the chromatic metric, defined
on all graphs as the length of a shortest chain of relatednesses between two graphs.
It is a remarkable fact that the maximum distance between any two graphs is at
most 3. Our results are tied together by the following chain of conjectures. We sus-
pect that two graphs are related if and only if the chromatic number of each in terms
356 G. Benadé
of the other is at most two. This would imply two other conjectures: that the bipar-
tite graphs are characterized by relatedness to K2 , and that the maximum distance
between any two graphs, as measured with the metric defined above, is actually 2.
These conjectures still await resolution. It would furthermore be worthwhile to
investigate a refining of these concepts, leading to metrics that allow a wider range
of values. Deducing information about the structure of a graph depending on its
distance to known graphs, as exemplified above, would provide a useful tool in the
structural analysis of graphs.
References
1. Benadé JG (1990) Some aspects of generalised graph colourings. Ph.D thesis, Department of
Mathematics, Rand Afrikaans University
2. Benadé G, Broere I (1988) Generalized colourings: existence of uniquely colourable graphs.
Verslagreeks van die Departement Wiskunde, RAU, no. 6/88
3. Benadé G, Broere I (1990) A construction of uniquely C4 -free colourable graphs. Quaest Math
13:259–264
4. Benadé G, Broere I (1992) Chromatic relatedness of graphs. Ars Combinatoria 34:326–330
5. Bollobás B, Thomason AG (1977) Uniquely partitionable graphs. J Lond Math Soc 16:
403–410
6. Broere I, Frick M (1988) A characterization of the sequence of generalized chromatic numbers
of a graph. In: Proceedings of the 6th international conference on the theory and applications
of graphs, Kalamazoo
7. Broere I, Frick M (1990) On the order of uniquely colourable graphs. Discrete Math 82(3):
225–232
8. Brown JI (1987) A theory of generalized graph colouring. Ph.D. thesis, Department of Mathe-
matics, University of Toronto
9. Brown JI, Corneil DG (1987) On generalized graph colourings. J Graph Theory 11:87–99
10. Burger M (1984) The cochromatic number of a graph. Ph.D. thesis, Department of Mathemat-
ics, Rand Afrikaans University
11. Chartrand G, Geller DP (1968) On uniquely colorable planar graphs. J Combin Theory 6:
265–271
12. Chartrand G, Lesniak L (1986) Graphs and digraphs, 2nd edn. Wadsworth, Belmont
13. Folkman J (1970) Graphs with monochromatic complete subgraphs in every edge colouring.
SIAM J Appl Math 18:19–24
14. Frick M (1987) Generalised colourings of graphs. Ph.D thesis, Department of Mathematics,
Rand Afrikaans University
15. Greenwell D, Lovász L (1974) Applications of product colouring. Acta Math Acad Sci H
25:335–340
16. Harary F (1985) Conditional colorablility of graphs. In: Harary F, Maybee J (eds) Graphs and
applications. Proc 1st Col Symp Graph theory. Wiley, New York, pp 127–136
17. Lesniak-Foster L, Straight HJ (1977) The cochromatic number of a graph. Ars Combinatoria
3:39–45
18. Mynhardt CM, Broere I (1985) Generalized colorings of graphs. In: Alavi Y et al (eds) Graph
theory and its applications to algorithms and computer science. Wiley, New York, pp 583–594
Chapter 14
Some Applications of Eigenvalues of Graphs
Sebastian M. Cioabă
Abstract The main goal of spectral graph theory is to relate important structural
properties of a graph to its eigenvalues. In this chapter, we survey some old and new
applications of spectral methods in graph partitioning, ranking, epidemic spreading
in networks and clustering.
Keywords Eigenvalues Graph Partition Laplacian
MSC2000: Primary 15A18; Secondary 68R10, 05C99
14.1 Introduction
The study of eigenvalues of graphs is an important part of combinatorics. His-

torically, the first relation between the spectrum and the structure of a graph was
discovered in 1876 by Kirchhoff when he proved his famous matrix-tree theorem.
The key principle dominating spectral graph theory is to relate important invariants
of a graph to its spectrum. Often, such invariants such as chromatic number or in-
dependence number, for example, are difficult to compute so comparing them with
expressions involving eigenvalues is very useful. In this chapter, we present some
connections between the spectrum of a graph and its structure and some applications
of these connections in fields such as graph partitioning, ranking, epidemic spread-
ing in networks, and clustering. For other applications of eigenvalues of graphs we
recommend the surveys [44] (expander graphs), [51] (pseudorandom graphs), or
[61, 62] (spectral characterization of graphs).
To an undirected graph G of order n, one can associate the following matrices:
The adjacency matrix A D A.G/.
S.M. Cioabă ()

Department of Mathematical Sciences, University of Delaware, 501 Ewing Hall,
Newark, DE 19716-2553, USA

358 S.M. Cioabă
This is an n-by-n matrix whose rows and columns are indexed after the vertices
of G. For each u; v 2 V .G/, A.u; v/ equals the number of edges between u and v.
The Laplacian matrix L D L.G/.
It is also known as the combinatorial Laplacian of G and it equals D A, where
D is the diagonal matrix containing the degrees of the vertices of G and A is the
adjacency matrix of G.
The normalized Laplacian matrix L D L.G/.
1 1 1 1
This equals D 2 LD 2 D In D 2 AD 2 .
Given a real and symmetric matrix M of order n, we denote its eigenvalues by
1 .M / 2 .M / n .M /.
If G is an undirected graph, then all the previous matrices are symmetric and
consequently, their eigenvalues are real numbers.
We use the following notation throughout this paper. The eigenvalues of the ad-
jacency matrix A.G/ are indexed in nonincreasing order:
1 .G/ 2 .G/ n .G/ (14.1)
The eigenvalues of the combinatorial Laplacian matrix L.G/ are listed in nonde-
creasing order:
1 .G/ 2 .G/ n .G/ (14.2)
The eigenvalues of the normalized Laplacian L.G/ are listed in nondecreasing

order:
1 .G/ 2 .G/ n .G/ (14.3)
If G is d -regular, the previous three matrices are related as follows:
1 1
L.G/ D L.G/ D In A.G/: (14.4)
d d
This implies that the eigenvalues of these matrices satisfy the following equation:
i .G/ nC1i .G/

i .G/ D D1 : (14.5)
d d
We list below some basic properties of eigenvalues of graphs. For more details
on eigenvalues of graphs see the monographs of Cvetković et al. [24, 25] (for eigen-
values of the adjacency matrix), the survey of Mohar [55] (for eigenvalues of the
Laplacian), the monograph of Godsil and Royle [38] (for eigenvalues of the ad-
jacency matrix and of the Laplacian), or the book of Chung [18] (for eigenvalues
of the normalized Laplacian). The close relation between eigenvalues and the edge
distribution of a graph is outlined in the following section.
For any real and symmetric matrix M of order n, its eigenvalues are real and they
can be described as follows.
14 Some Applications of Eigenvalues of Graphs 359
Theorem 1 (Courant–Fisher). Let M be a real and symmetric matrix of order n.

Then
xt M x
1 .M / D max
x2Rn ;x¤0 x t x
For any j 2 f2; : : : ; ng,
xt M x
j .M / D min max
u1 ;:::;uj 1 2Rn n
x2R ;x¤0 xt x
x?u1 ;:::;uj 1
xt M x
D max min :
v1 ;:::;vnj 2Rn n
x2R ;x¤0 xt x
x?v1 ;:::;vnj
14.2 Eigenvalues of the Adjacency Matrix
The eigenvalues of the adjacency matrix were studied in 1957 in a paper [23] by
Collatz and Sinogowitz. In [23], the authors determined the eigenvalues of the fol-
lowing graphs:
The complete graph Kn : spectrum n 1 and 1 with multiplicity n 1.
The path Pn : spectrum
j
2 cos ; j 2 f1; : : : ; ng: (14.6)
nC1
The cycle Cn : spectrum
2j
2 cos ; j 2 f1; : : : ; ng: (14.7)
n
Collatz and Sinogowitz also showed that the largest eigenvalue of the adjacency
matrix of a graph G with n vertices satisfies the following inequalities:

2 cos 1 .G/ n 1: (14.8)
nC1
Equality holds in the first inequality if and only if G D Pn and equality holds in the
second inequality if and only if G D Kn .
A walk of length r in G is a sequence of vertices u0 ; u1 ; : : : ; ur such that ui is
adjacent to ui C1 for each 0 i r 1. The previous walk is closed if u0 D ur .
The following lemma can be easily proved by induction.
Lemma 1. The .u; v/-th entry of Ar equals the number of walks of length r which
start at u and end at v.
360 S.M. Cioabă
Let Wr .G/ denote the number of closed walks of length r in G. An easy con-
sequence of the previous result is the following lemma which is the basis of many
important results involving eigenvalues of the adjacency matrix. This is often used
when studying the eigenvalues of random graphs.
Lemma 2. For any integer r 1,
X
n
Wr .G/ D trAr D ri : (14.9)
iD1
A simple connection between the structure of a graph and its eigenvalues is given
by the following result.
Lemma 3. A graph G is bipartite if and only if the spectrum of its adjacency matrix
is symmetric with respect to 0.
Proof. The proof follows using the previous result. t
u
For regular graphs, we have more information regarding the extreme eigenvalues.
Lemma 4. Let G be a connected d -regular graph on n vertices. Then

(i) d D 1 > 2 n d .
(ii) G is bipartite if and only if n D d .
As mentioned earlier, there is a close connection between the eigenvalues of a
graph and its structure. The following result, also known as the expander mixing
lemma (cf. [44]), exemplifies this connection.
Theorem 2. Let G be a connected d -regular graph and D max.j2 j; jn j/. If
S; T V .G/, then
p
d jS j.n jS j/jT j.n jT j/
jjE.S; T /j jS jjT jj : (14.10)
n n
This result implies that if is small compared to d , then the edge distribution
of G is close to the edge distribution of the random graph with the same edge den-
sity as G. The graphs with small are called expanders and are very important in
many areas of mathematics and computer science (see the excellent survey of Hoory
et al. [44] on expander graphs and their applications).
14.3 Eigenvalues of the Laplacian
The first application of the Laplacian of a graph is the matrix-tree theorem or

Kirchhoff’s theorem [49] (see [9], Chap. II for more details). If L is the Laplacian
matrix of a graph G and i ¤ j are two vertices of G,then let L.ij / be the matrix
obtained from L by deleting row i and column j .
Theorem 3 (Matrix-Tree Theorem). If i ¤ j are two vertices of a connected

graph G, then the number of spanning trees of G equals the absolute value of
det.L.ij / /. Also, the number of spanning trees of G equals 2 :::
n
n
.
We list now some simple properties of the eigenvalues of the Laplacian of a graph.
Lemma 5. Let G be a graph. Then
(i) The Laplacian matrix of G is a positive semidefinite matrix.
(ii) The smallest eigenvalue 1 .G/ of the Laplacian of G equals 0 and its multi-
plicity equals the number of components of G.
(iii) The graph G is connected if and only if 2 .G/ > 0.
Proof. Orient the edges of G arbitrarily. Consider a signed incidence matrix N of
G with respect to the orientation of the edges. The rows of N are indexed by the
vertices of G, the columns of N are indexed by the edges of G, and the entries of
N are defined as follows:
8
ˆ
<C1; if i is the head of e
ˆ
N.i; e/ D 1; if i is the tail of e
ˆ
:̂0; otherwise:
By a simple calculation, it follows that L.G/ D N N t . This implies that the

Laplacian of G is a positive semidefinite matrix. Thus, all its eigenvalues are non-
negative. Also, for any vector x 2 Rn ,
X
x t Lx D x t N N t x D .N t x/t .N t x/ D .xi xj /2 : (14.11)
ij 2E.G/
Let H1 ; : : : ; Hk denote the components of G. For each i 2 f1; : : : ; kg, consider

the vector vi that is the characteristic vector of the component Hi . It is easy to see
that vi is an eigenvector of L corresponding to the eigenvalue 0. Also, v1 ; : : : ; vk
are linearly independent which implies that the multiplicity of 0 is at least k.
Let y be an arbitrary eigenvector corresponding
P to the eigenvalue 0. It follows
that y t Ly D 0. Using (14.11), it follows that ij 2E.G/ .yi yj /2 D 0 which means
that the entries of y are constant on each component of G. This implies y is a linear
combination of v1 ; : : : ; vk which shows that the multiplicity of 0 as an eigenvalue of
L.G/ equals the number of components of G. The last part of the theorem follows
easily. t
u
A very important property of the eigenvalues of the Laplacian is that they control
the edge distribution in the graph. Chung [19] proved the following result.
Theorem 4. Let G be a connected graph on n vertices with average degree d .
Then for any subsets S; T V .G/,
d maxi ¤0 jd i j p
jjE.S; T /j jS jjT jj jS j.n jS j/jT j.n jT j/: (14.12)
n n
362 S.M. Cioabă
14.4 Eigenvalues of the Normalized Laplacian
The normalized Laplacian was introduced by Chung [18]. We list now some sim-
ple properties of the eigenvalues of the normalized Laplacian of a graph. These
properties are very similar to those of the Laplacian of G. The eigenvalues of the
normalized Laplacian seem to relate better to parameters related to random walks
on graphs (cf. [19]).
Lemma 6. Let G be a graph. Then
(i) The normalized Laplacian matrix of G is a positive semidefinite matrix.
(ii) The smallest eigenvalue 1 .G/ of the Laplacian of G equals 0 and its multi-
plicity equals the number of components of G.
(iii) The graph G is connected if and only if 2 .G/ > 0.
In [19], Chung proved a matrix-tree theorem for the normalized Laplacian.
Theorem 5. If G is a connected graph, the number of its spanning trees equals
Q
i 2V .G/ di Y
P i
i 2V .G/ di
i ¤1
The eigenvalues of the normalized Laplacian also

P influence the edge distribution
in the graph. If S V .G/, define vol.S/ as i 2S di . Chung [19] proved the
following result.
Theorem 6. If S and T are subsets of vertices in a connected graph G, then
q
vol.S/vol.T/ vol.S/vol.S/vol.T/vol.T/
jjE.S; T / j
vol.G/ vol.G/
where D maxi ¤0 j1 i j.
14.5 Graph Partitioning Using Eigenvalues and Eigenvectors
There are many examples of graph-theoretic questions which can be formulated as

the problem of partitioning the vertices of a graph G D .V; E/ into a fixed number
k 2 of disjoint nonempty subsets V1 ; : : : ; Vk such that some objective function
f .V1 ; : : : ; Vk / is maximized or minimized.
The famous MAX-CUT problem is concerned with determining a partition of G
into two parts V1 and V2 such that the number of edges between these parts e.V1 ; V2 /
is maximum.
Finding the edge-connectivity of G is equivalent to finding a partition of G into

two parts V1 and V2 such that e.V1 ; V2 / is minimum. Finding the vertex connec-
tivity of G means determining a partition of G into three parts V1 ; V2 ; V3 such that
e.V1 ; V3 / D 0 and jV2 j is minimum.
e.S;S c / jN.S/nSj
Given a subset of vertices S , let ˚.S / D min.jSj;jS c j/ and .S / D jSj
.
Determining the edge-expansion constant of a graph means finding the minimum of
˚.S / taken over all subsets S of V .G/. The vertex-expansion of G is the minimum
of .G/ over all subsets of S with jS j jV .G/j
2 .
The idea of using eigenvalues to study graph-partitioning problems originated
with Donath and Hoffman [29]. Their work was based on previous results of
Hoffman and Wielandt [43]. A partition of the vertex set of a graph G into k
nonempty subsets V1 ; : : : ; Vk is called a k-partition of G.
Theorem 7 ([29]). Let V1 ; : : : ; Vk be a k-partition of a G such that jVi j D ni for
each i 2 f1; : : : ; kg and n1 n2 nk 1. Then
X 1X
k
e.Vi ; Vj / nl l .G/: (14.13)
2
1i <j k lD2
Proof. The proof uses the Hoffman–Wielandt inequality [43] which states that is
A and B are two real and symmetric matrices of the same order m, then
X
n
tr.ABt / i .A/i .B/ (14.14)
iD1
Taking A to be the Laplacian of G and B the direct sum of all one matrices of order
n1 ; n2 ; : : : ; nk yields the required result. t
u
Actually Donath and Hoffman proved some stronger results in [29]. They showed
that the previous result is true when one replaces the Laplacian by any matrix of the
form F A where F is a diagonal matrix whose entries sum up to twice the number
of edges of G.
If the sizes ni are not equal, then Donath and Hoffman prove the following
improvement of the previous theorem.
Theorem 8. Let G D .V; E/ be a graph and V D V1 [ V2 [ [ Vk be a partition
of G into k parts such that jVi j D ni and n1 n2 nk . Let y2 yk
be the roots of
!
X X X
ni x k1 2 ni nj x k2 C 3 ni nj nl x k3 D 0
i i <j i <j <l
Then
X X
k
e.Vi ; Vj / yi i .G/
1i <j k i D2
364 S.M. Cioabă
If k divides n, a k-partition V1 ; : : : ; Vk of G is called balanced if jVi j D n

k for
any i 2 f1; : : : ; kg. The k-section width swk .G/ of a graph G is defined as
X
swk .G/ D min e.Vi ; Vj /;
1i <j k
where the minimum is taken over all balanced k-partitions of G. The 2-section width
is also called the bisection width. The calculation of the bisection width of a graph
G is NP-hard [34], even when it is restricted to the class of d -regular graphs [16].
The result of Donath and Hoffman implies that for any graph G on n vertices,
Pk
n l .G/
swk .G/ lD2
(14.15)
2k
In particular, for k D 2, the bisection width satisfies the inequality
n2 .G/
sw2 .G/ (14.16)
4
Motivated by questions in parallel computation, Elsässer et al. [31] studied bal-
anced k-partitions of graphs. The authors gave a new proof of inequality (14.15)
and characterized the equality case. Note that Theorem 1 of [31] is a particular case
of Corollary 4.3.18 from [45].
Theorem 9. Let G be a connected graph on n vertices and let V1 ; : : : ; Vk be a
balanced k-partition of G of size swk .G/. Let x1 ; : : : ; xk be eigenvectors corre-
sponding to the first k smallest eigenvalues of L.G/. If
P
n klD2 l .G/
swk .G/ D
2k
then
(i) For any i 2 f1; : : : ; kg, if s; t 2 Vi , then xj .s/ D xj .t/ for any j 2 f1; : : : ; kg.
(ii) For any i ¤ j 2 f1; : : : ; kg and any two vertices s; t 2 Vi , the number of
neighbours of s in Vj equals the number of neighbours of t in Vj .
The authors of [31] also provide examples of simple graphs for which the bound
from Theorem 7 is far from optimal. We describe some of their examples below.
Given two graphs G and H , the Cartesian product GH has vertex set V .G/
V .H / and its edges are defined as follows:
.a1 ; b1 / .a2 ; b2 /
if and only if a1 a2 and b1 D b2 or a1 D a2 and b1 b2 . The Laplacian matrix

of GH equals L.G/ ˝ IjV .H /j C IjV .G/j ˝ L.H /. Thus, the eigenvalues of the
Laplacian of GH are of the form i .G/ C j .H / for i 2 f1; : : : ; jV .G/jg and
j 2 f1; : : : ; jV .H /jg (see also [55]).
The r r torus graph is the Cartesian product Cr Cr of two cycles of length r.
This graph is a 4-regular graph and thus, the eigenvalues of its Laplacian are related
to the eigenvalues of its adjacency matrix as pointed out by
(14.5).
Using (14.5) and
p p
(14.7), a n n-torus has 2 D 3 D 4 D 2 2 cos 2
p
n
. Thus, the right side
3 2
p bound of 2 for sw4 . However, the 4-section width of

of Theorem 7 yields a lower
the previous graph is 4 n.
When k D 2, Bezrukov et al. [8] characterized the graphs for which equality is
attained in (14.16).
Theorem 10. Let G D .V; E/ be a connected graph on an even number of vertices.
The following statements are equivalent:
(i) sw2 .G/ D n24.G/ .
(ii) There is an eigenvector corresponding to 2 .G/ which has only 1 and C1
entries.
(iii) In any optimal bisection, V .G/ D V0 [ V1 , any vertex is incident to exactly
2 .G/
2 edges.
n2
There are many graphs whose bisection width equals 4
. Such examples are the
2
complete graphs Kn on an even number of vertices (they have sw2 D n4 and
2 D 4), the Petersen graph (it has n D 10; sw2 D 5, and 2 D 2), and the
d -dimensional hypercube Qd (it has n D 2d ; sw2 D 2d 1 , and 2 D 2).
However, there are many graphs for which inequality (14.16) is weak. Guattery
and Miller [39] constructed some examples of such graphs. We describe one of their
examples below. For k 1, the graph Gk has vertex set f1; : : : ; 4kg and consists of
two disjoint paths on 2k vertices (with vertex set f1; : : : ; 2kg and f2k C 1; : : : ; 4kg,
respectively). Also, for any 1 j k, the vertex k C j is adjacent to the vertex
3k C j . The graph Gk is planar and looks like a ladder with 2k steps from which
the bottom k steps have been removed.
The graph Gk has 4k vertices. It has a bisection width 2 since removing the edges
.k; k C 1/ and .3k; 3k C 1/ yields two disjoint components of order 2k, namely the
ones induced by f1; : : : ; k; 2k C 1; : : : ; 3kg and fk C 1; : : : ; 2k;
3k C 1; : : : ; 4kg.
Guattery and Miller [39] showed that 2 .G/ 4 sin2 2k
and that the spectral
partition produces a bisection width of size k (the bisection width given by the
spectral method is f1; : : : ; 2kg and f2k C 1; : : : ; 4kg).
In [8], the authors also improve the Donath–Hoffman lower bound on the bisec-
tion width for a graph with specific level structure. We briefly describe their results
below. Let V D V0 [ V1 be a bisection of a graph G with cut size . Let V01 de-
note the subset of vertices in V0 that are incident to a cut edge. For i 1, let V0i
denote the set of vertices in V0 at distance i 1 from a vertex in V01 . One can define
the sets V1i similarly. Also, let Ei D E.Vi ; Vi C1 / for i 1 and 2 f0; 1g. If
g W N ! N, then LS.g; / denotes the class of graphs which have a bisection of
cut size and a level structure as above such that jEi j g.i / for 2 f0; 1g and
all i 1.
366 S.M. Cioabă
Theorem 11. If G 2 LS.g; /, then there exists a function W RC ! R with

.x/ ! 0 as x ! 1 such that
P1 n
If A WD 1 C 2 i D2 g.i11/ < 1, then 4 2 A 1 C n .

n2
If g.i / D i C 1, then 4
LambertW 4
2
1 C n , where
LambertW.x/ is the inverse function of xe x .
1C˛
n2 2
g.i / D .i C 1/ and 0 ˛ < 1, then
˛
4 f .˛/ 1 C n , where
f .˛/ D 1C˛
1C˛ .
2..1˛/.3˛// 2
In [8], the authors show that there are graphs for which the bounds from the
previous theorem are tight up to a constant factor. If G is a graph of maximum
degree d , then G 2 LS.g; sw2 .G//, where g.i / D .d 1/i . This is because
max.jV0i j; jV1i j/ sw2 .G/.d 1/i 1 . In this case, the previous theorem implies
that sw2 .G/ n4 2 d d2 .1 o.1// as sw2n.G/ ! 1.
p
Recall that a connected d -regular graph is called Ramanujan if ji j 2 d 1
for each i ¤ ˙ d . In [8], the authors use the previous theorem to improve the bi-
section width of Ramanujan graphs. The Donath–Hoffman bound implies a lower
bound of 0:0042n for the bisection width of a 3-regular Ramanujan graph and
of 0:133n for the bisection width of a 4-regular Ramanujan graph. They improve
the previous bound to 0:082n and 0:176n, respectively. In the opposite direction,

Monien and Preis [56] gave upper bounds on the bisection width of 16 C n for
3-regular graphs and of .0:4 C /n for 4-regular graphs, for any > 0, when n
is larger than some function of the chosen . For more recent results regarding the
bisection width of random regular graphs, see [28].
Using some eigenvalue interlacing results of Haemers [40], Bollobás and
Nikiforov [10] proved the following result which also implies inequality 14.15.
Theorem 12. Let V1 ; : : : ; Vk be a k-partition of a graph G on n vertices. Then
X
k1 X X
k
1 1
nl .G/ e.Vi ; Vj / C l .G/: (14.17)
jVi j jVj j
lD0 1i <j k lD2
Fiedler [32, 33] used the eigenvalues of the Laplacian in connection with the
connectivity of a graph. From the Courant–Fisher theorem we know that
P
ij 2E.G/ .xi xj /2
2 .G/ D min P (14.18)
n
x2R ;x¤0
x?1 i 2V .G/ xi2
In [32], Fiedler called 2 .G/ the algebraic connectivity of the graph G because
of its connections with the usual vertex- and edge-connectivity of G. Recall that
the vertex connectivity k.G/ of a connected graph G is the minimum number of
vertices whose deletion disconnects G. By convention k.Kn / D n 1. The edge
connectivity of a connected graph G is the minimum number of edges whose

removal disconnects G. The following result is well known (see [67, 68] for more
details).
Lemma 7 ([68]). If G is a connected graph with minimum degree ı.G/, then
1 k.G/ k 0 .G/ ı.G/
Fiedler [32] proved the following important theorem.

Theorem 13 ([32]). Let G be a connected graph. Then
2 .G/ k.G/ k 0 .G/:
Proof. The proof follows after showing that deleting any vertex from a connected
graph decreases the algebraic connectivity by at most 1. More precisely, if i is vertex
of a connected graph G on n vertices and H D G n fi g, then
2 .G/ 2 .H / C 1
This can be proved using the Courant–Fisher theorem. t

u
Kirkland et al. [50] characterized the connected graphs for which 2 .G/ D
k.G/. If G1 and G2 are distinct graphs, then the join, G1 _ G2 of G1 and G2 is the
graph obtained from the union of G1 and G2 by adding all edges between V .G1 /
and V .G2 /.
Theorem 14 ([50]). Let G be a connected graph on n vertices. Then 2 .G/ D
k.G/ if and only if G can be written as a join G1 _ G2 where G1 is a disconnected
graph on n k.G/ vertices and G2 is a graph on k.G/ vertices with 2 .G2 /
2k.G/ n.
For regular graphs, Fiedler’s results were improved by Krivelevich and
Sudakov [51].
Theorem 15 ([51]). Let G be a connected, d -regular graph. If 2 .G/ D d
2 .G/ 2, then k 0 .G/ D d . Also,
362 .G/
k.G/ d
d
Here, .G/ D max ji .G/j where the maximum is taken over all eigenvalues
i .G/ ¤ ˙d .
The first inequality of the previous theorem was recently improved by the author
(see [22] for more details). In [51], Krivelevich and Sudakov show that the error
term in the second inequality is tight up to a constant factor.
A graph G of order n is called strongly regular with parameters .n; d; a; b/ if it
is d -regular, any two adjacent vertices have exactly a common neighbours, and any
368 S.M. Cioabă
two nonadjacent vertices have exactly b common neighbours. From the definition,
it follows that if A is the adjacency matrix of an .n; d; a; b/ strongly regular graph,
then
A2 D dI C aA C b.J I A/
where J is the all one matrix. This implies that the eigenvalues of an .n; d; a; b/
strongly regular graph are
p
ab˙ .a b/2 C 4.d b/
d;
2
Strongly regular graphs are well studied and have many connections to finite geom-
etry and algebra.
Brouwer and Mesner [15] showed that the vertex-connectivity of a strongly
regular graph equals its degree. Brouwer and Haemers [12] showed that the edge-
connectivity of a distance-regular graph equals its degree.
These results were recently improved by Brouwer and Koolen [14] who showed
that the vertex-connectivity of a distance-regular graph equals its degree d and that
the only disconnecting subsets of size d are the vertex neighborhoods.
In [32], Fiedler obtained other inequalities relating the connectivity of a graph to
the eigenvalue of the Laplacian.
Theorem 16 ([32]). Let G be a connected graph with n vertices and maximum
degree
.G/. Let ! D n . Then
2 .G/ 2k 0 .G/.1 cos !/
and
2 .G/ 2k 0 .G/.cos ! cos 2!/ 2
.G/ cos !.1 cos !/
In another seminal paper [33], Fiedler studied the eigenvectors of the Laplacian
of a graph.
Theorem 17 ([33]). Let G be a connected graph, and let u2 be an eigenvector
corresponding to the eigenvalue 2 .G/. For any ˇ 2 R, let VC .ˇ/ D fi 2 V .G/ W
u2 .i / ˇg and V .ˇ/ D fj 2 V .G/ W u2 .j / ˇg. Then for any ˇ 0, the
subgraph induced by VC .ˇ/ is connected and the subgraph induced by V .ˇ/ is
connected as well.
The entries of an eigenvector u2 corresponding to 2 .G/ can be used to con-
struct graph-partitioning algorithms. The basic idea of spectral partitioning is to
find a splitting value ˇ and partition the graph into V .ˇ/ D fi W u2 .i / ˇg and
V .G/ n V .ˇ/ D fj W u2 .j / > ˇg. Choosing the value of ˇ depends on the specific
application. Some popular choices are the following.
Bisection width: ˇ is the median of u2 .1/; : : : ; u2 .n/.
Edge expansion: ˇ is the value that minimizes ˚.S /, where S D V .ˇ/.
Vertex expansion: ˇ is the value that minimizes .S /, where S D V .ˇ/.
Since the mid-1980s, many researchers (see [1, 6, 54, 60] for example) have stud-
ied the connections between the expansion of a graph and its Laplacian eigenvalues.
The following result is due to Mohar [54].
Theorem 18 ([54]). If G is a connected graph, then
2 .G/ p
˚.G/ .2
.G/ 2 .G//2 .G/: (14.19)
2
In [18], Chung proved a similar result involving the eigenvalues of the normalized
P that if S is a subset of
Laplacian and the expansion properties of a graph. Recall
vertices of a graph G, vol.S/ is defined to be vol.S/ D i2S di . The Cheeger ratio
jE.S;S /j
of S is defined to be hS D min.volS;volS/ . This is very similar to the definition of
˚.S /. Also, note that hS D hS . The Cheeger constant of G is
hG D min hS : (14.20)
SV .G/
Recall that i is the i -th smallest eigenvalue of the normalized Laplacian I

1 1
D 2 AD 2 . Chung [18] proved the following result (see also [20] for a simpler
proof).
Theorem 19. If G is a connected graph, then
2
sG h2
2hG 2 G: (14.21)
2 2
Here sG is the minimum Cheeger ratio of subsets Sk , consisting of vertices with the
largest k values in the eigenvector associated with 2 , for all 1 k n 1.
In a recent paper [21], Chung studied local cuts and local graph partitioning
algorithms based on eigenvalues of the normalized Laplacian. More precisely, given
a connected graph G D .V; E/ and a subset of vertices S , the local Cheeger constant
cS of S is defined as
jE.T; T /j
cS D min :
T S vol.T/
The closure S of S is formed by the vertices of S and the vertices adjacent to

a vertex of S . A function f W S ! R satisfies the Dirichlet boundary condition if
f .i / D 0 for all i 2 S n S . The Dirichlet eigenvalue S of S is defined as
P
ij 2E.G/ .f .i / f .j //
2
S D min P 2
;
i 2S f .i /di
where the minimum is taken over all nonzero functions f W S ! R satisfying the
Dirichlet boundary condition.
Chung [21] proves the following local Cheeger inequality.
370 S.M. Cioabă
Theorem 20. Let G be a connected graph and S be a subset of vertices of G such

that GŒS is connected. Then
cS2
cS S :
2
The proof of this theorem yields a simple algorithm (which is based on the eigenvec-
tor corresponding to S ) for finding a local cut. The previous theorem will guarantee
that this cut is within a quadratic of the optimum.
Spielman and Teng [58, 59] have proved that the spectral partitioning method
works well for planar graphs.
Theorem 21 ([58]). Let G be a connected planar graph on n vertices and maxi-
mum degree
.G/. Then
8
.G/
2 .G/ :
n
Proof. From the Courant–Fisher theorem, we know that

P
ij 2E.G/ .xi xj /
2
2 .G/ D min P 2
:
x?1 i 2V .G/ xj
It follows that P
ij 2E.G/ jjvi vj jj2
2 .G/ D min P ; (14.22)
i 2V .G/ jjvi jj2
where
P the minimum is taken over all vectors v1 ; : : : ; vn 2 Rn such that
E
i 2V .G/ vi D 0.
Spielman and Teng now use the following kissing disk theorem of Koebe,
Andreev, and Thurston (see [58, 59] for more details).
Theorem 22 (Koebe–Andreev–Thurston). If G is a planar graph with vertex set
f1; : : : ; ng, then there exist a set of disks fD1 ; : : : ; Dn g in the plane such that .i; j /
is an edge of G if and only if Di touches Dj .
A cap is the intersection of a half-space with a sphere and its boundary is a circle.
Using a stereographic projection to map the kissing disk embedding of the graph G
to a kissing cap embedding of G, Spielman and Teng show that we can represent
the planar graph G by kissing caps on the unit sphere such that the centroid of the
centers of the caps is the center of the sphere.
Let vi be the center of the cap corresponding to vertex i . One can assume that
P
E
i 2V .G/ vi D 0. Denote by ri the radius of the cap corresponding to vertex i . If cap
i touches cap j , then jjvi vj jj < ri C rj by the triangle inequality. This implies
that
X X X
jjvi vj jj2 < .ri C rj /2 2.ri2 C rj2 /
ij 2E.G/ ij 2E.G/ ij 2E.G/
X
2
.G/ ri2 :
i 2V .G/
Since the caps do not overlap, it follows that the area of the unit sphere is larger than
the sum of the areas of the caps which implies that
X
4 ri2 :
i 2V .G/
Using inequality (14.22), the desired result follows. t

u
The following theorem of Mihail [53] (see [54] for related results and see [18–20]
for similar results for the normalized Laplacian) shows that one can use eigenvectors
corresponding to 2 (or approximations of such eigenvectors) to find subsets S with
small ˚.S /.
Theorem 23. Let G be a connected graph with maximum degree

.G/, and let
˚G D min ˚.S /:
SV .G/
Then for any vector v 2 R with 1 ? v, we have that
vt L.G/v
˚G2 2
.G/ :
vt v
q
t
Also, there exists ˇ 2 R such that ˚.S / 2
.G/ v L.G/v
vt v
, where S D V .ˇ/.
Combining the previous two results, one can deduce that the edge-expansion con-
stant of a planar graph G on n vertices is at most 4.G/
p
n
. Also, there is a polynomial
time algorithm for finding a subset S such that ˚.S / 4.G/
p
n
. By a classical result
of Lipton and Tarjan [52], it follows that the previous result is tight up to a constant
factor.
The genus of a graph G is the smallest g such that G can be embedded in a
surface of genus g without any edge crossings. Planar graphs are graphs of genus 0.
Kelner [47] extended the previous results of Spielman and Teng to graphs of
genus g.
Theorem 24. Let G be a graph with n vertices, genus g, and bounded degree. Then
g
2 .G/ O (14.23)
n
where the constant in the O-notation depends on

.G/.
Combining this result with Mihail’s theorem yields a polynomial time algorithm for
finding a subset S of a graph G of order n, genus g, and bounded maximum degree
p
such that ˚.S / O gn . Using a method described in the appendix of [59], one
p
can use this algorithm to find a bisection of size O. gn/.
372 S.M. Cioabă
These results are tight up to a constant factor as shown by the examples found by
Gilbert et al. [35]. The authors described a class of bounded degree graphs with no
p
bisection of size less than O. gn/.
Clustering is the partitioning of data into groups of similar items. A clustering
algorithm performs well if items that are similar are assigned to the same cluster
and items that are not similar are assigned in different clusters. This situation can
be modeled by a weighted graph in which the weight of an edge wij measures the
similarity between the vertices i and j .
Kannan et al. [46] suggested the following measure of the quality of a clustering
of a graph. Given a connected weighted graph G D .V; E/, a partition V D V1 [
[ Vk is called an .a; /-clustering if
˚GŒVi a (the subgraph induced by each cluster has weighted edge expansion
at least a).
P
1i <j k jE.Vi ; Vj /j jE.G/j (the weight of the intercluster edges is at
most a times the weight of the edges in G).
The following optimization problem is studied in [46]: given a, find an .a; /-
clustering that minimizes . In [46], the authors use a recursive algorithm based on
the spectral partitioning method described above to find an approximate algorithm
for the previous problem. They show that if G has an .a; /-clustering, then using

2 p
the spectral partitioning method, one can find an 72 loga2 .n=/ ; 20 log.n=/ -
clustering.
The idea of using eigenvectors for ranking goes back to Kendall [48] and
Wei [66]. Brin and Page [11] introduced the notion of PageRank in their seminal
paper on Web search. The Web pages are classified according to their importance
scores given by PageRank which are computed from the graph structure of the Web.
The PageRank importance of a Web page is determined by the PageRank impor-
tance of the Web pages linking to it.
The Web is regarded as a graph with nodes being Web pages and edges being
hyperlinks. The basic idea of PageRank is that links from important vertices should
weigh more than links from less important vertices.
Consider a connected graph G with adjacency matrix A and let D denote the
diagonal matrix containing the degrees of the vertices of G. Define W D D 1 A.
Thus, (
1
; if i j
W .i; j / D di
0; otherwise:
The matrix W can be regarded as the transition probability matrix of a random walk
of G. The stationary
on the vertices distribution of this random walk is the row
d1 dn
vector D vol.G/ ; : : : ; vol.G/ .
The PageRank vector pr.a; s/ of a graph G is the unique solution of the equation
pr.a; s/ D as C .1 a/pr.a; s/W;

where a 2 .0; 1 is a jumping constant and s is a starting vector. The PageRank

vector associated with search ranking has s D n1 1. PageRank vectors whose start-
ing vectors are concentrated on a small number of vertices are called personalized
PageRank vectors and were introduced by Haveliwala [41]. The PageRank vector
can be used to design graph partitioning algorithms (see Andersen et al. [7] and
Chung [20]).
An important problem in communication networks is the following: given a con-
nected graph G and a set of pairs of vertices .si ; ti /; 1 i r, find r edge-disjoint
paths Q1 ; : : : ; Qr , where Qi connects si to ti . In [4], Alon and Capalbo used the
connections between the edge distribution of a graph and its eigenvalues to prove
the following result.
Theorem 25. Let G be a connected d -regular graph and let D max.j2 j; jn j/.
Assume that d > 8 and let c > 0 be a constant and r WD c nd log.d=4/
log n
. Given r
pairs of vertices .si ; ti / such that no vertex of G appears more than d3 times as si
or ti , there exists a polynomial time algorithm that finds r edge-disjoint paths Qi
such that Qi joins si to ti .
The questions of finding paths of logarithmic length between each pair remains
open.
14.6 Epidemic Spreading in Networks
It is well known that graphs can be used as abstract models of various networks
that appear in computer science, biology, and sociology among others. The problem
of virus propagation has been studied in these areas and various models have been
proposed.
The susceptible–infective–susceptible (SIS) model assumes that each node of a
network (graph) can be in one of two states: healthy but susceptible (S) to infection,
or infected (I). An infected node can spread infection along the network to suscepti-
ble nodes. An infected node can be cured locally and it becomes susceptible again.
A directed edge from node i to node j means that i can infect j . A rate of infection
ˇ is associated with each edge and a virus curing rate, ı, is associated with each
infected node.
The epidemic threshold of a graph G is the value such that if ˇı < , then the
viral outbreak dies out over time and if ˇı < , then the infection survives.
Recently, Wang et al. [65] found connections between the eigenvalues of a graph
and the epidemic threshold in the SIS model.
Consider a connected network (graph) G D .V; E/. The model considered in
[65] assumes discrete time. During each time interval, an infected node i tries to
infect its neighbours with probability ˇ. At the same time, the node i can be cured
with probability ı.
Recall that 1 .G/ denotes the largest eigenvalue of the adjacency matrix of G.
The main result of [65] is the following theorem whose proof we sketch below.
374 S.M. Cioabă
1
Theorem 26. The epidemic threshold of a graph G equals 1 .G/ .
Proof. Let pi;t denote the probability that i is infected at time t and qi;t denote the
probability that i will not be infected by its neighbours at time t.
A node i is healthy at time t if
i was healthy at time t 1 and did not receive infections from its neighbours at t.
i was infected before t, cured at t, and did not receive infections from its neigh-
bours at t.
i was infected before t, received and ignored infections from its neighbours at
time t, and was cured at time t.
Assume that the probability that a curing event at node i takes place after infection
from neighbours is 50%. This means that
1
1 pi;t D .1 pi;t 1 /qi;t C ıpi;t 1qi;t C ıpi;t 1.1 qi;t /:
2
Let Pt denote the column vector .p1;t ; : : : ; pn;t /. From the previous equation, one
can obtain that
Pt D ..1 ı/In C ˇA.G// Pt 1 : (14.24)
For the infection to die off, the vector Pt should tend to zero as t gets large. This
will happen when for each i , the i -th eigenvalue of ..1 ı/In C ˇA.G//t tends to
0 as t gets large. It follows that 1 ı C ˇ1 .G/ < 1 which means that D 11.G/ .u
t
Using the previous argument, it is shown in [65] that when ˇı is below the epidemic
threshold, the number of infected nodes decays exponentially over time.
The result from [65] motivated further research. In [64], the authors studied the
problem of minimizing the spectral radius of a connected graph of order n and
diameter D. In [64], the authors solved this problem when D 2 f1; 2; n 3;
n 2; n 1g, but many questions remain open (see [63, 64] for more details).
Another model for epidemic spreading in networks is the susceptible-infective-
removed (SIR) model. Consider again a graph G with n vertices. Each vertex can be
in one of three possible states, susceptible (S), infective (I), or removed (R). Again,
we assume discrete time. We assume that the initial set of infective vertices at time
0 is nonempty, and the rest of the vertices are susceptible at time 0.
Let Xi .t/ denote the indicator that the vertex i is infected at time t and Yi .t/ the
indicator that i is removed at time t. Each vertex that is infected tries to infect each of
its neighbours; each infection attempt is successful with probability ˇ independent
of other infection attempts. Each infected node is removed at the end of the time slot.
It follows
Q that the probability that a vertex i becomes infected at the end of time t is
1 j i .1ˇXi .t//. The evolution stops when there are no more infective vertices
in the graph. One would like to know how many vertices are removed at this time.
This model was studied by Draief et al. [30] who proved the following theorem.
Theorem 27. Assume that ˇ1 .G/ < 1. Then, the total number of vertices re-
moved jY .1/j satisfies the inequality
p
njX.0/j
EŒjY .1/j ; (14.25)
1 ˇ1 .G/
where X.0/ is the number of initial infective vertices.
14.7 Eigenvalues and Other Graph Invariants
Finding the chromatic number of a graph is also a graph partitioning problem.

Among the first results connecting the eigenvalues of a graph to its chromatic and
independence number were the following theorems due to Wilf [69], Delsarte [27],
and Hoffman [42]. These are classical results with many applications in discrete
mathematics and also more recent applications in quantum computing (see [26,36]).
For extensions of these results and other applications, see Haemers [40], Nikiforov
[57], or Godsil and Newman (see [37] and [36]).
Theorem 28 ([69]). If G is a connected graph with chromatic number .G/, then
.G/ 1 C 1 .G/:
Theorem 29 ([27, 42]). If G is a connected graph of order n, then
1
.G/ 1 C :
n
If G is d -regular and ˛.G/ denotes the independence number of G, then
nn
˛.G/ :
d n
Godsil and Newman [37] have obtained similar results for graphs containing loops
and used these results to find bounds for the independence number of the Erdös–
Rényi graphs.
We note here the results of Alon et al. [5] which provide inequalities in the
opposite direction.
Theorem 30. Let G be a connected d -regular graph and let D max.j2 j; jn j/.
Then for any subset S of vertices of G, the subgraph GŒS induced by S contains
an independent set of size

n jS j.d /
˛.GŒS / ln C1 :
2.d / n. C 1/
376 S.M. Cioabă
Also, the chromatic number of G satisfies the inequality
6.d /
.G/ :

ln dC1 C1
p
For d -regular graphs with D O. d /, the previous result implies .G/ D
O.d= ln d /. As described in [5, 51], there are many graphs with this property.
As mentioned earlier, the MAX-CUT problem is an example of a graph par-
titioning problem. Alon [2] used the following result to find tight bounds for the
maximum cut of several families of graphs such as triangle-free graphs. Given a
graph G, let f .G/ denote the maximum number of edges in a bipartite subgraph of
G.
Theorem 31. If G is a d -regular graph of order n, then
n.d n /
f .G/ :
4
Alon [2] showed that if G is a triangle-free graph with e edges, then it contains
4
a bipartite subgraph with at least 2e C ce 5 edges and this result is tight up to the
constant c. This result was extended by Alon et al. in [3] who showed that graphs
r
with girth at least r 4 contain a bipartite subgraph with at least 2e C c 0 e rC1 edges
and this result is tight up to a constant factor for r D 4; 5.
Butler and Chung [17] extended previous results of Krivelevich and Sudakov [51]
and found an eigenvalue condition that implies the existence of a Hamiltonian cycle
in a graph.
Theorem 32. Let G be a connected graph with average degree d . If there exists a
positive constant C such that
.log log n/2

jd i j C d
log n.log log log n/
for i > 1 and n is sufficiently large, then G contains a Hamiltonian cycle.

Brouwer and Haemers [13] conjectured that any strongly regular graph (except
the Petersen graph) is Hamiltonian. They have verified this conjecture for graphs
with at most 99 vertices.
14.8 Conclusions
As our knowledge and technology advance, the complexity of the social, com-
munication, and biological networks surrounding us is increasing rapidly. Many
important combinatorial parameters of large networks are often hard to calculate or
approximate. Eigenvalues provide an effective and efficient tool for studying prop-
erties of large graphs which arise in practice. In this chapter, we presented some
applications of eigenvalues of graphs. Spectral graph theory is a very dynamic area
that will continue to grow. We believe that more applications and tighter connections
between graph eigenvalues and other graph invariants will be found in the future.
Acknowledgments This work is supported by a start-up grant from the Department of Mathe-
matical Sciences at the University of Delaware. The author is grateful to the referees for their
comments.
References
1. Alon N (1986) Eigenvalues and expanders. Combinatorica 6:83–96

2. Alon N (1996) Bipartite subgraphs. Combinatorica 16:301–311
3. Alon N, Bollobás B, Krivelevich M, Sudakov B (2003) Maximum cuts and judicious partitions
of graphs without short cycles. J Combin Theory B 88:329–346
4. Alon N, Capalbo M (2007) Finding disjoint paths in expanders deterministically and online.
In: FOCS, pp 518–524
5. Alon N, Krivelevich M, Sudakov B (1999) List coloring of random and pseudo-random graphs.
6. Alon N, Milman V (1985) 1 , Isoperimetric inequalities for graphs and superconcentrators. J
Combin Theory B 38:73–88
7. Andersen R, Chung F, Lang K (2006) Local graph partitioning using pagerank vectors.
In: Proceedings of the 47th annual IEEE symposium on foundation of computer science,
pp 475–486
8. Bezrukov S, Elsässer R, Monien B, Preis R, Tillich J-P (2004) New spectral lower bounds on
the bisection width of graphs. Theor Comput Sci 320:155–174
9. Bollobás B (1998) Modern graph theory. Graduate texts in mathematics, vol 184. Springer,
New York
10. Bollobás B, Nikiforov V (2004) Graphs and Hermitian matrices: eigenvalue interlacing.
11. Brin S, Page L (1998) The anatomy of a large-scale hypertextual Web search engine. Comput
Netw ISDN Syst 30:107–117
12. Brouwer A, Haemers W (2005) Eigenvalues and perfect matchings. Lin Algebra Appl
395:155–162
13. Brouwer A, Haemers W (2010) Spectra of graphs. Monograph in preparation +200pp, available
at http://homepages.cwi.nl/aeb/math/ipm.pdf
14. Brouwer A, Koolen J (2009) The vertex connectivity of a distance regular graph. Eur J Com-
binator 30:668–673
15. Brouwer A, Mesner DM (1985) The connectivity of strongly regular graphs. Eur J Combinator
6:215–216
16. Bui TN, Chaudhuri S, Leighton FT, Sipser M (1987) Graph bisection algorithms with good
average case behaviour. Combinatorica 2:171–191
17. Butler S, Chung FRK (2010) Small spectral gap in the combinatorial Laplacian implies Hamil-
tonian, Annals of Combinatorics 13(4):403–412
18. Chung FRK (1997) Spectral graph theory. American Mathematical Society, Providence, RI
19. Chung FRK (2004) Discrete isoperimetric inequalities. Surveys in differential geometry IX.
International Press, Somerville, MA, pp 53–82
20. Chung FRK (2007) Four proofs of the Cheeger inequality and graph paritition algorithms. In:
Proceedings of ICCM, vol II
378 S.M. Cioabă
21. Chung FRK (2007) Random walks and local cuts in graphs. Lin Algebra Appl 423:22–32
22. Cioabă SM (2010) Eigenvalues and edge-connectivity of regular graphs. Lin Algebra Appl
432:458–470
23. Collatz L, Sinogowitz U (1957) Spektren endlicher Grafen. Abh Math Sem Univ Hamburg
21:63–77
24. Cvetković D, Doob M, Sachs H (1980) Spectra of graphs – theory and application. Academic,
New York, 3rd edn, Johann Ambrosius Barth (1995)
25. Cvetković D, Rowlinson P, Simic S (1997) Eigenspaces of graphs. Cambridge University Press,
Cambridge
26. de Klerk E, Pasechnik DV (2007) A note on the stability of an orthogonality graph. Eur J
27. Delsarte P (1973) An algebraic approach to the association schemes of coding theory. Philips
Res Rep Suppl 10:1–97
28. Diáz J, Do N, Serna MJ, Wormald NC (2003) Bounds on the max and min bisection of random
cubic and random 4-regular graphs. Theor Comput Sci 307:531–548
29. Donath WE, Hoffman AJ (1973) Lower bounds for the partitioning of the graphs. IBM J Res
Dev 17:420–425
30. Draief M, Ganesh A, Massoulié L (2008) Threshold for virus spread on networks. Ann Appl
Probab 18(2):359–378
31. Elsässer R, Lücking T, Monien B (2003) On spectral bounds for the k-partitioning of graphs.
Theor Comput Syst 36:461–478
32. Fiedler M (1973) Algebraic connectivity of graphs. Czech Math J 23:298–305
33. Fiedler M (1975) A property of eigenvectors of non-negative symmetric matrices and its appli-
cations to graph theory. Czech Math J 85:619–633
34. Garey MR, Johnson DS, Stockmeyer L (1976) Some simplified NP-complete graph problems.
Theor Comput Sci 1:237–267
35. Gilbert J, Hutchinson J, Tarjan R (1984) A separation theorem for graphs of bounded genus. J
Algorithm 5:391–407
36. Godsil CD, Newman MW (2008) Coloring an orthogonality graph. SIAM J Discrete Math
22:683–692
37. Godsil CD, Newman MW (2008) Eigenvalue bounds for independent sets. J Combin Theory
B 98:721–734
38. Godsil CD, Royle G (2001) Algebraic graph theory. Springer, Berlin
39. Guattery S, Miller GL (1998) On the quality of spectral separators. SIAM J Matrix Anal Appl
19:701–719
40. Haemers W (1995) Interlacing eigenvalues and graphs. Lin Algebra Appl 226/228:593–616
41. Haveliwala TH (2003) Topic-sensitive PageRank: a context-sensitive ranking algorithm for
Web search. IEEE Trans Knowl Data Eng 15:784–796
42. Hoffman AJ (1970) On eigenvalues and colorings of graphs. In: Graph theory and its appli-
cations. (Proceedings of an advanced seminar, mathematical research center, University of
Wisconsin, Madison, WI, 1969). Academic, New York, pp 79–91
43. Hoffman AJ, Wielandt H (1953) The variation of the spectrum of a normal matrix. Duke Math
J 29:37–39
44. Hoory S, Linial N, Wigderson A (2006) Expander graphs and their applications. Bull AMS
43:439–561
45. Horn RA, Johnson CR (1985) Matrix analysis. Cambridge University Press, Cambridge
46. Kannan R, Vempala S, Vetta A (2004) On clusterigs: good, bad and spectral. J ACM
51:497–515
47. Kelner JA (2004) Spectral partitioning, eigenvalue bounds, and circle packings for graphs of
bounded genus. In: Proceedings of the symposium on the theory of Computing (STOC)
48. Kendall MG (1955) Further contributions to the theory of paired comparisons. Biometrics
11:43–62
49. Kirchhoff G (1847) Über die Auflösung der Gleichungen auf welche man bei der Untersuchung
der Linearen Vertheilung galvanischer Ströme geführt wird. Ann Phys Chem 72:497–508
50. Kirkland SJ, Molitierno JJ, Neumann M, Shader BL (2002) On graphs with equal algebraic
and vertex connectivity. Lin Algebra Appl 341:45–56
51. Krivelevich M, Sudakov B (2006) Pseudo-random graphs. In: More sets, graphs and numbers.
Bolyai Society Mathematical Studies, vol 15, pp 199–262
52. Lipton RJ, Tarjan RE (1979) A separator theorem for planar graphs. SIAM J Appl Math
36:177–189
53. Mihail M (1989) Conductance and convergence of Markov chains – a combinatorial treatment
of expandes. In: Proceedings of the 30th annual symposium on foundations of computer sci-
ence. IEEE Computer Society, Washington, DC, pp 526–531
54. Mohar B (1989) Isoperimetric numbers of graphs. J Combin Theory B 47:274–291
55. Mohar B (1997) Some applications of Laplace eigenvalues of graphs. In: Hahn G, Sabidussi G
(eds) Graph symmetry. Kluwer, Dordrecht, pp 225–275
56. Monien B, Preis R (2001) Upper bounds on the bisection width of 3 and 4-regular graphs.
In: Pultr A, Sgall J, Kolman P (eds) Mathematical foundations of computer science, vol 2136.
Lecture Notes in Computer Science. Springer, pp 524–536
57. Nikiforov V (2001) Some inequalities for the largest eigenvalue of a graph. Combinator Probab
Comput 11:179–189
58. Spielman D, Teng SH (1996) Spectral partitioning works: planar graphs and finite element
meshes. In: Proceedings of the 37th annual symposium on foundations of computer science,
pp 96–106
59. Spielman D, Teng SH (2007) Spectral partitioning works. Lin Algebra Appl 421:284–305
60. Tanner RM (1984) Explicit construction of concentrators from generalized N-gons. SIAM J
Algebra Discr 5:287–294
61. van Dam E, Haemers W (2003) Which graphs are determined by their spectrum? Lin Algebra
Appl 373:241–272
62. van Dam E, Haemers W (2009) Developments on spectral characterization of graphs. Discrete
Math 309:576–586
63. van Dam E, Jamakovic A, Kooij RE, Van Mieghem P (2006) Robustness of networks against
viruses: the role of spectral radius. In: Proceedings of the 13th annual symposium of the
IEEE/CVT Benelux, Liége, Belgium, pp 35–38
64. van Dam E, Kooij RE (2007) The minimal spectral radius of graphs with give diameter. Lin
Algebra Appl 423:408–419
65. Wang Y, Chakrabarti D, Wang C, Faloutsos C (2003) Epidemic spreading in real networks:
an eigenvalue viewpoint. In: Proceedings of the symposium on reliable distributed computing,
Florence, Italy, pp 25–34
66. Wei TH (1952) The algebraic foundations of ranking theory. Cambridge University Press,
London
67. West DB (2001) Introduction to graph theory, 2nd edn. Prentice Hall, Englewood Cliffs, NJ
68. Whitney H (1932) Congruent graphs and the connectivity of graphs. Am J Math 54:150–168
69. Wilf H (1967) The eigenvalues of a graph and its chromatic number. J Lond Math Soc
42:330–332
Chapter 15
Minimum Spanning Markovian Trees:
Introducing Context-Sensitivity
into the Generation of Spanning Trees
Alexander Mehler
Abstract This chapter introduces a novel class of graphs: Minimum Spanning

Markovian Trees (MSMTs). The idea behind MSMTs is to provide spanning trees
that minimize the costs of edge traversals in a Markovian manner, that is, in terms
of the path starting with the root of the tree and ending at the vertex under con-
sideration. In a second part, the chapter generalizes this class of spanning trees in
order to allow for damped Markovian effects in the course of spanning. These two
effects, (1) the sensitivity to the contexts generated by consecutive edges and (2) the
decreasing impact of more antecedent (or “weakly remembered”) vertices, are well
known in cognitive modeling [6, 10, 21, 23]. In this sense, the chapter can also be
read as an effort to introduce a graph model to support the simulation of cognitive
systems. Note that MSMTs are not to be confused with branching Markov chains
or Markov trees [20] as we focus on generating spanning trees from given weighted
undirected networks.
Keywords Markovian trees Minimum spanning trees Cohesion trees

Linguistic networks Semiotic networks
MSC2000: Primary 05C05, 68R10; Secondary 05C12, 05C38, 05C75
15.1 Introduction
According to [24] a Network Optimization Problem (NOP) is generally described as

follows. Given a weighted graph G D .V; E; / whose edges are weighted by an
edge weighting function W E ! R, the task is to find a subgraph of G that satis-
fies a set of well-defined properties by optimizing (i.e., minimizing or maximizing)
A. Mehler ()
Goethe-University Frankfurt am Main, Senckenberganlage 31,
60325 Frankfurt am Main, Germany

382 A. Mehler
a certain function of . A very prominent example of a NOP is given by Minimum

(weight) Spanning Trees (MST) that have been defined in order to derive tree-like
structures from graphs subject to edge weights as representations of costs of edge
traversal [1, 24]. Mehler [18] shows how MSTs and their relatives in the form of
Shortest Path Trees (SPT) can be used to span the kernels of so-called generalized
trees [2,3]. The idea behind this approach is to provide a model of graphs that range
from tree- to graph-like structures so that they share the efficiency of trees (in terms
of information processing) with the expressiveness of graphs. A basic outcome of
Mehler [18] is that the choice of the kernel of a generalized tree determines the
semantics of its edge types in a nontrivial manner so that we get a variety of gener-
alized trees suitable for different tasks. This raises the question of spanning trees as
alternative kernels of generalized trees beyond the well-known concepts of an MST
and an SPT.
The present chapter focuses on this question. Its starting point is Mehler [14] who
extends the notion of an MST by means of so-called Dependency Trees (DT) and
Cohesion Trees (CT). These classes of spanning trees have been further developed
by Mehler [16] by means of bipartite cohesion trees as a graph model of browsing
in the semantic web [5]. The basic principle behind these tree-like structures is to
introduce context-sensitivity into the generation of spanning trees. From the point of
view of a vertex to be processed, this context-sensitivity is induced by its candidate
predecessor (as in the case of DTs) or by the path to be continued by that vertex (as in
the case of CTs). Take, for example, the cognitive process of spreading activation in
association networks in the course of discourse comprehension [11, 23]: depending
on the starting point (i.e., as determined by the discourse already processed) the
course of spreading activation, its intensity, and its direction differ so that different
subgraphs of the association network are activated if this starting point is varied. It is
this sort of context-sensitivity that is in the focus of dependency trees and especially
of cohesion trees.
Dependency trees were originally introduced in computational linguistics to
structure (dis-)similarity relations of signs in a tree-like manner [7,12,15,22]. Gener-
ally speaking, a dependency tree is generated as follows: for a distinguished vertex r
of a graph G D .V; E; /, vertices are inserted into the dependency tree T spanned
over G starting with r in ascending order of their geodesic distance from r where
the predecessor of any vertex v 2 V to be inserted into T is chosen to be the ver-
tex w 2 V that in terms of is closest to v among all vertices already inserted
into T . Cohesion trees extend this principle of context-sensitive spanning by addi-
tionally evaluating the candidate paths to be continued by v starting with r. In this
sense, cohesion trees are more context-sensitive than dependency trees which, in
turn, are more context-sensitive than MSTs. Mehler [14] shows that DTs and CTs
are actually different from MSTs, while Mehler [15] relates these two notions to the
area of context-sensitive clustering. By distinguishing the layer of dominating topoi
on the one hand and the layer of dominated textual instances of these topoi on the
other, Mehler [16] gains an additional layer of control of spanning tree-like struc-
tures and, thus, of context-sensitivity in the generation of such trees. In Markovian
terms: while cohesion trees relate to Markovian trees in a manner to be specified
15 Minimum Spanning Markovian Trees 383
in this chapter, their bipartite extension relates to the notion of a hidden minimum
spanning Markovian tree – we leave the latter extension to future work and therefore
concentrate on MSMTs.
In this chapter we generalize the class of dependency trees and of cohesion trees
by means of minimum spanning Markovian trees. In this way, we no longer demand
that the underlying graph be a completely connected weighted graph (as has been
done by Mehler [14, 15]). We loosen this precondition and demand instead that the
underlying graph be connected. Further, we show that Markovian trees of the sort in-
troduced here are based on three types of parameters: (1) the operative notion of path
sensitivity, (2) their measure of vertex relatedness, and (3) the choice of their root.
The basic idea of MSMTs runs as follows. If in the course of spanning an MSMT
T D .V; E; r/ we have to decide where to insert a newly encountered vertex v, then
we select that vertex w as the end of the unique path P starting with the root r that
minimizes the costs of edge traversals among all candidate paths to which w might
be attached according to the topology of the graph to be spanned. Starting with its
end vertex v, suffixes of such paths P are evaluated whose length corresponds to
the Markov order of the MSMT to be generated. Thus, if the order of an MSMT is
larger than one it is always more sensitive to paths than any corresponding MST or
DT. This approach departs from dependency trees [22] and similarity trees [12] in
two respects:
1. We start with more general connected graphs.
2. We view paths as context-building units by recursively accounting for the prede-
cessor’s vertices in a Markovian manner to be specified in this chapter.
Although our basic motivation behind introducing MSMTs as a novel class of
graphs is to find alternative kernels of generalized trees, we disregard the impact
of our findings on the typing of the edges of such trees – for a first account of such
a semantics that analyzes the impact of MSTs and SPTs on the edge types of gen-
eralized trees see Mehler [18]. In contrast to this, we concentrate on the class of
MSMTs itself and leave a proof–theoretical analysis of its impact on generalized
trees to future work.
The chapter is organized as follows. Section 15.2.1 generalizes the notion of a
dependency tree in terms of so-called minimum spanning Markovian trees. Fur-
ther, Sect. 15.2.2 generalizes the notion of a cohesion tree by means of damping
Markovian transitions in MSMTs along the paths starting with the corresponding
root. Finally, Sect. 15.3 concludes, ending with a discussion of the prospects for
future work.
15.2 Context-Sensitive Spanning Trees
In order to pave the way for our graph model we start with graph-theoretical prelim-
inaries used throughout this chapter.1
1
See Mehler [18].
384 A. Mehler
Definition 1 (Preliminaries I). Let G D .V; E; LV ; LE ; / be a connected

weighted undirected graph whose vertices are uniquely labeled by the function
LV W V ! LV for the set of vertex labels LV and whose edges are uniquely labeled
by LE W E ! LE for the set of edge labels LE . Throughout this chapter we assume
that LV N0 and LE N0 ; that is, vertices and edges are labeled by ordinal
numbers and this numbering is consecutive. By V V 2 (E E 2 ) we refer
to the natural order of LV N0 (LE N0 ) such that for all a; b 2 V; a 6D b
(e; f 2 E; e 6D f ): a <V b (e <E f ) iff LV .a/ < LV .b/ (LE .e/ < LE .f /).
This allows us to define the order relation
a D V [ E
on the set of vertices and edges. Without loss of generality we assume that W E !
RC n f0g is an edge weighting function that represents costs of traversing edges
in E. Think of , e.g., as a function of the loss of coherence induced by following
hyperlinks. Now let P.G/ be the set of all simple paths in G and
P D .vi0 ; ej1 ; vi1 ; : : : ; vim1 ; ejm ; vim / 2 P.G/
a simple path such that 81 k m W ejk D fvik1 ; vik g 2 E. Then,
V .P / D fvi0 ; vi1 ; : : : ; vim1 ; vim g V
is the set of all vertices,
E.P / D fej1 ; : : : ; ejm g E
the set of all edges, and

VE.P / D V .P / [ E.P /
the set of all constituents of P . Further, Vend .P / D fvi0 ; vim g is the set of both end
vertices and Vin .P / D V .P / n Vend .P / the set of all inner vertices of P . Next, by
ŒPvi0 vim p D .vi0 ; ej1 ; vi1 ; : : : ; vimp1 ; ejmp ; vimp / 2 P.G/;
p m, we denote the prefix of P that consists of m p C 1 vertices. Note that if

G is a tree then for each v; w 2 V the simple path ending at v and w is unique. Such
paths are denoted as Pvw indexed by their end vertices v and w. Now we can define
the order relation
6a P.G/2
on the set of paths P.G/ of G such that for P D .vi1 ; ei2 ; : : : ; eimi 1 ; vimi / 2 P.G/
and P 0 D .vj1 ; ej2 ; : : : ; ejmj 1 ; vjmj / 2 P.G/, P 6D P 0 : P 6a P 0 iff 9r <
min.mi ; mj /8k 2 f1; : : : ; rg WVE.P / 3 xik D xjk 2 VE.P 0 / ^ VE.P / 3 xirC1 <a
xjrC1 2 VE.P 0 /. Further, by PG .v; w/ we denote the set of all simple paths in G
ending at v and w. Finally, for vimi D vj1 we define the concatenation
P ı P 0 D .vi1 ; ei2 ; : : : ; eimi 1 ; vimi ; ej2 ; : : : ; ejmj 1 ; vjmj /
of P and P 0 .
We need to define order relations on the sets of vertices, edges, and paths in
order to account for the redundancy that is omnipresent in semiotic systems. In
graph-theoretical terms, this redundancy is manifested by multiple edges so that the
shortest path between two vertices, for example, is not necessarily unique in a graph
corresponding to a semiotic system. Think of a graph with exactly two vertices
and n 1 multiple edges ending at these vertices each of the same weight. In
this case we have n different MSTs so that we have to decide which one to use if
uniqueness is required. This is exactly the task of the order relations specified by
Definition 1. Next, we introduce further preliminaries that repeat some other well-
known concepts of graph theory:
Definition 2 (Preliminaries II). Let G D .V , E, LV , LE , / be a weighted con-

nected graph according to Definition 1. Then, we extend as a function of P.G/,
that is,
W P.G/ ! .0; 1/
such that for each P D .vi0 ; ej1 ; vi1 ; : : : ; vim1 ; ejm ; vim / 2 P.G/ we set
m
X
.P / D .ejk /
kD1
Based on we define the geodesic path GP .v; w/ between v and w in G as

( )
GP .v; w/ D inf arg min .P /
6a P 2PG .v;w/
Next, the geodesic distance O W V V ! Œ0; 1/ between v; w 2 V is defined as

0 vDw
O w/ D
.v;
.GP .v; w// v D
6 w
Finally, for any weighted graph G D .V; E; / we define

X
.G/ D .e/
e2E
Remark 1. In order to prevent negative cycles [24, p. 85] we henceforth assume that
is a function from E to RC n f0g. Further, throughout this chapter we only deal
386 A. Mehler
with finite graphs. Finally, in order to keep the formalization simple we concentrate
on undirected graphs and therefore disregard their directed orientations.
Remark 2. Throughout this chapter we always assume the existence of the order
relation 6a as introduced by Definition 1 without explicitly noting this in the sub-
sequent definitions of graphs. The reason for this omission is to keep the formalism
simple.
We start with developing our formal apparatus for the class of connected labeled
weighted undirected graphs.
Definition 3 (Spanning Pattern). Let G D .V; E; LV ; LE ; / be an undirected
graph according to Definition 1. Let further x 2 V be a distinguished vertex of G
and
˝x D fx g [ fPxy j y 2 V n fxgg
be a set – called a spanning pattern on G – such that for each y 2 V nfxg: Pxy is a
well-ordering on the set of neighbors NG .y/ of y in G that is conditioned (according
to Line 14 of Algorithm 15.1) by the subset Pxy P.G/ of paths ending at x and
y, respectively. Further, x is a well-ordering on V with infimum
x D inf V
x
such that for each v; w 2 V n fxg:
v x w ,
O
.x; O
v/ < .x; w/ _ ..x;
O v/ D .x;
O w/ ^ LV .v/ < LV .w// _ v D w
We write v <x w to denote that v 6D w ^ v x w. Analogously, we write v <Pxy w

to denote that v 6D w ^ v Pxy w.
Definition 4 (Spanning Pattern-Based Subgraph). Let ˝x be a spanning pat-
tern for a distinguished vertex x of a graph G D .V; E; LV ; LE ; / that is defined
according to Definition 3. Then, the graph
span.G; x; ˝x / D .V 0 ; E 0 ; L0V ; L0E ; x; 0 /
computed by Algorithm 15.1 is called a spanning pattern-based subgraph of G

subject to ˝x .
Theorem 1. For any Vi , 1 < i < jV j, and any vertex w 2 V selected according to
Lines 13 and 14 of Algorithm 15.1 it always holds that NG .w/ \ Vi 6D ;.
Proof. Obviously, 8v 2 Vi W v x w. Further, according to Lines 12–24 of
Algorithm 15.1 there is no y 2 V nVi , y 6D w, such that y x w. Thus, there exists a
path Pxu 2 P.G/ such that V .Pxu / Vi , fu; wg 2 E so that NG .w/ \ Vi 6D ;. Oth-
erwise w D infx V n Vi would not hold according to the definition of the geodesic
O
distance . t
u
Require: A graph G D .V; E; LV ; LE ; / and a spanning pattern ˝x for a

distinguished vertex x 2 V according to Definition 3.
Ensure: span.G; x; ˝x / D .V 0 ; E 0 ; L0V ; L0E ; x; 0/ according to Definition 4.
1: procedure PATTERN BASED S UBGRAPH(G; x; ˝x)
2: for y D infx V n fxg do
3: ej1 fx; yg 2 E
4: V2 fx; yg
5: E2 fej1 g
6: LV2 LjV2
7: L E2 LjE2
8: 2 jE2
9: G2 .V2 ; E2 ; LV2 ; LE2 ; 2 /
10: end for
11: for 1 < i < jV j do
12: if w D infx V n Vi then
13: Pxw fPxw 2 P.G/ j Vin .Pxw / n fwg Vi ^ Vend .ŒPxw 1 / \
NG .w/ 6D ;g B the path context of w in G constrained by Vi
14: if v D infPxw NG .w/ \ Vi then
15: eji fv; wg
16: ViC1 Vi [ fwg
17: EiC1 Ei [ feji g
18: LVi C1 LjVi C1
19: LEi C1 LjEi C1
20: iC1 jEi C1
21: GiC1 .ViC1 ; EiC1 ; LVi C1 ; LEi C1 ; iC1 /
22: end if
23: end if
24: end for
25: for Gn D .Vn ; En ; LVn ; LEn ; n /; n D jV j do
26: V0 Vn D V ^ E 0 En ^ L0V LVn ^ L0E L En ^ 0 n
27: end for
28: return span.G; x; ˝x /
29: end procedure
Algorithm 15.1: Computing spanning pattern-based subgraphs
Theorem 2. For any graph G D .V; E; LV ; LE ; / and any ˝x D fx g [ fPxy

j y 2 V n fxgg, both defined according to Definition 3 and any 1 < i <
jV j, the graph Gi C1 D .Vi C1 ; Ei C1 ; LVi C1 ; LEi C1 ; i C1 / generated according to
Algorithm 15.1, Line 21 is a tree.
Proof. In order to prove this theorem we need to show that Gi C1 D .Vi C1 ; Ei C1 ;

LVi C1 ; LEi C1 ; i C1 / is connected and has jEi C1 j D i edges where jVi C1 j D
i C 1 [4, 9]. These two properties follow directly from the greedy nature of Algo-
rithm 15.1. Firstly, connectedness follows from the fact that Lines 12 and 14 select
– by analogy to Prim’s algorithm – exactly one vertex of V n Vi and exactly one
vertex of Vi in order to connect them. Thus, each iteration of the for loop (Line 11)
generates exactly one edge to connect one more vertex where initially (see Lines
2–10 of Algorithm 15.1) G2 is of order 2 with a single edge. Thus, jEi C1 j D i . ut
388 A. Mehler
Remark 3. Because of its prominent role in determining the spanning pattern ˝x as

the starting point for spanning the tree span.G; x; ˝x / D .V 0 ; E 0 ; L0V ; L0E ; x; 0 /,
the vertex x is used as the distinguished root vertex of this tree.
Remark 4. Theorem 2 tells us something about the type of output generated by

Algorithm 15.1 in spite of the fact that the relations Pxw are not yet fully defined
beyond the claim that they are well-orderings on the set of vertices. Thus, in con-
junction with Theorem 2, Definition 4 provides a scheme based on the spanning
pattern ˝x as the scheme-building variable that allows us to derive different types
of trees whose gestalt can only be fully determined if the latter variable is instanti-
ated. From that point of view, the present chapter introduces a certain instantiation
of a spanning pattern that defines MSMTs.
The following corollary follows directly from Theorem 2.
Corollary 1. span.G; x; ˝x / D Gn D .Vn ; En ; LVn ; LEn ; n /, n D jV j, is a tree.
More important is the following corollary. It includes a statement about the path
context of a vertex to be inserted at some iteration of the for loop (see Line 11) of
Algorithm 15.1. Obviously, this corollary follows from the fact that all graphs Gi C1
generated by this algorithm are trees.
Corollary 2. For each neighbor v 2 NG .w/ of vertex w identified according to

Lines 13 and 14 of Algorithm 15.1 the path context Pxw of w in G constrained by
Vi contains exactly one path Pxw 2 Pxw such that Vend .ŒPxw 1 / D fx; vg.
Remark 5. We can think of Algorithm 15.1 as a model of a construction–integration

process based on priming relations in an association network in the sense of
Kintsch [10].
1. Construction: The order relation x maps the construction phase. It defines the
initial selection of all vertices w 2 V to be inserted into the tree to be inte-
grated. The smaller the geodesic distance of w to the root-forming vertex x
of span.G; x; ˝x /, the earlier this vertex is processed. To recapitulate this in
semiotic terms: x models priming relations induced when using x as a prime.
Starting with x, this priming does not evolve chaotically but according to an order
determined by the geodesic distances of the primed vertices to x in the underlying
association network: units that are closer to x in this network are primed earlier
and are, therefore, processed faster within the subsequent integration phase. x
maps this order that determines the “time” at which vertices are inserted into the
tree to be spanned.
2. Integration: Order relations of the type Pxw provide orderings of the neigh-
borhoods NG .w/ of vertices w to be integrated into the output graph so that a
tree-like structure emerges. To recapitulate this in semiotic terms: Pxw models
effects of context priming as induced by the path to which w is attached. That
is, w is attached to the end vertex of a path to which it fits best in terms of the
operative association relations of the underlying association network. Context
effects of this sort are not mapped by x but by Pxw . To which degree this
context effect takes place is specified by the Markovian order of the MSMT to
be introduced as a special sort of spanning pattern-based subgraph.
In a nutshell: the spanning pattern ˝x models a sort of context-sensitivity as
exemplified by priming relations and addresses certain aspects of structure forma-
tion based thereon.
One objection to this semiotic interpretation might be that tree-like structures do

not adequately model the kind of structure formation based on priming relations
and that general graphs provide more adequate models. Actually, we respond to
this objection by pointing to the aim of introducing tree-like kernels of generalized
trees that because of their expressiveness can do exactly this: mapping graph-like
structures.
Remark 6. x is defined by means of the geodesic distance O since we do not

deal with completely connected graphs (as this has been done by Mehler [14]), but
more generally with connected graphs. Therefore, we need to leave the grounds of
Euclidean spaces and related geometric conceptions of semantic spaces in order to
enter the area of weighted, possibly sparse but connected graphs.
15.2.1 Minimum Spanning Markovian Trees
A class of spanning trees that can be derived by instantiating the spanning pat-
tern of Definition 3 is given by Minimum Spanning Markovian Trees (MSMT).
The idea behind this notion is to generalize the concept of (minimum spanning)
Dependency Trees (DT) [14]. This concept has been defined in order to include
context-sensitivity into the generation of spanning trees that goes beyond minimiz-
ing the weights of edges selected to generate Minimum Spanning Trees (MST) [24].
MSMTs are context-sensitive as they condition this selection to the paths generated
by the greedy Algorithm 15.1. MSMTs are formally introduced by the Definitions
5–7.
Definition 5 (Degree of Markovian Connectivity). Let G D .V; E; LV ; LE ; /

be a graph, x 2 V a distinguished vertex, and x defined according to Definition 3.
Let further m 2 N n f0g. Then, for each y 2 V n fxg and
Pxy D Pvi0 vit C1 D .vi0 ; ej1 ; vi1 ; : : : ; vit ; ejt C1 ; vit C1 / 2 P.G/;
vi0 D x, vit C1 D y, ejk D fvik1 ; vik g 2 E, k 2 f1; : : : ; t C 1g, the degree of end
vertex connectivity cm .Pxy / of y to Pxy of order m is defined as:
t C1
X
cm .Pxy / D .ejk /
kDmax.1;.t C1/mC1/
390 A. Mehler
Based on this notion we define the degree of Markovian connectivity of order m

of y as an end vertex of Pxy D Pvi0 vit C1 as:

C Xt C1 D vit C1 j Xt D vit ; Xt 1 D vit 1 ; : : : ; X0 D vi0

D C Xt C1 D vit C1 j Xt D vit ; : : : ; Xt mC1 D vit mC1

D C Xt C1 D y j Xt D vit ; : : : ; Xt mC1 D vit mC1
cm .Pxy /
Remark 7. As the Markovian connectivity of a vertex y can be evaluated with

respect to paths Pxy of varying length the lower bound of the sum in the defini-
tion of cm .Pxy / is specified by means of max. This provides the flexibility to deal
with paths of variable length. Note further that in order to evaluate the Markovian
connectivity of order m of an end vertex of a path we have to evaluate m edges.
Obviously, the Markovian connectivity of order t C 1 of y to Pxy D Pvi0 vit C1

equals .Pvi0 vit C1 /. Further, for any m > t C 1 it holds that cm .Pxy / D ct C1 .Pxy /.
Note that the notion of Markovian connectivity is reminiscent of the notion of a
Markov process of order m. However, Definition 5 does not deal with probabil-
ities but, more generally, with weighted edges of a graph defined according to
Definition 3. These weights do not necessarily denote probabilities. They may also
represent membership degrees of a fuzzy relation represented as a graph. This gen-
eralization helps bridging the notion of a Markov process on the one hand and that
of a spanning tree on the other as becomes clear in the following pages.
In order to instantiate the schema of spanning trees introduced by Definition 4
we need to find appropriate instances of the well-orderings Pxy mentioned in
Definition 3 (of spanning patterns) and also used in Algorithm 15.1. Appropriate
means that the instantiation of these order relations has to be related to the notion of
Markovian connectivity as defined above. This is done by means of the notion of a
Markovian neighborhood ordering.
Definition 6 (Markovian Neighborhood Ordering). Let G D .V; E; LV ;

LE ; /, be a graph according to Definition 3. Let further x; y 2 V and Pxy
be a subset of paths ending at x and y where for each v 2 NG .y/ there is at
most one path P .v/ 2 Pxy such that v is an end vertex of ŒP .v/1 . Further, let
NG0 .y/ NG .y/ be the subset of all neighbors of y for which the latter condition
holds. For any w 2 NG0 .y/ we write
ŒP .w/1 D .viw0 ; ewj1 ; viw1 ; : : : ; viwt 1 ; ejwt ; viwt /; viw0 D x; viwt D w
in order to denote this unique path. Now, let m 2 Nnf0g. Then, for each y 2 V nfxg
and each v; w 2 NG .y/ we define the relation
Œm
Pxy .NG .y//
2
such that
8
ˆ
ˆ v; w 2 NG0 .y/ ^
ˆ
ˆ
ˆ
ˆ C.Xt C1 D y j Xt D vivt ; : : : ; Xt mC1 D vivt mC1 / <
ˆ
ˆ
ˆ
ˆ C.Xt C1 D y j Xt D viwt ; : : : ; Xt mC1 D viwt mC1 /
ˆ
ˆ
ˆ
ˆ _ v; w 2 NG0 .y/ ^
ˆ
ˆ
<
C.Xt C1 D y j Xt D vivt ; : : : ; Xt mC1 D vivt mC1 / D
v Œm
Pxy w,
ˆ
ˆ C.Xt C1 D y j Xt D viwt ; : : : ; Xt mC1 D viwt mC1 / ^
ˆ
ˆ
ˆ
ˆ LV .v/ <V LV .w/
ˆ
ˆ
ˆ
ˆ
ˆ
ˆ _ v 2 NG0 .y/ ^ w 62 NG0 .y/
ˆ
ˆ
ˆ _ v; w 62 NG0 .y/ ^ LV .v/ <V LV .w/
:̂
_vDw
Œm
Pxy is called Markovian neighborhood ordering of order m of NG .y/ constrained
by Pxy .
Theorem 3. For any x; y 2 V and m 2 N n f0g, Œm

Pxy is a well-ordering on NG .y/.
Proof. We notice that for any v; w 2 NG .y/ the conditions enumerated by the
disjunction in Definition 6 are exhaustive and mutually exclusive so that Œm
Pxy is a
Œm
total relation on NG .y/. Further, we easily verify that Pxy is reflexive – if v D w,
antisymmetric – if, e.g., v; w 2 NG0 .y/, then always either C.Xt C1 D y j Xt D
vivt ; : : : ; Xt mC1 D vivt mC1 / < C.Xt C1 D y j Xt D viwt ; : : : ; Xt mC1 D
viwt mC1 / or LV .v/ <V LV .w/ – and transitive (since D, <, and <V are
transitive). t
u
Note that the set Pxy in Definition 6 is defined by analogy to its counterpart with
the same name in Definition 3. This correspondence is the starting point of bridging
the notion of a Markovian neighborhood in a graph with that of a spanning tree.
Definition 7 (Minimum Spanning Markovian Tree). Let G D .V; E; LV ;

Œm Œm
LE ; / be a graph according to Definition 3 and ˝x D fx g [ fPxy j y 2
V n fxgg be a spanning pattern based on the Markovian neighborhood orderings
Œm
Pxy of order m 2 N n f0g for a distinguished vertex x. Then,

G ˝xŒm D span G; x; ˝xŒm
is called a Minimum Spanning Markovian Tree (MSMT) of order m spanned over G

by means of ˝xŒm starting with x.
Remark 8. Note that the expression G.˝xŒm / D span.G; x; ˝xŒm / means that
G.˝xŒm / is generated by Algorithm 15.1 where the input parameter ˝x is instanti-
ated by ˝xŒm , that is, ˝x ˝xŒm .
392 A. Mehler
Corollary 3. Because of Theorem 2 it readily follows that under the conditions of

Definition 7, G.˝xŒm / is a (spanning) tree (of G).
Now, we prepare a theorem that shows in which sense the attribute minimum is
appropriately added to the name of an MSMT.
Definition 8 (Costs of Trailing in a Weighted Rooted Tree). Let T D .V;

E 0 ; L0V ; L0E ; x; 0 / be a weighted rooted tree and m 2 N n f0g. The costs cxŒm .T /
of trailing in T induced by x are defined as
X
cxŒm .T / D cm .Pxv .T //
v2V
where Pxv .T / is the unique simple path in T ending at root x and vertex v.
Remark 9. In the case where T in Definition 8 is an MSMT of a corresponding

graph, the notion of trailing costs includes two central ingredients:
Firstly, the vertex x from whose perspective the tree is trailed and which deter-
mines the order of vertices being processed according to their geodesic distance
O x/ to x,
.v;
Œm
Secondly, the degree m of Markovian connectivity that affects cx .T / by speci-
fying the length of the suffix of Pxv that is taken into consideration.
In this way, Definition 8 reflects both perspectives: (1) the one induced by the root
of the MSMT to be spanned and (2) the one induced by the path to which vertices
are attached when instantiating the input parameter ˝x of Algorithm 15.1 by ˝xŒm .
Obviously, this concept of costs departs from its classical counterpart in terms of
minimum spanning trees as it introduces the sort of context sensitivity induced by
both perspectives.
The way in which MSMTs actually minimize costs is now specified by proving
the following theorem.
Theorem 4. Let G D .V; E; LV ; LE ; / be a graph according to Definition 3,

x 2 V a distinguished vertex of G, and m 2 N n f0g. Let T be any spanning tree of
G such that
8w 2 V 9ŠPxw 2 P.T /8v 2 Vin .Pxw / W v x w
In this case the following inequality holds:
cxŒm .T / cxŒm .G.˝xŒm //
Proof. Let G D .V; E; LV ; LE ; / be a graph according to Definition 3, x 2 V a

distinguished vertex of G, m 2 N n f0g, and G.˝xŒm / D .V; E 0 ; L0V ; L0E ; x; 0 / be
the MSMT of order m spanned over G by means of ˝xŒm starting with x. Let further
T D .V; E 00 ; L00V ; L00E ; x; 00 / be a spanning tree of G rooted in the same vertex x
and assume that

cxŒm .T / < cxŒm G ˝xŒm
Without loss of generality we consider the sum

X
cm .Pxvik .T //
vi1 ;:::;vijV j
such that x D vi1 x x vijV j (as we deal with sums we can always arrange
vertices in this order). Suppose now that j , 1 < j jV j, is the smallest index such
that
cm .Pxvij .T // < cm Pxvij G ˝xŒm
Then, according to the precondition of Theorem 4 we state, firstly, that for each
u 2 Vin .Pxvij .T // W u x vij . Secondly, we observe that there have to be two
vertices v 6D w such that v x vij , w x vij , fv; vij g 2 E 00 , fw; vij g 2 E 0 ,
fv; vij g 2 E; and fw; vij g 2 E. That is, we are in a situation that looks as follows
where dashed lines denote paths:2
k v

‹

x_ _ _u vi j
*
? ‹
S
w
This situation is obviously in contradiction to the principle of computing G.˝xŒm /

since in this case v <Œm
Pxv w (note that v 6D w). t
u
ij
Corollary 4. Among all candidate spanning trees of a graph G defined according

to Definition 3 rooted in the vertex x, the MSMT rooted in that vertex is of minimal
costs of trailing starting with x.
This is a simple consequence of the proof of Theorem 4.
Remark 10. Note that we did not define the trailing cost cxŒm .T / of a spanning tree
T D .V; E 0 ; L0V ; L0E ; x; 0 / of G D .V; E; LV ; LE ; / as
X
cxŒm .T / D 0 .x; v/ C cm .Pxv .T //
v2V
2 Œm
Note that Pxvij .T / and Pxvij .G.˝x // may have a common subpath ending at x and u.
394 A. Mehler
_ W P
n g H
v @
~
:
j v 5

e ‹ 2
1

x _ _ _u
‹
vij vij Cp
*
? f ‹
T
w
Fig. 15.1 A scenario in which vertex vij has three candidates to which it might be attached: vertex
v, w, and vij Cp
That is we assume that minimum spanning Markovian trees do not minimize this
sum. Why? Look at Fig. 15.1 which extends the diagram of the preceding proof.
Suppose that although
Œm
w <Pxv v
ij
we get the following inequality of the corresponding geodesic distances
O 0 .x; v/ < O 0 .x; w/
a situation that might easily occur. In this case we can generate a spanning tree by
selecting the edge e D fv; vij g while skipping the edge f D fw; vij g under the
condition that
O 0 .x; w/ O 0 .x; v/ cm .Px::vvij / cm .Px::wvij /
where Px::wvij D GP .x; w/ ı .w; f; vij / and Px::vvij D GP .x; v/ ı .v; e; vij /.
For m 1 such a situation may easily occur. In this case, the corresponding MSMT
Pselect the edge e and skip the edge f – in contrast to what is expected if the
would
sum v O 0 .x; v/ has to be minimized too. That is, MSMTs are Markovian in a real
sense as they look back to a degree specified by their order P
without simultaneously
optimizing a look ahead as implied by minimizing the sum v2V O 0 .x; v/.
Remark 11. Note that in Theorem 4 we demand that v x w for all v 2

Vin .Pxw /; Pxw 2 P.T /; w 2 V . The reason to concentrate on the inner vertices
of this sort is to prevent us from considering paths that lead away from the root
vertex x. Look again at Fig. 15.1 and suppose that there is a vertex vij Cp 6D vij
such that vij x vij Cp . When considering candidate vertices to which vij should
be attached, the vertex vij Cp is ruled out as a candidate even if
vij Cp <Œm
Pxv v ^ vij Cp <Œm
Pxv w
ij ij
Although attaching vij to vij Cp may induce lower trailing costs, we face the risk of
generating a disconnected graph when selecting fvij ; vij Cp g instead of fw; vij g – in
contrast to the aim of finding a spanning tree.
These remarks may help to explain what exactly MSMTs minimize. The answer
is: the degree of Markovian connectivity of paths subject to the processing order of
the vertices as a function of their geodesic distance to the root of the MSMT. As
mentioned above this notion is reminiscent of the construction–integration theory
of discourse comprehension [10].
jV j.jV j1/
Corollary 5. Let G D .V; E; LV ; LE ; /, jEj D 2 , be a completely con-
nected weighted graph. Let further
n o
˝xŒ1 D fx g [ Œ1
Pxy j y 2 V n fxg
a spanning pattern according to Definition 3 based on the Markovian neighborhood

orderings Œ1 Œ1
Pxy of order 1. Then, the MSMT G.˝x / of order 1 spanned over G
by means of ˝xŒ1 starting with x is a dependency tree spanned over G according to
Mehler [14].
This corollary simply follows from the fact that dependency trees as formalized
by Mehler [14] are just MSMTs of minimal order 1 based on completely connected
graphs. Thus, MSMTs are generalizations of the class of simpler dependency trees
and similarity trees in these two respects. MSMTs are more general than dependency
trees as they cover Markovian neighborhoods of vertices beyond their immediate
neighborhood. This introduces a sort of Markovian memory of edge traversals or
a corresponding sort of transitivity whose scope is determined by the order of the
MSMT. To put it more strikingly: Where you are going (in the sense of which vertex
is used to continue a given path) depends on where you are from (in the sense of
which vertices precede that vertex in the path). Markovian spanning trees model
exactly this kind of dependency of a vertex on its antecedent path where the higher
the Markovian order of the MSMT, the longer the antecedent path on which this
vertex is dependent. Finally, we present an estimation of the time complexity of
generating instances of this class of spanning trees.
Theorem 5. The time complexity to compute an MSMT of a given order m spanned

over a sparse graph in which the average number of neighbors of vertices grows in
a logarithmic manner is on the order of O.jV j log jV j/.
Proof. We refer to Algorithm 15.1 and suppose that we deal with sparse graphs as
given by complex semiotic networks [17]. Thus, we assume that jEj
jV j2 . Then,
we have to firstly compute the order relation x . This can be done by a breadth-first
search that is on the order of O.jV j C jEj/. Having specified the order of vertices to
be processed we have to repeat the for loop (see Line 11) jV j 2 times. In this case
we assume that every vertex in y 2 V is assigned a vector v with m dimensions
396 A. Mehler
so that whenever we build an edge fv; wg; v 2 Vi ; w D infx V n Vi (Line 15)

we set
wŒ1 D .fv; wg/

wŒ2 D vŒ1 C .fv; wg/
:::
wŒm D vŒm 1 C .fv; wg/
That is, by means of wŒm 1 we can check the connectivity of a vertex y to be

attached to w by simply computing fw; yg C wŒm 1. In this way, we put in
memory the degrees of Markovian connectivity per inserted vertex so that we do
not need to recompute them by going back over the path ending at w.3 As the latter
operation neither depends on jV j nor on jEj its time complexity is constant (it does
not grow with jV j or jEj). Using this format of representing degrees of Markovian
connectivity we have to check in the worst case the Œm1 entry of jV2 j many vertices
so that we can estimate the time complexity of computing an MSMT of order m by

jV j
O jV j C jEj C .jV j 2/ D O.jV j2 /
2
This complexity can be reduced by arranging the values vŒm 1 in a way that
enables efficient searches in the order of a complexity smaller than jV2 j . Another
way of seeing how this complexity is reduced is by assuming that we deal with
sparse graphs in which the average number of neighbors of vertices grows with jV j
in a logarithmic manner. In this case the complexity of computing an MSMT of
order m is reduced to
O.jV j C jEj C .jV j 2/ log jV j/ D O.jV j log jV j/

t
u
15.2.2 Damped Markovian Trees
Mehler [14] has introduced an extension of dependency trees that maps weakly
transitive distance effects in spanning trees of the sort of Markovian trees. Here,
the attribute weakly transitive denotes the effect of a damped impact of preceding
vertices as a function of their geodesic distance to the end vertex of the path to
be processed. Trees spanned by means of this principle have been called Cohesion
Trees (CT) in order to recall the linguistic notion of cohesive ties [8, 13] that in the
present case are manifested by interlinked vertices of a graph. The idea was to relax
3
Note that we use a C++-like notation in order to denote accesses to vectors.
the Markovian dependence on mediately linked vertices as a function of their dis-

tance in the corresponding path. According to the notion of cohesion, the cohesive
force of cohesive ties is indeed a decreasing function of their distance in discourse
– it is this effect that we want to model by means of damped minimum spanning
Markovian trees. From a semiotic point of view this approach is self-explanatory as
it is known that processes of spreading activation decay with the distance they cover
in the corresponding network. In this section we generalize the notion of a minimum
spanning Markovian tree by means of the notion of decaying degrees of Markovian
connectivity. This is done as follows.
Definition 9 (Damped Degree of Markovian Connectivity). Let G D .V; E; LV ;

LE ; / be a graph, x 2 V a distinguished vertex, and x be defined according to
Definition 3. Further, let m 2 N n f0g and d W f1; : : : ; mg ! Œ0; 1 be a function.
Then, for each y 2 V n fxg and
Pxy D Pvi0 vit C1 D .vi0 ; ej1 ; vi1 ; : : : ; vit ; ejt C1 ; vit C1 / 2 P.G/;
vi0 D x, vit C1 D y, ejk D fvik1 ; vik g 2 E, k 2 f1; : : : ; t C 1g, the damped degree
of end vertex connectivity cOm .Pxy / of y to Pxy of order m is defined as:
t C1
X
cOm .Pxy ; y/ D d.t C 1 k C 1/ .ejk /
kDmax.1;.t C1/mC1/
We call d a damping function. Based on this notion we define the damped degree of
Markovian connectivity of order m of y as an end vertex of Pxy D Pvi0 vit C1 as:

CO Xt C1 D vit C1 j Xt D vit ; Xt 1 D vit 1 ; : : : ; X0 D vi0

D CO Xt C1 D vit C1 j Xt D vit ; : : : ; Xt mC1 D vit mC1

D CO Xt C1 D y j Xt D vit ; : : : ; Xt mC1 D vit mC1
cOm .Pxy /
Figure 15.2 exemplifies candidate functions of d . They range from constant func-
tions (Case A) to functions decaying in a logarithmic manner (Case F). Note that
Fig. 15.2 does not show real cases, but simplifies the presentation in order to hint at
prototypical cases:
1. Case A shows a constant function d of m that because of mapping each de-

gree n m onto 1 leads to degrees of Markovian connectivity according to
Definition 5.
2. Case B exemplifies a function that apart from the first vertex (as the immediate
predecessor of the end vertex of the path under consideration) damps all other
vertices down to zero. This kind of damping leads to degrees of Markovian con-
nectivity in the line of MSMTs of order 1.
398 A. Mehler
Fig. 15.2 Six prototypical instances of the damping function d (see Definition 9)
3. Case C varies the latter case by considering damping ratios smaller than 1.
Obviously, it damps vertices in the manner of a step function.
4. Case D shows a function that demonstrates, so to speak, an exponential growth
of the degree by which more distant units are damped. In other words: Case D
valuates the importance of more distant units in a way that decays exponentially.
Thus, the connectivity of a distant vertex (i.e., if k 1; k 2 f1; : : : ; mg) to its
predecessor and successor nodes in a path has a much smaller effect than the
one of a closer vertex (i.e., if k
m) even in the case of identical connectivity
values. In this case, larger distances to closer vertices count more than those to
more distant vertices. Functions of this sort model an effect of a declining impact
as a function of the distance of vertices in a path.
5. Case E demonstrates a reversed S -shaped function for which less distant vertices
are damped to a much lower degree than more distant ones. That is, in this case
we observe a transition from a concave to a convex part of the damping function.
6. Finally, Case F demonstrates a concave function that slowly decays the damping
effect for growing distances.
Which function d should be preferred depends on the application area. In the
present case we might argue that impact decays by analogy to similarity by an ex-
ponential function of distance (see [6]) so that Case D would be preferred. In the
area of Web mining this is confirmed by the so-called link-content conjecture of
Menczer [19] who states that the content of a page is similar to the one of the pages
that link to it. Menczer [19] presents data in support of this conjecture that point at an
exponential decay of this similarity induced by following hyperlinks between pages.
So when modeling trails in the Web by means of MSMTs one should prefer this sort
of exponential damping in order to account for the decay of similarity of mediately
linked documents. From this semiotic perspective the values d.k/; k 2 f1; : : : ; mg,
may also be viewed as degrees of salience (see Table 15.1) that decays as a func-
tion of the distance to the topical vertex. However, other applications may decide
differently. In any case, Definition 9 is general enough to map a wide range of in-
stantiations of the damping function d .
Table 15.1 Three classes of spanning trees in relation to MSTs from the
point of view of context-sensitivity
Level Graph model Support of context
0 MST ;
1 MSMT-1 Root, predecessor
2 MSMT-m, m > 1 Root, path of length m
3 DMSMT Root, path of length m, degree of salience
The next step of defining damped minimum spanning Markovian trees is to

utilize damped degrees of Markovian connectivity in the definition of Markovian
neighborhood orderings.
Definition 10 (Damped Markovian Neighborhood Ordering). Let G D
.V; E; LV ; LE ; /, x; y 2 V , Pxy , NG0 .y/, ŒP .v/1 and m all defined as in
Definition 6. Then, for each y 2 V n fxg and v; w 2 NG .y/ we define
Œm;d
Pxy .NG .y//
2
such that
8
ˆ
ˆ v; w 2 NG0 .y/ ^ cOm .Px::vy / < cOm .Px::wy /
ˆ
ˆ
ˆ
< _ v; w 2 NG0 .y/ ^ cOm .Px::vy / D cOm .Px::wy /^LV .v/ <V LV .w/
v Œm;d
Pxy w , _ v 2 NG0 .y/ ^ w 62 NG0 .y/
ˆ
ˆ
ˆ 0
ˆ _ v; w 62 NG .y/ ^ LV .v/ <V LV .w/
:̂ _ v D w
where Px::vy D GP .x; v/ ı .v; fv; yg; y/ and Px::wy D GP .x; w/ ı .w; fw; yg; y/.
Œm;d
Pxy is called the damped Markovian neighborhood ordering of order m of NG .y/
constrained by Pxy .
According to Definitions 3 and 4 we need to show that the relations Œm;d

Pxy are
well-orderings.
Corollary 6. For any x; y 2 V , m 2 N n f0g, and any damping function d W
f1; : : : ; mg ! Œ0; 1, Œm;d
Pxy is a well-ordering on NG .y/.
Proof. We can prove the latter corollary simply by analogy to Theorem 3. We no-
tice that for any v; w 2 NG .y/ the conditions enumerated by the disjunction in
Definition 10 are exhaustive and mutually exclusive so that Œm;d
Pxy is a total rela-
Œm;d
tion on NG .y/. Further, we verify that Pxy is reflexive, antisymmetric (if, e.g.,
v; w 2 NG0 .y/, then always either cOm .Px::vy / < cOm .Px::wy / or LV .v/ <V LV .w/)
and transitive (since D, <, and <V are transitive). t
u
The final step is to define damped minimum spanning Markovian trees by utiliz-
ing Œm;d
Pxy as the constitutive neighborhood-related well-ordering.
400 A. Mehler
Definition 11 (Damped Minimum Spanning Markovian Tree). Let G D

.V; E; LV ; LE ; / be a graph according to Definition 3. Let further d W
f1; : : : ; mg ! Œ0; 1 be a damping function and
n o
˝O xŒm;d D fx g [ Œm;d
Pxy j y 2 V n fxg
for a distinguished vertex x 2 V , some m 2 N n f0g, and a damping function d .

Then,
G.˝O xŒm;d / D span G; x; ˝xŒm;d
is called a damped minimum spanning Markovian tree (DMSMT) of order m

spanned over G by means of ˝O xŒm;d starting from x and damped by d .
Corollary 7. Because of Theorem 2 it readily follows that under the conditions of
Œm
Definition 11, G.˝x / is a (spanning) tree (of G).
We do not consider damped MSMTs in terms of a proof–theoretical analysis fur-
ther but hint at the fact that they may help to extend the kind of Markovian spanning
trees as introduced by MSMTs.
15.3 Conclusion
In this chapter we have introduced the notion of a minimum spanning Marko-

vian tree together with its extension in the form of damped minimum spanning
Markovian trees. Table 15.1 summarizes these concepts and relates them to clas-
sical minimum spanning trees. It shows that by changing over to MSMTs we gain
context-sensitivity of graph modeling by taking paths as context-building units into
account. Further, the extensions of MSMTs in the form of DMSMTs provide a more
realistic model of salience or memory than ordinary m-order MSMTs. We have
argued that the motivation for introducing these kinds of structures comes from
linguistics where we have to model context effects of trailing in semiotic networks
(e.g., association networks and semantic memories or networks of Web documents).
A related example is browsing in a semantic web that – because of its bipartite struc-
ture – requires an extension of MSMTs in the form of hidden minimum spanning
Markovian trees. This extension will be the task of future work.
Acknowledgments Financial support of the German Federal Ministry of Education (BMBF)

through the research project Linguistic Networks and of the German Research Foundation (DFG)
through the Excellence Cluster 277 Cognitive Interaction Technology (via the Project Knowledge
Enhanced Embodied Cognitive Interaction Technologies (KnowCIT)), the SFB 673 Alignment in
Communication (via the Project X1 Multimodal Alignment Corpora: Statistical Modeling and
Information Management), the Research Group 437 Text Technological Information Modeling (via
the Project A4 Induction of Document Grammars for Webgenre Representation), and the LIS-
Project Content-Based P2P-Agents for Thematic Structuring and Search Optimization in Digital
Libraries at Bielefeld University is gratefully acknowledged.
References
1. Caldarelli G, Vespignani A (eds) (2007) Large scale structure and dynamics of complex net-
works. World Scientific, Hackensack, NJ
2. Dehmer M, Mehler A (2007) A new method of measuring the similarity for a special class of
directed graphs. Tatra Mt Math Publ 36:39–59
3. Dehmer M, Mehler A, Emmert-Streib F (2007) Graph-theoretical characterizations of general-
ized trees. In: Proceedings of the 2007 international conference on machine learning: models,
technologies, and applications (MLMTA’07), Las Vegas, pp 25–28
4. Diestel R (2005) Graph theory. Springer, Heidelberg
5. Fensel D, Hendler J, Lieberman H, Wahlster W (2003) Spinning the semantic Web. Bringing
the World Wide Web to its full potential. MIT Press, Cambridge, MA
6. Gärdenfors P (2000) Conceptual spaces. MIT Press, Cambridge, MA
7. Gritzmann P (2007) On the mathematics of semantic spaces. In: Mehler A, Köhler R (eds)
Aspects of automatic text analysis, vol 209. Studies in fuzziness and soft computing. Springer,
Berlin, pp 95–115
8. Halliday MAK, Hasan R (1976) Cohesion in english. Longman, London
9. Jungnickel D (2008) Graphs, networks and algorithms. Springer, Berlin
10. Kintsch W (1998) Comprehension: a paradigm for cognition. Cambridge University Press,
Cambridge
11. Kintsch W (2001) Predication. Cognitive Sci 25:173–202
12. Lin D (1998) Automatic retrieval and clustering of similar words. In: Proceedings of the
COLING-ACL ’98, pp 768–774
13. Martin JR (1992) English text: system and structure. John Benjamins, Philadelphia, PA
14. Mehler A (2002) Hierarchical analysis of text similarity data. Künstliche Intelligenz (KI) 2:
12–16
15. Mehler A (2002) Hierarchical orderings of textual units. In: Proceedings of the 19th inter-
national conference on computational linguistics (COLING ’02), Taipei, San Francisco, pp
646–652
16. Mehler A (2005) Lexical chaining as a source of text chaining. In: Patrick J, Matthiessen C
(eds) Proceedings of the 1st computational systemic functional grammar conference, Univer-
sity of Sydney, Australia, pp 12–21
17. Mehler A (2008) Structural similarities of complex networks: a computational model by ex-
ample of wiki graphs. Appl Artif Intell 22(7&8):619–683
18. Mehler A (2009) Generalized shortest paths trees: a novel graph class applied to semiotic
networks. In: Dehmer M, Emmert-Streib F (eds) Analysis of complex networks: from biology
to linguistics. Wiley-VCH, Weinheim, pp 175–220
19. Menczer F (2004) Lexical and semantic clustering by web links. J Am Soc Inf Sci Technol
55(14):1261–1269
20. Menshikov MV, Volkov SE (1997) Branching Markov chains: qualitative characteristics.
Markov Proc Relat Fields 3:1–18
21. Murphy GL (2002) The big book of concepts. MIT Press, Cambridge
22. Rieger BB (1978) Feasible fuzzy semantics. In: 7th International conference on computational
linguistics (COLING-78), pp 41–43
23. Sharkey AJC, Sharkey NE (1992) Weak contextual constraints in text and word priming.
J Mem Lang 31(4):543–572
24. Tarjan RE (1983) Data structures and network algorithms. Society for Industrial and Applied
Mathematics, Philadelphia
Chapter 16
Link-Based Network Mining
Jerry Scripps, Ronald Nussbaum, Pang-Ning Tan,

and Abdol-Hossein Esfahanian
Abstract Network mining is a growing area of research within the data mining
community that uses metrics and algorithms from graph theory. In this chapter we
present an overview of the different techniques in network mining and suggest future
research possibilities in the direction of graph theory.
Keywords Network mining Link mining Data mining
MSC2000: Primary 91D30; Secondary 94C15
16.1 Introduction
Since the early 1990s when it began to coalesce as a discipline, data mining has
grown in scope and depth. Although its foundations are in computer science, statis-
tics and machine learning, data mining has forged its way into such diverse areas as
medicine, biology, chemistry, sociology, and other humanities as well as business
and engineering. In this chapter we discuss how concepts in graph theory have been
absorbed into data mining, allowing it to expand into important new directions.
Data mining is the search for hidden knowledge within large data sets. The data
consist of a collection of objects. In a small data set, it is often possible to extract
meaningful patterns and models by applying traditional statistics and data analysis
methods. However, with large data sets, it is necessary to employ more scalable
and sophisticated techniques from data mining to deal with the high volume, high
dimensionality, noisy, and potentially distributed nature of the data. Some of the
techniques, such as classification, are predictive, while other techniques, such as
J. Scripps ()
School of Computing and Information Systems, 1 Campus Drive, Grand Valley State University,
Allendale, MI 49401, USA

404 J. Scripps et al.
clustering and association analysis, are descriptive. These techniques rely heavily on
the attributes of objects. It is the attributes that distinguish one object from another
and provide a basis for making predictions or forming descriptions.
The objects introduced above are considered to be independent of each other.
For classification, the class of one object does not depend on the data from any
other object. This independence assumption allows data mining techniques to make
use of statistical models that depend upon the samples being independent and iden-
tically distributed. In most domains though, the objects are related. Taking into
account the relationships between the objects has led to the emergence of an area
called link-based network mining or link mining [26]. Link mining techniques have
found applications in diverse types of network data, including social networks,
protein interaction networks, food web, telecommunication, and transportation
networks.
Link mining research has focused on various issues, such as understanding how
networks are formed, how their structural properties can be characterized, what are
the underlying hidden patterns, and how to make sound inferences based on models
derived from the data. Recent advances in this area have led to the development
of novel techniques for link prediction, node classification, node ranking, influence
maximization, etc. A key challenge for these techniques is to make use of both the
node attributes and links in a way that will produce better results than using either
the attributes or link information alone.
The remainder of this chapter is organized as follows. In Sect. 16.2, we discuss
the problem of characterizing the properties of a network. Section 16.3 reviews
the link mining techniques that have been proposed in the literature. Finally, in
Sect. 16.4, we present some of the open problems and ongoing research in this area.
16.2 Networks and Their Properties
A network is a collection of nodes (people, publications, companies, etc.). Each

node can be assigned attribute values. In addition to having attributes, the nodes
can have relationships with other nodes. The relationships are represented as links,
normally a binary value to indicate the presence or absence of a relationship. In some
cases, the links are weighted according to the strength of their connections. Some
links are also directed to denote asymmetric relationships between objects (e.g.,
influence of an individual over another or hyperlink from one Web page to another).
Many of the techniques described in this chapter assume that the network is static. In
a static network, a link exists between a pair of nodes if they have interacted at any
point during the period of data collection. This assumption helps to make the link
mining tasks computationally more tractable. Increasingly, the focus in link mining
is on networks that are dynamic where nodes and links can be added or removed
over time from the network.
16 Link-Based Network Mining 405
Table 16.1 Summary of network metrics

Type Metric Description References
Node Degree Number of links [10, 69]
Closeness Mean shortest path to all other nodes [10, 69]
Betweenness Number of shortest paths that include [10, 69]
node
Authority Nodes are assigned values from the [41, 53]
dominant eigenvector of adjacency
matrix
Node-pair Distance Shortest path between two nodes [14, 62]
Min-cut Minimum number of edges, when [14]
removed separate a pair of nodes
Common neighbors The number of common neighbors [51]
between two nodes
Jaccard’s coefficient Number of common neighbors divided by [64]
the total neighbors of the two nodes
Adamic/Adar Number of common neighbors divided by [1]
the total neighbors of the two nodes
Katz The weighted sum of all paths between [39]
two nodes
Network Density Ratio of links to total number of node [14]
pairs
Clustering coefficient Similar to density (see reference) [70]
Average path length Mean shortest path length over all node [14]
pairs
16.2.1 Metrics
Metrics from graph theory and social network analysis are useful for many of the
techniques that are described shortly. Table 16.1 lists examples of metrics that are
often used. Some of the metrics are applicable to single nodes, while others are used
to characterize node-pairs or the entire network.
16.2.2 Network Characterization
One of the active research areas in link mining is to understand characteristics of

real-world networks and to identify the generative mechanism that leads to the for-
mation of such networks. For example, many social and physical networks have
been observed to exhibit a power-law degree distribution. Such scale-free networks,
as they are known, can be explained using a generative mechanism known as pref-
erential attachment [6]. Another example is the small-world network, which has
properties such as high clustering coefficient and low average path length.
Figure 16.1 provides a visual depiction of the different network types. The
properties of these network types are summarized in Table 16.2 in terms of well-
known metrics such as degree distribution, clustering coefficient, and path length.
Regular Small world Random
Scale-free Cellular Core-periphery
Fig. 16.1 Network types
Table 16.2 Summary of network types

Network type Properties References
Regular Uniform degree distribution
Random Poisson degree distribution [21]
Small world High clustering coefficient and low average path length [70]
Scale-free Power-law degree distribution [6]
Cellular Tightly connected cells with sparse interconnections [2, 24]
Core-periphery Single, tightly connected core of nodes with periphery points [2, 9]
connected only to the core
Forest fire Composite approach to model networks with shrinking [45]
diameter and densification
In addition to the metric-based approaches, Sole and Velverde [63] and Dehmer and
Emmert-Streib [16] proposed characterizing networks using information-theoretic
and statistical approaches. Although the metrics shown in Table 16.2 are useful to
compare different network types, it is also helpful to examine some of the invariant
properties of a network. As an example, the following theorem describes the nature
of density within a network.
Theorem 1. For any graph G D .V; E/, and for any fixed integer k, 1 < k
jV j, the average density over all k-induced subgraphs of G is the same as the
density of G.
Proof. Let G D .V; E/ be a graph. We begin by considering the set of all k-induced
subgraphs of G, for an arbitrary value of k. An induced subgraph of G is one con-
taining a subset of the nodes in G, along with every link in G that has both endpoints

in the subset. A k-induced subgraph is one with k nodes. There are jVk j of these,
jV j2
and each link in G will appear in exactly k2 of them. The probability that a
given edge appears in a particular k-induced subgraph equals
jV j2 .jV j2/Š
k2 .k2/Š.jV jk/Š kŠ.jV j 2/Š k.k 1/
jV j D D D : (16.1)
jV jŠ jV jŠ.k 2/Š jV j.jV j 1/
k kŠ.jV jk/Š
By definition, the maximum possible number of links in a graph with k nodes is

k.k1/
2 . So the average density of all k-induced subgraphs of G is
jEj jVk.k1/
j.jV j1/ 2jEj
D ; (16.2)
k.k1/ jV j.jV j 1/
2
thus proving the theorem. t

u
In addition to the existing network generation models, there are growing interests
in understanding the dynamics of networks as nodes and edges are being added or
removed. For example, Hanneke and Xing [32] presented an extension of the expo-
nential random graph model to represent network evolution over time. Leskovec et
al. [45] developed a new model to account for certain properties that were revealed
in their study of real evolving networks. Their model, which is based on a “forest
fire” spreading process, exhibits characteristics such as shrinking network diameter,
increasing densification, as well as power-law degree distribution.
16.3 Techniques of Link Mining
Link mining has the same goal as data mining – finding hidden knowledge – but in
a different setting. Some of the techniques have morphed from data mining to link
mining, such as clustering to community finding and classification to link-based
classification. Additionally, new techniques have emerged such as influence maxi-
mization and link prediction. Here we describe these techniques in detail.
16.3.1 Community Finding
The technique of community finding, also called group detection [26], positional
analysis [20, 69], or blockmodelling [69], is the process of placing nodes into
groups in such a way that the nodes within a group are “similar” to each other
and “dissimilar” to nodes in other groups. This is equivalent to clustering [64] and
graph partitioning [37]. From the graph theory perspective, the problem of commu-
nity finding is to remove links from the graph so that the remaining graph has the
“desired” components.
Community finding is ill-posed; there is no agreed-upon metric for evaluation.

Metrics that are commonly used can be separated into supervised, where the original
community assignments are known, and unsupervised, where they are not known.
Supervised metrics, such as purity, entropy, and normalized mutual information,
measure – in different ways – how well the “found” communities reflect the original
communities. Unsupervised metrics generally measure the cohesion (the similarity
of the nodes within communities) and/or the separation (the distance between nodes
from different communities). A recently proposed unsupervised graph-based metric
from Newman and Girvan [50], called modularity, is based on the fraction of links
within a community to those between communities. An additional challenge to com-
munity finding is scalability. Networks such as the World Wide Web or online social
networks can have millions, even billions, of nodes. Using an agglomerative hier-
archical algorithm with a complexity of O.n3 / – where n is the number of nodes –
can be infeasible.
The most common approach to community finding is to segment the entire net-
work into disjoint groups, where each node is assigned to exactly one community.
Traditional clustering algorithms such as k-means, DBScan, Chameleon, etc. [64]
can be applied to generate such communities. Graph partitioning algorithms are
also applicable. For example, spectral clustering [61] divides a network into bal-
anced components based on the eigenvalues of its Laplacian matrix. This approach
is equivalent to finding a partitioning that minimizes the normalized cut criterion
[18]. Karypis and Kumar [38] developed a multilevel graph partitioning approach
that can accommodate different heuristic functions for coarsening, partitioning, and
refining the clusters. Although these algorithms were not specifically designed for
networks, their application is straightforward. An approach that was specifically de-
signed for networks, from Girvan and Newman [28], uses the edge betweenness
metric to remove edges iteratively. It is intuitively appealing since high between-
ness edges would appear to be bottlenecks between communities; however, it is
slow [55, 68].
A variant of finding disjoint communities is to discover a hierarchy of commu-
nities. This approach allows the communities to be nested and organized as a tree
structure called a dendrogram. Agglomerative hierarchical clustering methods such
as single-link and complete-link can be used to find hierarchies in networks. More
recently, Clauset et al. [15] proposed a method of extracting hierarchies based on
maximum likelihood methods and Markov chain Monte Carlo sampling.
Algorithms that find disjoint communities are popular but do not allow for situa-
tions when nodes can belong to more than one community. This is often the case in
social networks where, for example, an individual can join two or more communi-
ties. An extreme case is to use fuzzy clustering, where every node belongs to every
community with an associated weight. Another overlapping clustering method, de-
veloped by Banerjee et al. [5], is based on a mixture model of exponential family
distributions. One of the challenges of overlapping communities is excess overlap.
A paper by Scripps et al. [57] attempts to minimize the number of nodes with over-
lapping communities by isolating the bridge-nodes – nodes that are linked to more
than one community – using a graph min-cut algorithm.
Some community finding methods do not try to completely cluster the entire
network. Instead they form communities from a given root set of nodes. This ap-
proach is helpful when only a portion of the network is known or the network is
large and a complete grouping is unnecessary. As examples, consider Web page
search where a set of related pages can be useful or in a large bibliographic database,
where one only wants to know the community of researchers to which an author
belongs. A Markov chain approach by Gibson et al. [27], specific to the World Wide
Web, starts with a core set of pages, adds a fixed number of nearby pages, then forms
the communities from the authoritative pages in the expanded set. Min-cut has also
been adapted [23] to find a community by using the targeted node as the source and
adding a virtual sink connected to all nodes in the graph.
More recently, progress in community finding has focused along several direc-
tions. Semi-supervised learning methods have become popular in the clustering
literature, where side information is available in the form of constraints on pairs
of nodes that should or should not be grouped together. The side information can be
obtained from the similarity between node attributes, partial knowledge of the class
labels, etc. The side information may improve community finding in many ways: to
aid in the cluster initialization, to guide the clustering process toward finding better
partitions, and to learn the appropriate distance metric consistent with the domain
expectations [7,13,25]. Another trend is finding communities in dynamic networks,
where the nodes, links, and attributes change over time. Backstrom et al. [4] studied
how the structural features of communities affect how nodes join and leave com-
munities. A paper by Tantipathananandh et al. [65] proposed a new framework for
tracking community changes in dynamic networks by modeling it as a graph color-
ing problem. Communities are identified by approximately solving a combinatorial
optimization problem using dynamic programming.
16.3.2 Node Ranking
Ranking is the process of creating a total ordering of the nodes in a network. The
rank of a node reflects the measurement of some particular structural property of
the network, with respect to the node, which conveys a semantic meaning such as
importance, popularity, authority, etc. As an end in itself, rankings can also be used
to look for well-connected or central nodes in a network.
In link mining, ranking is done using centrality measures [69]. The first, degree
centrality, is simply the degree of the node; in directional graphs it can be indegree
or outdegree. In a social network, the degree quantifies a node’s popularity. In a
bibliographic dataset the indegree is a measure of a paper’s authority, while the
outdegree measures the number of papers that it cites.
Closeness centrality is the average shortest distance between a node and all other
(reachable) nodes in the network:
1 X
closeness.v/ D d.v; u/
jV j 1
u2V nv
where V is the set of nodes and d.v; u/ is the distance from v to u. Lower values of
closeness indicate a more centrally located node. In a social network, a node with a
low closeness rank indicates a person who generally has short communication paths
to others, for instance, a CEO in a corporation. In a terrorist network it could help
to identify a cell leader.
Another centrality measure is betweenness, which is the number of shortest paths
between all pairs of nodes that go through it:
X gst .v/
betweenness.v/ D
gst
s2V;t 2V;s¤t ¤v
where gst is the number of shortest paths from s to t and gst .v/ is the number of
shortest paths from s to t that go through v. Betweenness can be defined in the
same way for edges. In a social network a node with a high betweenness score is
considered important because it is likely that it will be encountered as members
navigate the network. In a road map network, where nodes represent intersections
or small communities, nodes with high betweenness are likely to be points of high
congestion.
A popular ranking method for large directed networks like the World Wide Web
is the eigenvector method [41, 53]. In this method a node’s rank is the sum of the
ranks of its incoming neighbors. Given a network with n nodes and an adjacency
matrix A where Aij is 1 if there is a directed edge from i to j and zero otherwise,
for the node vi , the rank ri is defined as:
n
1X
ri D Aij rj

j D1
where is a constant. Written in matrix form it becomes the eigenvector equation

r D Ar. The dominant eigenvector of A provides an effective measure of authority
rank. Google’s PageRank is an example of this ranking method. Nodes with a high
rank are said to be authoritative as many other nodes refer to them. This method
of ranking effectively stifles the problem of manipulation. In the World Wide Web,
for which this was proposed, unscrupulous Web hosts would create fake Web pages
linked to their main page to raise its rank. However, since these bogus Web pages
themselves have a low rank it does not increase the main page’s rank very much.
Unfortunately, this formulation has problems with graph cycles. The rank for nodes
in a cycle will grow unabated. Page and Brin [53] solved this problem by adding a
decay factor E yielding the equation r D Ar C E. Other approaches, similar to
PageRank, include the algorithms HITS [41] and SALSA [43].
In addition to centrality measures, nodes can be ranked using other graph met-
rics such as eccentricity, but the practical significance of such metrics is less clear
than, say, degree. Recently, there has been considerable interest in assigning rank
values to nodes based on their community belongingness. Guimera et al. [31] in-
troduced a metric called participation coefficient, which measures to what degree
a node participates in other communities. Their approach requires the communities

in a network to be identified first using an algorithm that optimizes a modularity
function of the network partition. As a consequence, the ranks of the nodes are sen-
sitive to the choice of community finding algorithm. Scripps et al. [59] introduced
an alternative metric called rawComm for assigning ranks and roles to nodes with-
out applying a community finding algorithm. The metric rawComm estimates the
number of communities to which a node vi belongs based on its local neighborhood
structure:
X 1
rawComm.vi / D
1 C n1 p C n2 .1 q/
vj 2N.vi /
where N.vi / is the set of nodes that are connected to vi , n1 is the number of com-
mon neighbors of vi and vj , and n2 is jN.vi /jn1 . The values p and q represent the
probabilities that two linked nodes are in the same community and two non-linked
nodes are in different communities, respectively. Nodes with higher rawComm val-
ues are connected to more communities, making them good ambassador nodes.
Node ranking in dynamic networks remains an important but largely unexplored
area of research. Desikan et al. [17] has recently developed an incremental approach
to adjusting PageRank scores in evolving graphs without recomputing the ranks.
Another promising direction would be to detect interesting trends in a dynamic net-
work, for example, finding nodes with rapidly increasing authority scores. Finally,
the problem could also be extended to ranking communities or groups of nodes.
16.3.3 Influence Maximization
Closely related to ranking is the technique of influence maximization (also known

as diffusion of innovation), which is important in the areas of epidemic spread and
viral marketing. The goal is to find influential nodes – nodes that will spread their
influence quickly through the network. Influence is assumed to spread using a par-
ticular model of diffusion. In these models, nodes become activated (contracted a
virus or bought a product) and can, in turn, activate their neighbors.
Diffusion models include the families of threshold and cascade models. In the
threshold models [30] a node becomes activated when a certain percentage of its
neighbors become activated. Newly activated nodes under the cascade models [29]
have a one-time chance to activate neighbors with a given probability. Most of the
models are probabilistic in nature. Without probability (e.g., if nodes are activated
with certainty) every graph component with an activated node would end up with
all nodes activated. Using appropriate probabilities ensures that activated nodes will
only activate some of their neighbors and that the spread will stop before the entire
network is activated.
The problem then is to choose nodes that will maximize a particular utility func-
tion. The most apparent utility function is the spread of activation to as many nodes
Fig. 16.2 Choosing a node to

maximize influence
as possible. For example, in viral marketing, a company may want to offer a small
number of free or discounted products to influential people in the hopes that they
will inspire others to purchase the product.
One might first consider activating only the highest degree nodes to obtain the
optimal solution. However, one can quickly imagine that if the high degree nodes
are all neighbors, the spread of influence will be less than if lower degree nodes,
more spread out, were chosen. For example, in Fig. 16.2, to maximize the number
of nodes activated, the selected node is likely the best choice even though it is not the
highest degree. Another challenge is that the link information may not be reliable;
for example, in an online network, links between users are easy to add but do not
always reflect genuine friendship. Furthermore, given the size of many real-world
networks, simulating the activation process repeatedly to find the optimal solution
is computationally expensive.
Kempe et al. [40] showed that the problem is NP-complete under the specific
diffusion models of independent cascade and linear thresholds. They then pro-
pose a greedy strategy based on submodular functions [48], which guarantees a
solution that is provably within 63% of optimal for these same models. In their ex-
periments, the greedy strategy always performs better than the alternative strategies
of selecting the nodes with the highest degree or lowest closeness scores.
An alternative to the problem was suggested by Scripps et al. [58] where the
network is assumed to have latent communities. The problem then becomes choos-
ing the nodes that will maximize the number of communities with activated nodes.
For example, a viral marketer may be interested in offering free samples to a small
group of individuals who will promote the product to as many demographic groups
(sports fans, poetry lovers, etc.) as possible. The authors propose using the raw-
Comm metric described in Sect. 16.3.2. Their experiments show that rawComm
does better than greedy, degree, or closeness at maximizing the spread to latent
communities.
Domingos and Richardson [19] proposed a cost/benefit approach to the influ-
ence maximization problem. They assume there is a cost for activating nodes and
a revenue associated with activated nodes. The problem then becomes choosing a
subset of nodes to activate that will maximize the expected lift in profit (i.e., rev-
enue minus cost). A solution to the influence maximization problem in the face of
competition was proposed by Bharathi et al. [8]. For example, multiple companies
with similar products may attempt to influence the buying decisions of a targeted
group of customers. Extending influence maximization to dynamic networks, where
nodes may join or leave the network, is another open research problem. Variations
of the problem in dynamic networks include finding the nodes that are most influen-
tial for new nodes or identifying the nodes whose influence spread is increasing or
decreasing.
16.3.4 Link Prediction
The link prediction problem can be stated as follows. Given a network, can we
infer the node pairs that are likely to be linked together? Link mining techniques
are applicable to static networks (to infer missing links in an incomplete network)
or dynamic networks (to predict new interactions that will occur in the near future).
Examples of link prediction problems include detecting covert ties between criminal
suspects or identifying future collaboration between researchers.
Link prediction is a challenging problem due to the sparsity of many networks.
Predicting which nonlinked node pairs will become linked has so far yielded very
low accuracies [46]. Rattigan and Jensen [56] have shown that this is due to the
skewed class distribution; as networks grow and evolve, the number of nonlinked
pairs increases quadratically while the number of linked pairs often grows only
linearly. Research in social sciences has suggested the tendency of individuals to
establish friendship ties with others who have similar interests (attributes) [36]. In
addition, individuals may also become friends because they share common friends
(link structure) or belong to similar groups (communities). Integrating these differ-
ent sources of information to improve link prediction is a challenge.
Liben-Nowell and Kleinberg [46] compared a large number of graph metrics as
link predictors. They tested the metrics on bibliographic data sets using only the link
structure and ignoring the node attributes. This work has been expanded to include
both link and attribute data [33, 46] by using binary classifiers. Another approach
is to use probabilistic generative models, where the goal is to learn the joint prob-
ability density of the nodes, links, subgroups, etc., and to predict the missing links
by applying Bayes’s theorem [49,67]. Because of the sparsity of networks, Rattigan
and Jensen [56] proposed a variation to the problem known as anomalous link dis-
covery, where the goal is to find links that are anomalous. Recent works have also
considered the changes in the network over time. Potgieter et al. [54] combined the
metrics from the Liben-Nowell study with temporal metrics such as return, moving
average, and recency. In another work by O’Madadhain et al. [52], a time-evolving
probabilistic classifier is constructed from training data sampled over many time
periods. Hanneke and Xing [32] developed an extension of the exponential random
graph model to account for the evolution of networks over time. A recent study by
Backstrom et al. [4] on the evolution of communities in large social networks sug-
gested that community structures and link formation are closely related. Making use
of latent community structures for link prediction is another possible direction for
future research.
16.3.5 Link-Based Classification
The classification problem is to predict the class of an object (which is simply

an attribute of interest). A training set of objects whose class is known is given.
A classifier is trained on the training set and used to predict the class of objects
whose class is unknown. In a social network, for example, we may know the marital
status of many of the members but not all. A classifier may help to identify combi-
nations of other attributes (such as age group and income) that can be used to infer
the marital status of those for whom it is unknown.
Traditional classifiers make a simplifying assumption that the objects are inde-
pendent of each other. Researchers have recently begun to take advantage of the
clearly defined relationships (links) within networks to improve classification. In
the social network example above, the marital status of a person can potentially be
inferred from the marital status of his or her friends. The challenge for link-based
classification is integrating the attribute and link data. Using the attributes of neigh-
bors has been shown to actually be detrimental in some cases [12]; however, using
the class of the neighbor has been shown to be helpful [12, 47]. A related challenge
is to recognize and utilize the structures inherent in the network. The study by Yang
et al. [71] identified the existence of certain regularities in networks. For example,
some networks exhibit encyclopedia regularity where nodes of one class link to
nodes of the same class.
Some researchers have concentrated on utilizing a local approach to node clas-
sification. For example, Chakrabarti et al. [12] have developed a technique for Web
page categorization that exploits link information in a small neighborhood around
the Web pages. They showed that, by using both the attributes of a node and the
class of its neighbors, the error rate of an attribute-based classifier can be reduced
up to 70%. In another work by Lu and Getoor [47], two classifiers were trained,
one on the attribute data and the other using neighborhood class statistics of neigh-
bors. They showed that the combined classifiers result in improved predictions. The
problem of propagating the class of known nodes through a network to the nodes
with unknown classes is analogous to the label propagation problem in graph-based
semi-supervised learning literature [67]. Unlike link-based classification, the graph
used for label propagation is constructed based on the attribute similarity between
objects.
Probabilistic models have also been used for link-based classification. Taskar
et al. [66] proposed a probabilistic relational model using conditional Markov net-
works. They showed that the collective classification of multiple related entities can
be inferred from the learned model. Similarly, Neville and Jensen [49] proposed a
generative model that simultaneously learns the latent communities and the condi-
tional probabilities associated with them.
Link-based classification can be extended to make use of the temporal informa-
tion of an evolving network. For example, the class distribution of the nodes may
change over time, and thus, can be exploited to improve the prediction. In some
applications, a node can be assigned to multiple classes (e.g., a Web page having
multiple tags or a gene with more than one functional class). Therefore, another
new direction is to learn all the classes associated with a given node, a problem that
is known as multilabel learning. In another direction, although some of the above
approaches have shown improvements by using the class information of neighbors,
the information will be less helpful for some nodes than for others. Scripps et al. [58]
have shown that the role that a node plays in the network can guide the classifier to
use the neighborhood information when it is likely to help. For example, neighbor-
hood information is less predictive for nodes linked to many communities.
16.4 Conclusion
In this chapter we have reviewed characteristics of networks and described some

of the techniques that have been proposed in the link mining area. These tech-
niques have been applied to a wide variety of networks such as the World Wide
Web [41, 53], terrorist networks [60], viral marketing [19], organizational structure
[42], and even to some domains that do not immediately appear to be structured like
a network, such as macroeconomics [35].
Although recent progress in link mining research has been significant, there are
many new directions for growth. Consider the temporal aspect. Techniques such as
link prediction can assume that the network is changing over time; however, most
of the algorithms are still designed to work with static networks. To account for
changes in the network over time, concepts such as selection (people preferring
to make friends with others having similar attributes) and influence (changing at-
tributes to align more with friends) [11] are beginning to become integrated into
new models.
Another new direction is inspired by the recent explosion in online social net-
works and their available APIs. New Web and desktop applications could utilize a
user’s social network information (with the permission of the user). As an exam-
ple, a retailer with access to a person’s social network could make more meaningful
product recommendations. Third-party access to network data reveals a number of
new problems such as handling partial network data and blending networks. One
negative aspect of online social networks is the concern for privacy. Although many
sites provide security settings for users, many complacently use the defaults, which
can allow strangers to view their personal data. As shown by Backstrom et al. [3],
even in anonymized networks, it is still possible to identify users. Techniques to
safeguard against abuse in social networks would be well received.
Considering the massive size of many real-world networks, sampling from large
graphs is another promising research direction [44]. Sampling allows inferences to
be made from a representative subgraph, thus enabling current algorithms to scale
up to massive-sized networks. However, in many domains, the sample may be bi-
ased as a result of the data collection process (e.g., when crawling the pages of
an online social networking Web site). Issues such as boundary effects of the sub-
graph and biases in parameter estimation are some of the challenges that must be
addressed [22].
Finally, improvements in network visualization [34] would be another interest-

ing growth direction. A display of a small graph of a hundred nodes can be very
helpful. However, consider the users in Facebook, who often have over 200 friends.
Providing an informative, visual representation of such large and complex networks
is an important new challenge.
As online social networks continue to proliferate and become integrated into
more traditional applications the opportunity for new techniques will also continue
to grow accordingly. Graph theory will undoubtedly play a role in this growth.
References
1. Adamic L, Adar E (2003) Friends and neighbors on the web. Soc Networks 25:211–230
2. Airoldi EM, Carley KM (2005) Sampling algorithms for pure network topologies. SIGKDD
Explorations 7:13–22
3. Backstrom L, Dwork C, Kleinberg J (2007) Wherefore art thou r3579x? Anonymized social
networks, hidden patterns, and structural steganography. In: Proceedings of the 16th interna-
tional World Wide Web conference
4. Backstrom L, Huttenlocher D, Kleinberg J, Lan X (2006) Group formation in large social
networks: membership, growth, and evolution. In: Proceedings of the 12th ACM SIGKDD
international conference on knowledge discovery and data mining
5. Banerjee A, Krumpelman C, Ghosh J, Basu S, Mooney R (2005) Model based overlapping
clustering. In: Proceedings of the 11th ACM SIGKDD international conference on knowledge
discovery and data mining
6. Barabási A-L, Bonabeau E (2003) Scale-free networks. Sci Am 288:50–59
7. Basu S, Bilenko M, Mooney R (2004) A probabilistic framework for semi-supervised clus-
tering. In: Proceedings of the 10th ACM SIGKDD international conference on knowledge
discovery and data mining, Seattle, WA
8. Bharathi S, Kempe D, Salek M (2007) Competitive influence maximization in social networks.
In: Deng X, Graham FC (eds) Proceedings of WINE 2007. Springer, Heidelberg
9. Borgatti SP, Everett MG (1999) Models of core/periphery structures. Soc Networks 21:
375–395
10. Brandes U, Erlebach T (2005) Network analysis. Lecture Notes in Computer Science. Springer,
Berlin
11. Burk W, Steglich CEG, Snijders TAB (2007) Beyond dyadic interdependence: actor-oriented
models for co-evolving social networks and individual behaviors. Int J Behav Dev 31:397
12. Chakrabarti S, Dom B, Indyk P (1998) Enhanced hypertext categorization using hyperlinks.
In: Proceedings of the SIGMOD international conference on management of data. ACM,
New York, pp 307–318
13. Chang H, Yeung D-Y (2008) Robust path-based spectral clustering. Pattern Recogn 41:
191–203
14. Chartrand G, Oellermann O (1992) Applied and algorithmic graph theory. McGraw-Hill,
New York
15. Clauset A, Moore C, Newman MEJ (2006) Structural inference of hierarchies in networks. In:
Statistical network analysis: models, issues, and new directions, vol 4503, pp 1–13
16. Dehmer M, Emmert-Streib F (2008) Structural information content of networks: graph entropy
based on local vertex functionals. Comput Biol Chem 32:131–138
17. Desikan P, Pathak N, Srivastava J, Kumar V (2005) Incremental page rank computation on
evolving graphs. In: Proceedings of the 14th international World Wide Web conference (Special
interest tracks and posters)
18. Dhillon IS, Guan Y, Kulis B (2004) Kernel k-means: spectral clustering and normalized cuts.
In: Proceedings of the 10th ACM SIGKDD international conference on knowledge discovery
and data mining
19. Domingos P, Richardson M (2001) Mining the network value of customers. In: Proceedings
of the 7th ACM SIGKDD international conference on knowledge discovery and data mining.
ACM, New York, pp 57–66
20. Doreian P, Batagelj V, Ferligoj A (2005) Positional analysis of sociometric data. In: Carrington
P, Scott J, Wasserman S (eds) Models and methods in social network analysis, Cambridge,
New York
R P, Renyi
21. Erdos K A (1960) On the evolution of random graphs, vol 5. Publications of the institute
of Mathematics, Hungarian Academy of Science, pp 17–61
22. Fienberg S (2006) Panel discussion from statistical network analysis: models, issues, and
new directions. In: Proceedings of the ICML 2006 workshop on statistical network analysis,
Pittsburgh, PA, USA
23. Flake G, Tsioutsiouliklis K, Tarjan R (2002) Graph clustering techniques based on minimum
cut trees. Technical Report, NEC, Princeton, NJ
24. Frantz T, Carley KM (2005) A formal characterization of cellular networks. Technical Report
CMU-ISRI-05-109, School of Computer Science, Carnegie Mellon University
25. Gao J, Tan PN, Cheng H (2006) Semi-supervised clustering with partial background informa-
tion. In: Proceedings of SDM’06: SIAM international conference on data mining
26. Getoor L, Diehl CP (2005) Link mining: a survey. SIGKDD Explorations 7:3–12
27. Gibson D, Kleinberg J, Raghavan P (1998) Inferring web communities from link topology. In:
Proceedings of the 9th ACM conference on hypertext and hypermedia
28. Girvan M, Newman M (2002) Community structure in social and biological networks. Proc
Natl Acad Sci 99:7821–7826
29. Goldenberg J, Libai B, Muller E (2001) Using complex systems analysis to advance marketing
theory development: modeling heterogeneity effects on new product growth through stochastic
cellular automata. Academy of Marketing Science Review
30. Granovetter M (1978) Threshold models of collective behavior. Am J Sociol 83:1420–1443
31. GuimeraJ R, Sales-Pardo M, Amaral L (2007) Classes of complex networks defined by role-to-
role connectivity profiles. Nat Phys 3:63–69
32. Hanneke S, Xing E (2006) Discrete temporal models of social networks. In: Proceedings of the
23rd international conference on machine learning workshop on statistical network analysis
33. Al Hasan M, Chaoji V, Salem S, Zaki M (2006) Link prediction using supervised learning. In:
Proceedings of SDM’06: SIAM data mining conference workshop on link analysis, counter-
terrorism and Security
34. Heer J, Boyd D (2005) Vizster: visualizing online social networks. In: Proceedings of IEEE
symposium on information visualization. IEEE Press, Minneapolis, MN
35. Jackson M (2008) Social networks in economics. In: Benhabib J, Bisin A, Jackson MO (eds)
Handbook of social economics. Elsevier, Amsterdam
36. Kandel D (1978) Homophily, selection, and socialization in adolescent friendships. Am J
Sociol 84:427–436
37. Karypis G, Kumar V (1995) Analysis of multilevel graph partitioning. Supercomputing
38. Karypis G, Kumar V (1999) A fast and high quality multilevel scheme for partitioning irregular
graphs. SIAM J Sci Comput 20:359–392
39. Katz L (1953) A new status index derived from sociometric analysis. Psychometrika 18:
39–43
40. Kempe D, Kleinberg J, Tardos E (2003) Maximizing the spread of influence through a social
network. In: Proceedings of the 9th ACM SIGKDD international conference on knowledge
discovery and data mining, pp 137–146
41. Kleinberg J (1999) Sources in a hyperlinked environment. J ACM 46:604–632
42. Krackhardt D, Hanson JR (1993) Informal networks: the company behind the chart. Harvard
Bus Rev 71:104–111
43. Lempel R, Moran S (2001) Salsa: the stochastic approach for link-structure analysis. ACM
Trans Inf Syst 19:131–160
44. Leskovec J, Faloutsos C (2006) Sampling from large graphs. In: SIGKDD
45. Leskovec J, Kleinberg J, Faloutsos C (2005) Graphs over time: densification laws, shrinking
diameters and possible explanations. In: Proceedings of the 11th ACM SIGKDD international
conference on knowledge discovery in data mining
46. Liben-Nowell D, Kleinberg J (2003) The link prediction problem for social networks. In: Pro-
ceedings of the 12th international conference on information and knowledge management,
New Orleans, LA
47. Lu Q, Getoor L (2003) Link-based classification. In: Proceedings of the 20th international
conference on machine learning, ICML
48. Nemhauser GL, Wolsey LA, Fisher ML (1978) An analysis of approximations for maximizing
submodular set functions. Math Program 14:265–294
49. Neville J, Jensen D (2005) Leveraging relational autocorrelation with latent group models. In:
Proceedings of the 5th IEEE international conference on data mining
50. Newman M, Girvan M (2004) Finding and evaluating community structure in networks. Phys
Rev E 69:026113
51. Newman MEJ (2001) Clustering and preferential attachment in growing networks. Phys Rev E
64:025102
52. O’Madadhain J, Hutchins J, Smyth P (2005) Prediction and ranking algorithms for event-based
network data. SIGKDD Explorations 7:23–30
53. Page L, Brin S, Motwani R, Winograd T (1998) Pagerank citation ranking: bringing order to
the web. Technical report, Stanford University
54. Potgieter A, April K, Cooke R, Osunmakinde IO (2006) Temporality in link prediction: under-
standing social complexity. J Trans Eng Manag
55. Radicchi F, Castellano C, Cecconi F, Loreto V, Parisi D (2004) Defining and identifying com-
munities in networks. Proc Natl Acad Sci USA 101:2658–2663
56. Rattigan M, Jensen D (2005) The case for anomalous link discovery. SIGKDD Explorations
7:41–47
57. Scripps J, Tan PN (2006) Clustering in the presence of bridge-nodes. In: Proceedings of
SDM’06: SIAM international conference on data mining, Bethesda, MD
58. Scripps J, Tan PN, Esfahanian A-H (2007) Exploration of link structure and community-based
node roles in network. Technical report, Michigan State University
59. Scripps J, Tan PN, Esfahanian A-H (2007) Exploration of link structure and community-based
node roles in network analysis. In: Proceedings of the 7th IEEE international conference on
data mining
60. Senator T (2002) Darpa: evidence extraction and link discovery program. DARPATech
61. Shi J, Malik J (2000) Normalized cuts and image segmentation. IEEE Trans Pattern Anal
22(8):888–905
62. Skorobogatov VA, Dobrynin AA (1988) Metrical analysis of graphs. MATCH 23:105–155
63. Solé RV, Valverde S (2004) Information theory of complex networks: on evolution and archi-
tectural constraints. In: Lecture notes in physics, vol 650, pp 189–207
64. Tan P, Steinbach M, Kumar V (2005) Introduction to data mining. Addison Wesley,
Boston, MA
65. Tantipathananandh C, Berger-Wolf TY, Kempe D (2007) A framework for community identi-
fication in dynamic social networks. In: Proceedings of the 13th ACM SIGKDD international
conference on knowledge discovery and data mining, pp 717–726
66. Taskar B, Abbeel P, Koller D (2002) Discriminative probabilistic models for relational data.
In: Proceedings of the 18th conference on uncertainty in artificial intelligence (UAI02)
67. Taskar B, Wong MF, Abbeel P, Koller D (2003) Link prediction in relational data. In: Neural
information processing systems conference (NIPS03)
68. Tyler JR, Wilkinson DM, Huberman BA (2003) Email as spectroscopy: automated discovery of
community structure within organizations. In: Proceedings of the 5th international conference
on communities and technologies
69. Wasserman S, Faust K (1994) Social network analysis: methods and applications. Cambridge
70. Watts DJ, Strogatz SH (1998) Collective dynamics of ‘small-world’ networks. Nature
393:440–442
71. Yang Y, Slattery S, Ghani R (2002) A study of approaches to hypertext categorization. J Intell
Inf Syst 18:219–241
Chapter 17
Graph Representations and Algorithms
in Computational Biology of RNA
Secondary Structure
Stefan Washietl and Tanja Gesell
Abstract The analysis of RNA structures is an important problem in computational

biology. In this chapter we review various algorithms to predict and compare RNA
secondary structures. These algorithms are based on graph theory and use represen-
tations of RNA secondary structure as outerplanar graphs and trees.
Keywords Bioinformatics RNA folding Outerplanar graphs Tree editing
MSC2000: Primary 94C15; Secondary 92C40, 92D20, 05C30
17.1 Introduction
RNA secondary structure is an important level in the structural hierarchy of RNA

molecules. The basic principle of RNA secondary structure – discrete building
blocks connected by molecular interactions – naturally leads to graph-theoretical
approaches for their formal analysis. Therefore, graph and tree algorithms have a
long tradition in RNA structural biology and some of them are among the pioneer-
ing work in the field of computational biology [19].
However, only in more recent years has it become evident that the biological
importance of RNA has been vastly underestimated for a long time. The first de-
scription of “ribozymes” showed that RNA can catalyze biochemical processes, an
activity which was only known for protein enzymes before [5]. The discovery of
micro RNAs led to a paradigm shift in our understanding of gene regulation [1].
New high-throughput experimental techniques as well as computational predictions
suggest that there are tens of thousands of so-far-unrecognized RNAs in mammalian
T. Gesell ()
Center for Integrative Bioinformatics Vienna, Max F. Perutz Laboratories,
Dr. Bohr-Gasse 9, 1030 Vienna, Austria
and
University of Vienna, Medical University of Vienna and University of Veterinary Medicine,
Vienna, Austria

422 S. Washietl and T. Gesell
cells [4, 27, 28]. Although it is still unclear whether it is justified to proclaim a mod-
ern “RNA world”, there is no doubt that RNAs have to be considered as important
key players in the cell and that the structural biology of RNAs will be of particular
importance in the next years.
The goal of the chapter is to give an overview of some of the most fundamental
principles and algorithms of RNA secondary structures with a particular focus on
their representation as graphs. There are different ways to encode RNAs as graphs
which allow for attractive algorithms for their analysis.
We start with some background information on biochemical properties of RNAs
(Sect. 17.2). Next, we show how these basic biochemical properties as well as the
commonly used classification of structural elements in RNAs can be formalized
by a definition of RNA secondary structures as outerplanar graphs (Sects. 17.3
and 17.4). The RNA folding problem, i.e., the prediction of the secondary struc-
ture for a given RNA sequence, is the main topic of this chapter. In Sect. 17.5, we
introduce a simple recursive algorithm to the combinatorial problem of counting
secondary structures, which is the basis for the different RNA folding algorithms
reviewed in Sects. 17.6–17.8. In the last two sections, we address the problem of
comparing RNA structures. We show that RNA secondary structures can be en-
coded as trees and present tree editing as a special type of graph-matching problem
to calculate distances between RNA structures. The chapter finishes with a summary
and conclusion.
17.2 Structural Properties of RNA Molecules
RNA is a polymer made of individual units called nucleotides [17]. Nucleotides con-
sist of a ribose group, a phosphate group, and one of four different bases adenine
(A), cytosine (C), guanine (G), and uracil (U). The succession of the four different
bases of the nucleotides defines the primary structure or sequence of the molecule
(Fig. 17.1). Adjacent nucleotides in the primary sequence are connected by covalent
bonds, i.e., strong chemical bonds that do not open under normal conditions. These
bonds build the “backbone” of the molecule. RNA is generally single stranded but
complementary regions in the molecule can fold back onto themselves and form
double helices similar to the well-known DNA helix. In RNA, we usually find the
so-called Watson–Crick pairs CG and AU as well as GU “wobble pairs”. The intra-
molecular base-pairing results in a pattern of double helical stretches interspersed
with unpaired regions which is called the secondary structure. Unlike the cova-
lent bonds of the backbone this base-pairing is realized by weaker hydrogen bonds
that can be opened and closed under physiological conditions. The arrangement of
secondary structure elements in space finally forms the three-dimensional tertiary
structure.
RNA folding is a hierarchical process. The secondary structure usually forms
before and independently of the tertiary structure and contributes most of the
stabilizing energy. The formation of the tertiary structure usually does not induce
changes in the secondary structure.
17 Graph Representations and Algorithms in Computational Biology 423
AAGUCUGGGCUAAGCCCACUGAUGAGUCUCUGAAAUGAGACGAAACUU C
A
U
A C
A G U G
U C U A C
A U
C GA A
UG C
C C
A C G A
A G
G G
C U
G
U
→ A C →
A
A U
C G
U A
U A
Fig. 17.1 Principles of RNA structure. The primary structure (left) is defined by the succession
of the four different nucleotide types A,C,G,U. Pairing patterns among AU, GC, and GU form
the secondary structure (middle). The secondary structure elements interact with each other in a
complex three-dimensional pattern, the tertiary structure (right). Note that in the tertiary structure
nonstandard base-pairs can occur (dashed) that are usually not considered in algorithms ana-
lyzing the secondary structure. The example shows a so-called hammerhead ribozyme, a short
self-cleaving RNA
The function of the molecule is ultimately dependent on the tertiary structure.

However, a secondary structure can serve as a coarse-grained approximation and is
an extremely useful level on which to understand RNA function.
17.3 Secondary Structure as Outerplanar Graph
An early graph-based definition of RNA secondary structure is due to Waterman [29].

Definition 1. A secondary structure is a vertex labeled graph on n vertices with an
adjacency matrix A D .aij / fulfilling:
(a) ai;i C1 D 1 for 1 i n 1.
(b) For each i , 1 i n there is at most one aij D 1 where j ¤ i ˙ 1.
(c) If aij D akl D 1 and i < k < j then i < l < j .
The first part defines the continuous “backbone” of the primary structure of the
molecule. The second part defines the secondary structure interactions and allows
each nucleotide (vertex) to be paired with at most one other nucleotide not imme-
diately adjacent in the backbone. An edge of this type .i; j /, j ¤ i ˙ 1, is called
a base-pair. A vertex i connected only to i ˙ 1 is called unpaired. The third part
of the definition excludes interactions that are (somewhat arbitrarily) classified as
tertiary structure interactions. In particular, this rule excludes structures known as
“pseudoknots”.
The molecule geometry in RNA does not allow sharp bends with unpaired
regions shorter than three. In practical applications, one usually adds additional bi-
ological reality to this definition by requiring aij D 0 if 1 < j i 3.
Secondary structure graphs following this definition are outerplanar; i.e., they
have an embedding in the plane such that all vertices lie on the boundary of its
exterior region (Fig. 17.2). The edges representing the base-pairs lie inside and do
not cross.
1 63
S
2 62
S
3 61
S
4 60
S
5 59
58
57 51 50
6 56
54 53 52 49
55
M S S H
7 41 42
B 44 45 48
8 43 46 47
S 40
9
10 S 33 34 39
35
11 S 32 36 37 38
13 12 S
S 30 31
17 16 14 I 29
18 15
S 25 28
19 H 24 26 27
20 23
21 22
48 49 50 51
46 47 52
45 53
44 54
43 S H 55
42 56
41 S B 57
40 58
39
59
38 60
37 61
36 62
35 63
34 M
S S S S
S
33 1
S
32 S 2
31 S 3
30 S 4
29 5
28
I 6
27 7
26 8
25 S 9
24 10
23 H 11
22 12
21 13
20 19 14
18 17 16 15
Fig. 17.2 Graph representation and structural elements of RNA secondary structures. H: hairpin
I: interior loop, S: stacked pair, B: bulge loop, M: multi loop. Top: Conventional drawing of the
structures as used by biochemist and molecular biologist. Bottom: Circle representation emphasiz-
ing the graph-like nature of the secondary structure. The circle represents the backbone of the RNA.
Each nucleotide is connected to its immediate neighbours within the backbone. In addition each
nucleotide can form one (and only one) base-pair to another nucleotide (arcs) or stay unpaired.
The definition of RNA secondary structures excludes pseudoknotted structures; i.e., the arcs are
not allowed to cross. The faces of the graph correspond to the different substructure elements
Similar types of graphs have been studied in a nonbiological context. For exam-
ple, they are closely related to Touchard’s linked diagrams [26] and a generalization
of Yan’s “bamboo-shoot graphs” [32].
17.4 Classification of Structural Elements
To describe and understand complex RNA secondary structures, biologists distin-

guish between different structural elements. Also for formal treatment it is helpful to
identify and classify the basic building blocks in a secondary structure. For Zuker’s
structure prediction algorithm ([38], Sect. 17.7) the so-called k-loop decomposition
[37] is used.
Definition 2. A base k is called immediately interior of the base-pair .i; j / if i <

k < j and there is no other base-pair .p; q/ such that i < p < k < q < j .
Definition 3. The base-pair .i; j / and all bases immediately interior to .i; j / is
called a loop closed by .i; j /. The number of base-pairs contained in the loop (in-
cluding the closing base-pair) is called the degree of the loop.
Loops correspond to the faces of the outerplanar secondary structure graph

(Fig. 17.2). Commonly used structural elements of RNA secondary structures can
be defined using this formalism.
Definition 4. Classification of structural elements:

A loop of degree 1 is called a hairpin.
A loop of degree 2 is called an interior loop. Let .i; j / be the closing base-
pair and .p; q/ the base-pair immediately interior. There are two special cases of
interior loops:
– stacked pair if p i D 1 and j q D 1.
– bulge if p i > 1 or j q > 1 but not both.
A loop of degree 3 is called a multiloop.
17.5 Counting Secondary Structures
The combinatorial problem of counting the number of secondary structures that can
be formed by a sequence of a given length is of particular interest. Its recursive
solution was first realized by Waterman [29, 30] 30 years ago and it is the basis for
many of the folding algorithms we describe later in this chapter.
Let x be a sequence of n nucleotides xi 2 fA,C,G,Ug, 1 i n. If we assume
a specific sequence not all positions can pair, but only those following the base-
pairing rules for RNA structures (Sect. 17.2). We use the base-pairing matrix ˘
with the entries ˘ij D 1 if sequence positions i and j can form a base-pair; i.e.,
if .i; j / is in the set of allowed base-pairs B D fGC; CG; AU; UA; GU; UGg, and
˘ij D 0 otherwise. Further, let xij be the subsequence from i to j , and Nij the
number of secondary structures that can be formed by xij .
To calculate Nij , we assume that we already know Ni C1;j , i.e., the number of
structures of a subsequence shorter by one base. A newly added base can either be
unpaired or form a base-pair with some other base k. In the first case, the unpaired
base is followed by any possible structure in subsequence xi C1;j . In the latter case,
the new base-pair divides the sequence in two subsequences xi C1;k1 and xkC1;j .
Since base-pairs do not cross (Definition 1, part (c)), both subsequences can be
treated independently and their numbers can be simply multiplied. These consider-
ations lead to the following recursion:
X
Nij D Ni C1;j C Ni C1;k1 NkC1;j (17.1)
i C1kj
˘i k D1
with Ni i D 1.
RNA secondary structure graphs lead to many other interesting combinatorial
questions (e.g., [10] and references therein) which are, however, not of immediate
relevance for most practical applications in bioinformatics.
17.6 Structure Prediction Using Simple Base-Pairing Rules
The “RNA folding” problem, i.e., the prediction of the secondary structure for a
given primary sequence, is without doubt the most relevant problem for practical
applications. Experimental determination of structures can be laborious and is not
feasible in large scale. Computational predictions are therefore widely used in the
everyday analysis of RNAs.
Thermodynamic methods for RNA folding are the most established and most
frequently used methods today. Put in simple terms, the goal is to find the struc-
ture with the most favourable folding energy. Usually, the free energy of folding
G relative to the unfolded sequence is considered. Paired regions add stabilizing
(by convention negative) energy contributions to G while unpaired regions add
destabilizing (positive) energy terms.
The first attempts to calculate optimal secondary structures for simplified energy
models are due to Nussinov and co-workers [18, 19]. In the simplest case, one can
assign each type of base-pair a negative and fixed energy contribution. Then the
problem reduces to finding the structure with the maximum number of base-pairs.
In a more sophisticated (but still largely unrealistic scenario), one assigns each type
of base-pair .i; j / a specific energy contribution ˇij . The overall energy of a fold is
the sum of all base-pair energies. In this model, we can find the minimal energy Fij
of a sequence xij using a very similar strategy as used for enumerating all structures
in (17.1). Adding one base at a time, either the new base is unpaired or it
function Backtrack(i ,j )
begin
if i > j then return
if Kij D 0 then Backtrack(i C 1,j ) else
output: (i , Ki;j )
Backtrack(i C 1,Kij 1)
Backtrack(Kij C 1,j )
end
end
Algorithm 17.1: Recursive backtracking procedure to retrieve the list of base-
pairs in the optimal structure
forms a pair with some base k. The overall minimum is the minimum of these two
cases. To obtain the minimum of the latter case in which i forms a base-pair, all pos-
sible base-pairs .i; k/ are evaluated. Each base-pair .i; k/ separates the subsequence
in two intervals and due to the independence for the minimum free energy we obtain
the following recursion:
8 9
< ˚ =
Fij D min Fi C1;j ; min Fi C1;k1 C FkC1;j C ˇi k (17.2)
: i C1kj ;
˘i k D1
This is an example of a dynamic programming algorithm frequently encountered

in bioinformatics. A matrix containing the optimal solution for all possible sub-
sequences is filled and the entry F1;n finally contains the optimal solution for the
whole sequence of length n. The algorithmic complexity of this procedure is O.n2 /
and O.n3 / in memory and CPU, respectively.
However, evaluating (17.2) gives only the minimum free energy and not the struc-
ture itself. A so-called backtracking or backtracing procedure is used to get the list
of base-pairs corresponding to the optimal energy. A helper matrix K is filled during
the recursion. We set Kij D k, where k is the base which gives the optimal secondary
structure when paired with i for a subsequence from i to j . If i is unpaired in the
optimal structure we set Kij D 0. We can then retrieve the list of base-pairs of the
optimal structure using a simple recursive procedure as shown in Algorithm 17.1.
We start with input .i; j / D .1; n/; i.e., we consider K1;n which holds the pairing
partner k of position 1 in the optimal structure of the whole sequence of length n.
K1;n D k divides the sequence in two independent subsequences which are evalu-
ated by recursively calling the same function again.
17.7 Structure Prediction Using the Loop-Based Energy Model
Although this procedure clearly gives the optimal structure in an algorithmic sense,
structure predictions obtained this way are generally not very accurate. The energy
model based on simple base-pairing rules only poorly reflects the biophysical
properties of real RNA molecules. Most of the stabilizing energy in RNA secondary
structures comes from stacking interactions of neighbouring base-pairs. A realis-
tic energy model thus needs to consider the loops in a structure (Sect. 17.4). The
so-called loop-based energy model or nearest-neighbour model assigns each loop l
in a structure S a free energy G. The total free energy of the structure is the sum
of all loops:
X
G.S/ D G.l/ (17.3)
l2S
The energy rules used in current state-of-the art prediction programs are quite
complex [15, 31] and it would be out of scope to present them in detail here. Gen-
erally, the energy depends on the type of the loop, the size of the loop, the closing
base-pairs, and the bases immediately interior of the closing base-pair. The energy
values have been determined empirically using melting experiments that measure
the energy which is required to open specific structural elements. Only stacks and
some other small loops are tabulated exhaustively. The energy rules for other types
of loops usually contain extrapolations and other approximations.
In principle, one can find the minimum free energy model using a similar strat-
egy as shown before. However, it is not sufficient to distinguish only two cases in
the recursion. Instead, all possible loop types have to be considered in a system-
atic decomposition procedure. Recursions for this problem have first been proposed
by Zuker and Stiegler [38]. Here we show a version following reference [11] that
decomposes structures in such a way that each substructure is considered exactly
once.
Figure 17.3 shows a graphical outline of the decomposition steps. The procedure
requires four matrices. Fij contains the free energy of the overall optimal structure of
the subsequence xij . The newly added base can be unpaired or it can form a pair. For
the latter case, we introduce the helper matrix Cij , that contains the free energy of the
optimal substructure of xij under the constraint that i and j are paired. This structure
closed by a base-pair can either be a hairpin, an interior loop, or a multiloop. The
hairpin case is trivial because no further decomposition is necessary. The interior
loop case is also simple because it reduces again to the same decomposition step.
The multiloop step is more complicated. The energy of a multiloop depends on the
number of components, i.e., substructures that emanate from the loop. To implicitly
keep track of this number there is need for an additional two helper matrices. Mij
holds the free energy of the optimal structure of xij under the constraint that xij
is part of a multiloop with at least one component. Mij1 holds the free energy of
the optimal structure of xij under the constraint that xij is part of a multi-loop and
has exactly one component closed by pair .i; k/ with i k < j . The idea is to
decompose a multiloop in two arbitrary parts of which the first is a multiloop with
at least one component and the second a multiloop with exactly one component and
starting with a base-pair. These two parts corresponding to M and M 1 can further
be decomposed into substructures that we already know, i.e., unpaired intervals,
N 1 N 1
j i j i
Fij =
i+1 i+1
C
k k-1
C
M1
k l
M u
Cij =
i+1
j-1
i j i j i j
Mij = C M C
u
M
j i j i j-1
j
u
M1ij = M1 C
i i j
j-1
j
Fig. 17.3 Illustration of the recursive structure decomposition steps in Zuker’s folding algorithm.
The property of a sequence with chain length N is built up recursively from the properties of
smaller segments under the assumption that the contributions are additive. The procedure requires
four matrices: Fij , Cij , Mij , and Mij1 (cf. (17.4)). Bold dashed lines indicate base-pairs, dotted lines
indicate unpaired substructures, and solid black lines indicate arbitrary structures. Please refer, to
the text for a detailed description of the procedure
substructures closed by a base-pair, or (shorter) multiloops. We can summarize the

recursion as follows:

Fij D min Fi C1;j ; min Ci k C FkC1;j
i <kj

Cij D min H.i; j /; min Ckl C I.i; j I k; l/ ;
i <k<l<j

1

min Mi C1;u C MuC1;j 1 C a
i <u<j (17.4)

Mij D min min .u i C 1/c C CuC1;j C b ;
i <u<j

min Mi;u C CuC1;j C b ; Mi;j 1 C c
i <u<j
1
˚ 1
Mij D min Mi;j 1 C c; Cij C b ;
H.i; j / is the energy for a hairpin closed by base-pair .i; j / and I.i; j I k; l/ the
energy for an interior loop closed by the two base-pairs .i; j / and .k; l/. Multiloop
energies are approximated by a simple linear relationship: EML D a C b degree C
c size. Multiloops are generally considered destabilizing. The constant a is used to
penalize opening a multiloop in the first place. The constants b and c penalize the
number of components and the size of unpaired intervals, respectively.
Using these recursions, the minimum free energy and – using an appropriate
backtracking procedure – the optimal structure under the full loop-based energy
model can be found. This approach is currently the most widely used method to
predict RNA secondary structures. The most popular implementations are mfold
[36] and RNAfold from the Vienna RNA package [9].
17.8 Prediction of Base-Pairing Probabilities
At room temperature, the energy contributions from the base-pairing in a molecule is

on the same order of magnitude as the thermal energy. As a consequence, base-pairs
can open and close and an RNA molecule does not only fold into a single structure
but forms an ensemble of different structures. Following basic principles of ther-
modynamics, the probability of a given structure S is proportional to its Boltzmann
factor:
exp.G.S/=RT /
Prob.S/ D (17.5)
Z
where T is the absolute temperature and R the universal gas constant. The normal-
ization factor Z is a particularly important quantity. It is the Boltzmann weighted
sum over all possible structures and is called the partition function:
X
ZD exp.G.S/=RT / (17.6)
S
As shown by McCaskill [16], the partition function can be calculated using sim-
ilar recursions and dynamic programming algorithms as used for calculating the
minimum free energy. For the simple base-pair energy model, the recursion to cal-
culate the partition function can be formulated as follows:
X
Zij D Zi C1;j C Zi C1;k1 ZkC1;j exp.ˇi k =RT / (17.7)
i C1kj
˘i k D1
Please note the analogy to (17.2). We can simply replace the minimum by the
sum, the sums with multiplications, and the energy contribution by its Boltzmann
factor. The value of the partition function by itself is usually not of immedi-
ate interest. In practice, the most interesting information is the probability of a
specific base-pair
P within the equilibrium ensemble, or more precisely the proba-
bility pij D .i;j /2S Prob.S/ of observing a structure S that contains the base-pair
.i; j /. To calculate pij we need to know the partition function over all structures
forming .i; j / and the total partition function Z:
b ij Zi C1;j 1 exp.ˇij =RT /=Z

pij D Z (17.8)
The helper quantity Z bij is the partition function over all structures outside the in-
terval xij . Using similar considerations as for the “forward” recursion one arrives at
X
Z b i;j C1 C
b ij D Z b k;j C1 exp.ˇk;j C1 =RT /ZkC1;i 1
Z
1k<i
˘k;j C1 D1
X
C b i;k exp.ˇk;j C1 =RT /Zj C2;k1
Z (17.9)
j C2kn
˘k;j C1 D1
A common way to summarize the structural properties of an RNA molecule in the

thermodynamic ensemble is to calculate the probability matrix of all possible base-
pairs. This matrix can be conveniently visualized as “dot-plot”. Figure 17.4 shows
an example of a pairing matrix for a short hammerhead RNA calculated with the
program RNAfold of the Vienna RNA package [9] that implements the partition
function calculations described here for the full loop-based energy model.
17.9 Tree Representations of Secondary Structures
Trees are graphs with special structural properties which have been commonly used
to represent RNA secondary structures [14]. An undirected graph is called a tree if
the graph in question is cycle free and connected. Further, in an undirected rooted
tree T , there is always a designated vertex r called the root of T for which every
edge is directed away from r. Each vertex in T is uniquely accessible from r. In an
ordered tree an ordering is specified for the children of each node. RNA secondary
structures can be encoded as rooted, ordered, labeled trees (Fig. 17.5).
In the full tree representation [8] each internal node represents a base-pair, while
leaves represent unpaired bases. The root vertex does not correspond to a physical
part of the RNA. Shapiro et al. used a more abstract encoding [21, 22] in which
internal nodes correspond to the different loop types (stack, interior loop, bulge,
multiloop, hairpin). Depending on the type of representation the labels have dif-
ferent meaning. In the following, we assume that the labels are from some finite
alphabet ˙.
G C
G C
C G
A U
U A
A
A A U
C G
C A G G A
U C C A
C G
U A C A
G G G
G A C
A C U G AU
U U C
C A U
C A
U C
G C
G G U A
C A
G C
Fig. 17.4 Base-pairing probability matrix. The area of the dots in the upper right triangle of
the matrix is proportional to the probability that a specific base-pair forms in the thermodynamic
equilibrium. The lower left triangle shows the pairing pattern in the optimal structure of minimum
free energy. Again, a hammerhead RNA is shown as an example (conventional drawing below).
The structure was calculated using the program RNAfold
17.10 Comparing Secondary Structures Using Tree Editing
Comparison of secondary structures is a common problem in RNA bioinformatics

and used, for example, to classify RNAs into families or to detect evolutionarily
conserved RNA secondary structures [33].
From a graph-theoretical point of view we are facing a graph similarity problem.
Generally, approaches to determine the structural similarity of graphs can be di-
vided into two major categories: Exact graph matching and inexact graph matching.
To match two relational structures exactly means that one has to determine isomor-
phic or subgraph isomorphic relations. Historically, Zelinka [34] was the first to
determine the distances between isomorphism classes. Then, Kaden [12] and Sobik
GC
GC
R
CG
AU
S
UA
C CG C U G A U G A GC G A A
M
UA UA
GC CG
S S
GC CG
AU C A A A U A I H
UA
U CG U A C S
CG
A C U G C G C A H
Fig. 17.5 Tree representations of RNA secondary structures. Left: The “full tree” representation
[8]. Right: Shapiro-style tree [21, 22]. R,S,M,I,H denote root, stem, multi-loop, interior loop, and
hairpin loop nodes, respectively
[23,24] extended the resulting metric to labelled graphs as well as graphs of different
orders. A well-known graph metric from the inexact graph matching paradigm was
developed by Bunke [3]. For coping with structural errors, he transformed a graph
G1 into G2 by calculating the edit costs of certain graph edit operations. Finally,
the so-called graph edit distance is defined by the minimal edit costs to transform
G1 to G2 .
Here we describe tree editing [20, 25] as a way to compare two secondary struc-
tures represented as trees. We consider three basic edit operations on a labeled
tree T . The relabel operation changes the label of a node v. The delete operation
removes a node v with parent v0 , making the children of v the children of v0 . The
insert operation is the complement of the delete operation, inserting a new node v as
child of v0 making the children of v0 the children of v. We follow the presentation in
[2], and write (l1 ! l2 ) for an edit operation and use as a special blank symbol.
If l1 ¤ and l2 ¤ it is a relabeling operation. If l2 D it is a deletion and if
l1 D it is an insertion.
Each edit operation is assigned a cost which is a metric on the alphabet
˙ [ fg. A sequence of edit operations that transforms one tree T1 into another
tree T2 is called an edit script. The cost of an edit script is the sum of the costs of
its edit operations. The edit distance ı.T1 ; T2 / is the cost of the minimum cost edit
script.
A mapping is another way of representing the editing operations between two

trees. The mapping between T1 and T2 is a binary relation M 2 V .T1 / V .T2 /
between the vertex sets of the two trees such that for any pair .v1 ; w1 /; .v2 ; w2 / 2 M
holds:
(a) v1 D v2 iff w1 D w2 (one-to-one condition).
(b) v1 is an ancestor of v2 iff w1 is an ancestor of w2 (ancestor condition).
(c) v1 is left to v2 iff w1 is left to w2 (sibling condition).
By this definition each v 2 T1 has either a unique partner w 2 T2 with .v; w/ 2 M

or no partner at all. Let N1 and N2 be the set of nodes in T1 and T2 , respectively,
that have no partner in the other tree. The cost of M is then given by:
X X X
.M / D .v ! w/ C .v ! / C . ! w/ (17.10)
.v;m/2M v2N1 w2N2
Mappings are relations and can be composed. Let T1 , T2 , T3 be three trees and
M1 and M2 the mapping of T1 to T2 and T2 to T3 , respectively. Then
˚ ˇ
M1 ı M2 D .v; w/ ˇ 9u 2 V .T2 / that .v; u/ 2 M1 and .u; w/ 2 M2 (17.11)
is a mapping of T1 to T3 . The function is a metric and one can show that the
minimum cost mapping is equivalent to the minimum cost edit script, i.e., the edit
distance ı.
To calculate ı, we need to calculate the minimum cost mapping. As it turns out,
this problem can be solved using again simple recursions and a dynamic program-
ming algorithm. Formally, we need to extend the definitions above to forests as roots
can be deleted turning the ordered tree into an ordered forest. Likewise two trees in
a forest can be merged by inserting a new root. Let F be a forest and v be a node
in F . In the following we write F v for the forest that is obtained be deleting v,
F T .v/ the forest that is obtained by deleting v and its descendants, and F .v/ for
the set of trees that have the children of v as their roots.
Let F1 and F2 be two forests and v and w the root of the rightmost tree in F1
and F2 , respectively. M is the optimal mapping between F1 and F2 . There are three
possibilities: (1) v has no partner in M , then the optimal mapping is the mapping
between F1 v and F2 and a deletion of v. (2) w has no partner in M then the
optimal mapping is the mapping between F1 and F2 w with w inserted. (3) Both
v and w have partners. Using the definition of mappings and considering the fact
that both v and w are by construction the rightmost roots it is easy to show that
this implies .v; w/ 2 M . The edit distance can be computed using the following
recursions corresponding to the three different cases.
8
ˆ
<ı.F1 v; F2 / C .v ! /
ˆ
ı.F1 ; F2 / D min ı.F1 ; F2 w/ C . ! w/
ˆ
:̂ı.F .v/; F .w// C ı.F T .v/; F T .w// C .v ! w/
1 2 1 1 2 2
The recursion is initialized with the edit distance between two empty forests
ı.; / D 0. The cases of one tree being empty is handled as follows
ı.F1 ; / D ı.F1 v; / C .v ! /
ı.; F2 / D ı.; F2 w; / C . ! w/
These recursions can be used as the basis for a dynamic programming

algorithm to compute the optimal mapping. It can be shown that the time com-
plexity is bounded by O.jF1 j2 jF2 j2 /. Various improvements can speed up the
algorithm [13, 35]. Implementations for the algorithms are provided by the program
RNAdistance of the Vienna RNA package [9].
Structural analysis of RNAs is a common problem in computational biology. RNA

secondary structure can be regarded as a coarse-grained approximation of its three-
dimensional structure that captures important biological features of the molecule.
Secondary structures can be encoded as labeled outerplanar graphs. In its sim-
plest form, Nussinov’s algorithm finds the graph with the maximum number of
edges for a given labelling. This algorithm is a simple way of addressing the RNA
folding problem. In practice, the more sophisticated Zuker algorithm is used that
does not consider base-pairs independently but the structural elements formed by
neighbouring base-pairs. In other words, it considers the faces of the graph rather
than the mere edges. Empirical folding energy contributions are assigned to the faces
and a recursive algorithm calculates the structure with the optimal folding energy.
McCaskill’s algorithm is a closely related variant that calculates the partition func-
tion of all structures in a thermodynamic ensemble. This quantity can be used to
calculate equilibrium base-pair probabilities.
In order to compare two secondary structures it turned out to be useful to encode
the structures as trees. This allows us to use different tree distance measures like
tree editing for their comparison.
The topic presented in this chapter is a relatively rare example from com-
putational biology where concepts from discrete mathematics can be seamlessly
combined with biophysical knowledge to successfully address complex problems
of highly practical relevance like the prediction of molecule structures. There are
alternative ways to address the problems presented in this chapter, most notably
approaches based on stochastic context-free grammars [6, 7]. Such probabilistic
machine-learning-based approaches are becoming increasingly popular. However,
although these methods follow a completely different paradigm for RNA modelling,
they all build upon similar graph representations and – at their core – surprisingly
similar algorithms are at work.
Acknowledgements Funding from the Austrian GEN-AU projects “noncoding RNA” and “Bioin-
formatics Integration Network” as well as financial support to the CIBIV institute from the Wiener
Wissenschafts-, Forschungs- and Technologiefonds (WWTF) is gratefully acknowledged.
References
1. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116(2):
281–297
2. Bille P (2005) A survey on tree edit distance and related problems. Theor Comput Sci 337
(1–3):217–239
3. Bunke H (1983) What is the distance between graphs? Bull EATCS 20:35–39
4. Carninci P et al (2005) The transcriptional landscape of the mammalian genome. Science
309(5740):1559–1563
5. Doudna JA, Cech TR (2002) The chemical repertoire of natural ribozymes. Nature
418(6894):222–228
6. Dowell RD, Eddy SR (2004) Evaluation of several lightweight stochastic context-free gram-
mars for RNA secondary structure prediction. BMC Bioinformatics 5:71
7. Eddy SR, Durbin R (1994) RNA sequence analysis using covariance models. Nucleic Acids
Res 22(11):2079–2088
8. Fontana W, Konings DA, Stadler PF, Schuster P (1993) Statistics of RNA secondary structures.
Biopolymers 33:1389–1404
9. Hofacker IL, Fontana W, Stadler PF, Bonhoeffer LS, Tacker M, Schuster P (1994) Fast folding
and comparison of RNA secondary structures. Monatsh Chem 125:167–188
10. Hofacker IL, Schuster P, Stadler PF (1998) Combinatorics of RNA secondary structures. Dis-
crete Appl Math 89:177–207
11. Hofacker IL, Stadler PF (2007) RNA secondary structures. In: Lengauer T (ed) Bioinformatics:
from genomes to therapies, vol 1. Wiley-VCH, Weinheim, Germany, pp 439–489
12. Kaden F (1982) Graphmetriken und Distanzgraphen. ZKI-Informationen Akad Wiss DDR
2(82):1–63
13. Klein P (1998) Computing the edit distance between unrooted ordered trees. In: Bilardi G,
Italiano GF, Pietracaprina A, Pucci G (eds) Algorithms – ESA ’98, Proceedings of 6th annual
European symposium, Venice, Italy, 24–26 August 1998. Lecture Notes in Computer Science,
vol 1461. Springer, Heidelberg, pp 91–102
14. Le SY, Nussinov R, Maizel JV (1989) Tree graphs of RNA secondary structures and their
comparisons. Comput Biomed Res 22(5):461–473
15. Mathews DH, Sabina J, Zuker M, Turner H (1999) Expanded sequence dependence of ther-
modynamic parameters provides robust prediction of RNA secondary structure. J Mol Biol
288:911–940
16. McCaskill JS (1990) The equilibrium partition function and base pair binding probabilities for
RNA secondary structure. Biopolymers 29:1105–1119
17. Nelson DL, Cox MM (2004) Lehninger principles of biochemistry, 4th edn. W.H. Freeman,
New York
18. Nussinov R, Jacobson AB (1980) Fast algorithm for predicting the secondary structure of
single-stranded RNA. Proc Natl Acad Sci USA 77(11):6309–6313
19. Nussinov R, Piecznik G, Griggs JR, Kleitman DJ (1978) Algorithms for loop matching. SIAM
J Appl Math 35(1):68–82
20. Selkow SM (1977) The tree-to-tree editing problem. Inf Process Lett 6(6):184–186
21. Shapiro BA (1988) An algorithm for comparing multiple RNA secondary stuctures. CABIOS
4:387–393
22. Shapiro BA, Zhang K (1990) Comparing multiple RNA secondary structures using tree com-
parisons. CABIOS 6:309–318
23. Sobik F (1982) Graphmetriken und Klassifikation strukturierter Objekte. ZKI-Informationen

Akad Wiss DDR 2(82):63–122
24. Sobik F (1986) Modellierung von Vergleichsprozessen auf der Grundlage von
Ähnlichkeitsmaßen für Graphen. ZKI-Informationen Akad Wiss DDR 4:104–144
25. Tai K (1979) The tree-to-tree correction problem. J ACM 26:422–433
26. Touchard J (1952) Sur un problème de configurations et sur les fractions continues. Can J Math
4(6894):2–25
27. Washietl S et al (2007) Structured RNAs in the ENCODE selected regions of the human
genome. Genome Res 17(6):852–864
28. Washietl S, Hofacker IL, Lukasser M, Hüttenhofer A, Stadler PF (2005) Mapping of conserved
RNA secondary structures predicts thousands of functional non-coding RNAs in the human
genome. Nat Biotechnol 23:1383–1390
29. Waterman MS (1978) Secondary structure of single-stranded nucleic acids. Studies on founda-
tions and combinatorics. Advances in Mathematics Supplementary Studies. Academic Press,
New York, 1:167–212
30. Waterman MS, Smith TF (1978) RNA secondary structure: a complete mathematical analysis.
Math Biosci 42:257–266
31. Xia T, SantaLucia J, Burkard ME, Kierzek R, Schroeder SJ, Jiao X, Cox C, Turner DH (1998)
Thermodynamic parameters for an expanded nearest-neighbor model for formation of RNA
duplexes with watson-crick base pairs. Biochemistry 37(42):14719–14735
32. Yan L (1995) A family of special outerplanar graphs with only one triangle satisfying the cycle
basis interpolation property. Discrete Math 143(1–3):293–297
33. Yao Z, Weinberg Z, Ruzzo WL (2006) CMfinder – a covariance model based RNA motif
finding algorithm. Bioinformatics 22(4):445–452
p̆est Mathematiky 100:371–373
35. Zhang K, Shasha D (1989) Simple fast algorithms for the editing distance between trees and
related problems. SIAM J Comput 18:1245–1262
36. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nu-
cleic Acids Res 31(13):3406–15
37. Zuker M, Sankoff D (1984) RNA secondary structures and their prediction. Bull Math Biol
46:591–621
38. Zuker M, Stiegler P (1981) Optimal computer folding of larger RNA sequences using thermo-
dynamics and auxiliary information. Nucleic Acids Res 9:133–148
Chapter 18
Inference of Protein Function from the Structure
of Interaction Networks
Oliver Mason, Mark Verwoerd, and Peter Clifford
Abstract We consider the problem of using graph-theoretical techniques to predict

the function of unannotated proteins in an organism’s proteome. Specifically, we
present an overview of the major methods for predicting protein function based
on interaction network structure and describe an abstract framework within which
these methods can be treated in a unified fashion. We also present a comparison of
the proposed methods and highlight some open theoretical and practical questions
in the area.
Keywords Protein function prediction Graph algorithms Graph multicuts

Markov random fields
MSC2000: Primary 46N60; Secondary 05C85, 05C90
18.1 Introduction: Functional Classification and Protein

Interaction Networks
The past decade has witnessed enormous advances in experimental methodologies

within the life sciences [4, 37, 39]. These advances have significant implications for
the future practice of biology and related disciplines. The systems being studied
and the questions being addressed in contemporary biology are more intricate and
complex than ever before. With modern experimental techniques, it is possible to
investigate living systems in a manner and at a level of detail that would have been
unthinkable 50 years ago. In turn, this has generated a need for novel ways of think-
ing about the systems being considered and of assimilating the data being made
available.
Arguably the most noticeable aspect of recent developments in biology is that
the volume and nature of the data being generated are unprecedented. This latter
O. Mason ()
Hamilton Institute, NUI Maynooth, Maynooth, Ireland

440 O. Mason et al.
fact has led in a natural way to the recognition within the life sciences of a pressing
need for a closer and mutually beneficial interaction between computational and
mathematical scientists on the one hand and biologists on the other. It is important
to appreciate that these developments pose challenges and opportunities for both
experimental and theoretical scientists. Although modern biology now needs the
computational methods and theoretical frameworks provided by the mathematical
sciences, it is equally true that mathematicians and computational scientists need to
recognise that biological systems are substantially different from the physical and
engineering systems that have historically been the main focus of applied mathe-
matics. Old methods and tools cannot simply be dusted off and applied to this new
project [22, 36]; novel approaches and techniques are required, specifically tailored
to and inspired by biological problems.
Our purpose in the current chapter is to provide an introduction to one such prob-
lem that has been the focus of much attention in the field of computational biology
in the recent past. Specifically, we are concerned with the problem of assigning
functions to newly discovered genes and proteins [18, 35]. Although the number
of completely sequenced genomes has grown steadily over the past decade, many
fundamental questions still remain. One of the most significant of these relates to
determining the biological function of the gene products or proteins identified in
this process. At the time of writing, even for simple organisms such as S. cerevisiae
approximately 20% of the organism’s proteins have no assigned function [35]; such
proteins are said to be unannotated.
In the following section, we expand on what is to be understood by the notion of
protein function. For now, we simply note that, in view of the significant numbers
of unannotated proteins even for simple organisms, a major challenge for computa-
tional biology is to devise methods to reliably assign functions to these proteins
based on plausible biological hypotheses and the known functions of annotated
proteins. Unsurprisingly, there has been a considerable amount of interest in this
problem since the publication of sequenced genomes, and a variety of approaches
have been proposed. Early approaches made use of tools such as BLAST or PSI-
BLAST [1, 2] to predict function based on sequence similarity to proteins of known
function. Other methods based on phylogenetic profiles and gene co-expression pat-
terns have also been proposed [28, 43]. In keeping with the overall theme of this
book, we focus here on graph-theoretical methods that seek to exploit recently com-
piled networks of protein–protein interactions (PPI) to assign protein function. We
describe some of the main such methods and the principles on which they are based
in Sects. 18.3 and 18.4 below. In the interests of brevity, we shall largely focus on
direct methods and not describe techniques based on clustering methods such as
those presented in [8, 29, 30] (although we shall briefly describe one such method in
Sect. 18.5).
The structure of the chapter is as follows. In the next section, we describe the bio-
logical background to the problem of protein function assignment, and then present
a mathematical formulation of the problem in Sect. 18.3. In Sect. 18.4 we describe
several studies that have provided evidence of a connection between network topol-
ogy and protein function. Section 18.5 is concerned with discussing some of the
18 Inference of Protein Function from the Structure of Interaction Networks 441
main graph-based algorithms for protein function assignment and highlighting some
difficulties and open questions to which they give rise. In Sect. 18.6, we discuss a
number of numerical studies comparing the various methods described throughout
the chapter. Finally, in Sect. 18.7 we present some concluding remarks about the
computational and graph-theoretical challenges arising from the problem of protein
function assignment.
18.2 Functional Annotation and Protein Interaction Networks
To facilitate the application of computational methods in biology, there is a clear

need for consistent terminology and notation suitable for automated methods. The
problems that arise when different databases employ inconsistent notations, un-
suitable for computation, are clear. It is patently obvious that effective algorithms
for assigning functions to proteins cannot be developed if there is ambiguity in
the meaning of the term “function” itself. With the completion of whole-genome
sequencing projects, attention naturally focussed on providing a consistent, unam-
biguous terminology for classifying the biological function of all proteins within an
organism. This in itself is not a straightforward task and the various issues and diffi-
culties involved in developing an unambiguous functional terminology are discussed
in the paper [18]. At the time of writing, a variety of comprehensive annotation
schemes have been developed [3, 10, 21, 32]. To illustrate the basic ideas behind
these, we describe two of the most widely adopted schemes: namely the Gene
Ontology (GO) scheme [3] and the Functional Catalogue (FunCat) [32].
18.2.1 The Gene Ontology Consortium and MIPS

Functional Catalogue
The GO classification scheme consists of three basic categories, which describe

different aspects of a gene product’s functionality within the cell. The first of
these is molecular function and is defined in [3] as being the biochemical activ-
ity of the protein or gene product. Examples of general molecular function include
“enzyme” or “transporter” for example. Essentially, molecular function concerns
the specific action of the given protein without reference to the higher level bi-
ological processes in which it plays a role. These are the concern of the second
category within the GO scheme: biological process. The terms in this category de-
fine higher level activities usually comprised of several molecular functions, and
examples include “cell growth” and “signal transduction”. Finally, the third cate-
gory within the scheme is “cellular component”, which describes where in the cell
a particular gene product is active. Every term in the GO categories has a unique
numerical identifier or key of the form “GO:xxxxxxx”. The GO project itself is
the result of a collaboration between numerous databases around the world and
442 O. Mason et al.
has been running since 1998. The project is ongoing and is added to and updated
on a regular basis. For more information, the interested reader should consult ei-
ther the original reference [3] or the excellent documentation on the GO website
http://www.geneontology.org/.
The second annotation scheme – FunCat – was initially developed as part of
the S. cerevisiae genome project at MIPS but has since been broadened to include
annotations for several other eukaryotic and prokaryotic organisms [32]. FunCat is
structured differently to the GO scheme and is essentially organised as a number
of tree-like hierarchies. At the coarsest level, there are 28 different basic functional
categories including “metabolism”, “storage”, “protein synthesis”, and “cell type
differentiation”. Each of these corresponds to a tree consisting of successively more
specific functions. Each function within the annotation scheme is assigned a unique
numerical identifier that indicates which broad category it belongs to and its place in
the hierarchy. For instance, the broad category metabolism is assigned the identifier
01; at the next level down the hierarchy amino acid metabolism is assigned the
identifier 01.01; at one level lower again, we find “metabolism of the glutamate
group” with the identifier 01.01.03; the more specific “metabolism of glutamine”
is assigned 01.01.03.01 while at the most specific level biosynthesis of glutamine
and degradation of glutamine are assigned 01.01.03.01.01 and 01.01.03.01.02,
respectively.
Constructing comprehensive and convenient annotation schemes is only one step,
albeit a vital one, in the annotation of gene products; the proteins of an organism
must next be assigned to some functional category within the scheme. Essentially,
once the genome of an organism has been sequenced each protein identified must
have some collection of terms in either the GO scheme or the FunCat scheme as-
signed to it. As mentioned in the introduction, even for simple organisms this second
task is far from complete; however, for many organisms a significant fraction of their
proteome is annotated. Our interest is in combining this information with knowledge
of protein interactions to make sensible predictions for the functions of unannotated
proteins.
18.2.2 Protein–Protein Interaction Networks
A significant outcome of the experimental advances made in recent years has been
the construction of large-scale networks detailing the physical and biochemical in-
teractions among the genes, proteins, and metabolites within the cell [25]. In partic-
ular, the development of high-throughput techniques for detecting PPI such as yeast-
2-hybrid [17] or tandem-affinity purification with mass spectrometry (TAP-MS)
[14] has led to the generation of detailed maps of PPI for a growing number of
simple organisms. Essentially a PPI network is an undirected graph with nodes rep-
resenting the proteins in an organism and edges representing physical interactions
between proteins. At the time of writing, the organisms for which PPI networks have
been constructed include S. cerevisiae, D. melanogaster, C. elegans, and H. pylori

[15, 24, 26, 31, 40] and data on these networks can be obtained from a variety of
regularly updated databases such as DIP [41] or MIPS [26].
The construction of PPI networks has generated considerable interest in elucidat-
ing the structural properties of these networks, identifying common features, and re-
lating network structure to biological phenomenology. In particular, properties such
as degree distributions, clustering, and modularity have attracted attention [5]. On
the biological implications of network structure, the possible connection between
the structural role of a protein within the network and its biological importance, as
measured by its essentiality to the organism’s survival or its impact on growth rate,
has been thoroughly investigated [19, 42]. The work discussed in the remainder of
this chapter is along similar lines and concerns relating the structure of PPI networks
to biological function.
More specifically, we have already mentioned that, even for simple organisms,
significant numbers of proteins remain unannotated and that assigning functions
to these proteins is a central problem in modern biology. Recently, several re-
searchers have attempted to exploit graph-based algorithms to predict functions
for unannotated proteins based on their position within the PPI network and the
functions of annotated proteins in the network. The experimental evidence support-
ing the assumption that interaction network structure contains functionally relevant
information is presented in Sect. 18.4. In the following section, we present some
mathematical background as well as a more formal statement of the problem
considered.
18.3 Mathematical Formulation and Preliminaries
18.3.1 Notation and Mathematical Background
Throughout, R denotes the field of real numbers and RC denotes the set of non-
negative real numbers. For finite sets S; T , S T denotes the usual Cartesian product
of S and T , while jS j denotes the cardinality of S and 2S represents the power set of
S consisting of all subsets of S . For a function f W S ! T and a subset R S , f jR
denotes the restriction of f to R. Also, for sets S and T , S nT D fx 2 S W x … T g
denotes the set difference of S and T , while S 4T denotes the symmetric difference
of S and T given by .S [ T /n.S \ T /.
The PPI networks we consider in this chapter are naturally modelled as finite
undirected graphs. For background on basic concepts and notation, consult [12].
Unless stated otherwise, we use the notation G D .V; E/ for a finite undirected
graph where V is the vertex set and E denotes the set of edges. Also, the notation
uv denotes the edge between vertices u and v in V if such an edge exists. In this
case, we also say that u and v are neighbours or level-1 neighbours.
444 O. Mason et al.
For an undirected graph, G D .V; E/ and a vertex, u 2 V , the set of all

neighbours of u is denoted N.u/ and given by
N.u/ D fv 2 V W uv 2 Eg:
We denote paths by the list of vertices occurring along the path. For instance,
u D v1 ; : : : ; vm D v denotes a path of length m 1 between u and v, where
vi vi C1 2 E for i D 1; : : : ; m 1. As usual, we say that a graph is connected if
there is a path between any pair .u; v/ of vertices in V . When dealing with real
PPI network data, it is typical to work with the largest connected component of
the graph. In fact, most data sets consist of a single very large component with a
number of other components of significantly smaller size. Thus, in the interests of
simplifying terminology, we shall always assume that the graphs we deal with are
connected.
The distance d.u; v/ between any two nodes in V is defined to be the length of
the shortest path between u and v (by default d.u; u/ D 0). Given a node u and a
positive integer k, the k-neighbourhood of u is the set of all nodes v ¤ u in V with
d.u; v/ k, and is denoted by N k .u/. We refer to nodes v with d.u; v/ D k as
level-k neighbours of u.
18.3.2 Protein Function Prediction: Formal Statement
The problem of protein function prediction (PFP) is a rich source of challenging

graph-theoretical questions, many of which are open, with interesting connections
to other branches of applied graph theory. However, although various graph-based
algorithms have been proposed, as yet no standard formal notation for the problem
has been adopted. In the interests of clarity and to highlight how the various ap-
proaches described later fit within the one framework, we now state in a formal way
the problem of PFP.
Let the following four items be given:
An undirected connected graph G D .V; E/ representing the PPI network
A finite set F D ff1 ; : : : ; fk g representing the distinct terms in some annotation
scheme such as FunCat or GO
A partition of the vertex set V D Va [ Vu in which Va contains the annotated
proteins and Vu contains the unannotated proteins in the network
A mapping W Va ! 2F nf;g defined on Va taking nonempty values in the
power set of F representing the functions assigned to the annotated proteins in
the network.1
1
See Sect. 18.6 for a remark concerning the completeness of the annotation given by .
The essence of the problem of PFP is to extend to the whole of V , formally, to

define O W V ! 2F nf;g such that the restriction O jVa D . We use the notation O
to denote the set of all such extensions.
Throughout the remainder of this chapter, the notation G D .V; E/, Va , Vu , F ,
, O , O is used exclusively in this way.
Clearly the set O is going to be too large for practical purposes and more crite-
ria on O need to be specified in order to generate biologically plausible extensions.
These additional criteria should be based on biologically plausible assumptions for
which there is experimental evidence. In the next section, we describe the funda-
mental principles that underpin all of the graph-based approaches to PFP proposed
in the recent past.
For now, we continue to develop the abstract framework of PFP. Most of the al-
gorithms that we consider later follow a similar basic scheme. For each unannotated
protein u 2 Vu , a score function u W F ! RC is defined with u .f / indicating
the likelihood that u actually has the function f . The functions f in F are then
ranked in descending order of u .f / and the extension O can be defined in one of
two ways:
O .u/ D ff 2 F W u .f / g (18.1)
for some specified threshold , or else by choosing the functions corresponding to

the highest m values of u .f /, so that j O .u/j D m and
minfu .f / W f 2 O .u/g maxfu .f / W f … O .u/g: (18.2)
What distinguishes the various algorithms is the principles used to generate the
score function and corresponding ranking scheme on F . In Sect. 18.5 we dis-
cuss several different such ranking schemes and their corresponding algorithms for
functional annotation. However, in the next section we discuss the evidence for a
connection between network topology and protein function and identify the key as-
sumptions underlying all graph-based PFP algorithms.
18.4 Topology and Protein Function
The fundamental idea behind the use of PPI to predict function is quite simple;
proteins that interact with each other are likely to share functionality. In essence
this is analogous to the concept that individuals within an organization who meet
regularly are more likely to be involved in performing similar tasks. This core idea
is in itself biologically plausible and its validity has been investigated by a number
of researchers. Specifically, attention has focussed on the tendency of a protein u
within a PPI network G D .V; E/ to share functions with the proteins or nodes
belonging to the k-neighbourhoods N k .u/ of u for different (positive integer) values
of the parameter k.
446 O. Mason et al.
An early, and influential, study of this kind appeared in the paper [34].
Specifically, the authors of this paper used publicly available data on PPI in yeast
and the annotation scheme of the Yeast Proteome Database [10] to investigate the
tendency of a protein to share functions with its immediate neighbours. The YPD
classification scheme used was based on cellular role and is similar to the “biologi-
cal process” categorization in the GO scheme described above. In [34], the authors
first focussed on the annotated proteins within the network; in our terminology, on
the induced subgraph on the set of vertices Va . For each u 2 Va , the functions of the
neighbouring vertices in N.u/ \ Va were ranked in descending order of frequency
and the three most commonly occurring functions were postulated as potential func-
tions for u. If any of these predicted functions corresponded with a known function
of u, the prediction was deemed to be correct. Promisingly, this simple scheme led
to “correct” predictions for 72% of the vertices in Va . Moreover, to test the degree
to which protein function was dependent on the actual topology of the network,
the authors “shuffled” or scrambled links between the nodes in the network in a
random manner. They report that on average for the randomized networks, the rate
of correct predictions was as low as 12%.
In addition to simply checking if an annotated protein in Va shares function with
some of its immediate neighbours, some slightly more sophisticated measures of
functional similarity can be investigated. For instance, the functional similarity [9]
of u; v in Va has been defined as
j .u/ \ .v/j
F S.u; v/ D : (18.3)
j .u/ [ .v/j
Using functional annotation data obtained from the FunCat database in January
2008, we have investigated the average of F S.:; :/ over pairs of interacting and non-
interacting proteins in a network of protein interactions in yeast obtained from the
Database of Interacting Proteins [41] in January 2008. The average taken over non-
interacting pairs was 0.015042, while the average for interacting pairs of proteins
was an order of magnitude higher at 0.15155.
The last observation and the results reported in [34] lend experimental support
to the hypothesis that interacting proteins tend to share functions and to the gen-
eral idea of exploiting interaction data to predict protein function. Further evidence
of this nature was subsequently presented in [16] and then more recently in [9].
This latter paper also investigated more closely the relationship between a protein’s
functions and those of its level-2 neighbours in N 2 .u/nN.u/. Using the FunCat
scheme of annotation, and interaction data obtained from the Munich Information
Center for Protein Sequences, the authors of [9] found that proteins are significantly
more likely to share functions exclusively with level-2 neighbours than they are to
share function exclusively with their level-1 neighbours. The findings reported in
[9] add to earlier evidence described in [7, 33] that the functions of level-2 neigh-
bours N 2 .u/nN.u/ of a protein are also potentially useful indicators of the functions
of u. It should also be noted that the authors of [9] introduce a novel topological
measure for the degree of functional similarity between two proteins u and v in V .
We describe this and an associated algorithm for function prediction in more detail
in the following section.
The discussion in the previous two paragraphs should have made fairly clear
the general principle on which graph-based protein function prediction is based;
namely:
Given an unannotated u in Vu , the functions assigned in O .u/ should be “similar” to the
assigned functions of the level-1 and level-2 neighbours of u.
The above principle is still stated in a relatively loose fashion; it is the particular
interpretation of the word “similar” that determines the unique approach of each
specific algorithm for PFP. In the next section, we describe in detail several of the
more significant of these to have emerged recently.
18.5 Graph-Based Algorithms for PFP
18.5.1 Majority Rule
In light of the observations made above, the simplest approach to predicting func-
tions for an unannotated protein u in an interaction network G D .V; E/ would be to
rank functions based on the frequency with which they occur among the annotated
neighbours of u. This is the approach taken in the so-called majority rule described
in [34].
The score function for the majority rule is defined as follows. For u 2 Vu and
f 2 F , u .f / is defined to be the total number of occurrences of f among the
annotated neighbours of u. Formally,
u .f / D jfv 2 Va \ N.u/ W .v/ D f gj:
In keeping with the general framework outlined in Sect. 18.3, the functions with the
highest values of u .f / are assigned to u.
The two principal advantages of the majority rule are its simplicity and the fact
that it directly relates to the core biological hypothesis that interacting proteins
should have similar functionality. However, it also has several obvious drawbacks.
As it only considers annotated neighbours of unannotated proteins, it is unable to
make any prediction for proteins with no annotated neighbours. A further significant
disadvantage also arises from the fact that it only takes into account interactions be-
tween vertices in Vu and Va . This can indirectly lead to the very principle on which
it is based being violated. To see this consider the fragment shown in Fig. 18.1.
Here the solid nodes are annotated and belong to Va while the two unshaded
nodes are unannotated and belong to Vu . Suppose the annotated neighbour of u is
annotated with a function fi , while the two annotated neighbours of v and w are
annotated with a function fj ¤ fi . Then, following the majority rule, we would
assign the function fi to u and fj to v and w. But then u would have been assigned
448 O. Mason et al.
Fig. 18.1 Difficulties with

the majority rule
v w
the function fi while the majority of its neighbours would be annotated with the
different function fj . Although this example is overly simplistic, it illustrates this
fundamental problem with the majority rule. Another problem with this approach is
that it fails to take into account all of the information known about the annotated part
of the network. In particular, the frequency with which the various functions actually
occur for the annotated nodes is ignored. As this frequency can vary considerably
from function to function, this information should play some role in determining the
most likely functions for the unannotated nodes in Vu .
18.5.2 Chi-Squared Scheme
An attempt to address the final issue mentioned in the previous paragraph was made
in [16]. The algorithm described in this paper allows nodes in a k-neighbourhood
of an unannotated protein to be taken into account and ranks functions based on a
chi-squared score rather than a simple count. However, as noted in [9], the reliability
of predictions tends to decline dramatically when nodes at a distance greater than 2
are used to predict function. For this reason, and in the interests of simplicity, we
describe the method of [16] for the case of immediate neighbours only. In any case,
the extension to the more general case is obvious.
For each function f 2 F , let f denote the fraction of annotated nodes in the
network that are annotated with f :
jfw 2 Va W .w/ D f gj
f D :
jfVa gj
Also, for any u 2 Vu , let nu D jVa \ N.u/j, nfu D jfv 2 Va \ N.u/ W .v/ D f gj.
Then the score function for the chi-squared scheme is given by
.nfu f nu /2
u .f / D :
f nu
As with the majority rule, the functions f assigned to u are those corresponding to
the largest values of u .f /.
Before proceeding to more complicated approaches to PFP, at this point it is

appropriate to make some observations on the majority and chi-squared schemes.
1. Although the chi-squared scheme allows annotated nodes other than immediate
neighbours to be used, it still suffers from the limitation of only considering
annotated nodes in constructing the extension O of . This can lead to similar
problems to that illustrated in Fig. 18.1. Also, although the chi-squared scheme
may appear to address some of the limitations of the basic majority scheme, the
justification for the use of the chi-squared statistic in this context is unclear.
2. It is worth keeping in mind that all of the methods described here are essentially
trying to accomplish the same task: namely ranking the potential functions in F
for an unannotated node in Vu . A number of theoretical questions naturally arise
as to how the different ranking schemes relate to each other. For example, when
will the methods give rise to the same predictions for an unannotated protein?
f
It is trivial to see that if for u 2 Vu , the ratio nunu is constant for all f 2 F ,
f
then both the majority rule and the chi-squared scheme will give rise to the same
ranking on F . In fact, if the sum
nfu f nu
C f
f nu nu
is constant, the same is true.

3. Another important question relates to how sensitive the various ranking schemes
are to inaccurate network data. This is particularly vital in view of the known
issues with high-throughput techniques such as yeast-2-hybrid which have been
used to generate the interaction networks. Attempts to evaluate the robustness of
ranking schemes to data inaccuracies have been made in [7, 9, 34] but there are
no substantial theoretical studies on this topic at the time of writing.
18.5.3 Maximally Consistent Assignments and Functional Flow
We now discuss three basic extensions of the majority rule assignment, which we
shall refer to respectively as (V) the Vazquez method, (K) the Karaoz method, and
(N) the Nabieva method. Methods (V) and (K) pose the protein assignment problem
as an optimization problem, the objective of which is to minimize the number of “in-
consistent” edges. The methods differ mainly in the way they define inconsistency.
In the Vazquez method, the notion of an inconsistent edge is defined with respect to
an assignment (given an assignment , an edge e D .u; v/ is said to be inconsis-
tent if .u/\ .v/ D ;), whereas in the Karaoz method, it is defined with respect to
a function f (given a function f 2 F , an edge .u; v/ is said to be consistent if either
f 2 .u/ \ .v/ or f 62 .u/ [ .v/ and inconsistent otherwise). This observa-
tion suggests that, even though these methods are sometimes considered variations
of the same idea [27], they may in fact not be as closely related as they would seem
450 O. Mason et al.
at first sight. The Nabieva method is somewhat different from the other two, in the
sense that it is not an optimization-based method. Rather, it employs the notion of
functional flow to describe how nodes that are sufficiently close to one another can
inherit (a fraction of) each other’s functional annotation.
The Vazquez Method
The Vazquez method was introduced in [38]. The basic idea is as follows. Let W
Va 7! 2F n; be given and let O denote the set of all extensions of to the whole
of V . Consider the functional E W O 7! RC ,
Xˇ ˇ
E. O / WD ˇfu 2 N.v/ W O .u/ \ O .v/ ¤ ;gˇ:
v2Vu
We say that an assignment O 0 is maximally consistent if E. O / E. O 0 / for all

O 2 O . In general, finding maximally consistent assignments is computationally
intractable. Regardless, let us suppose we can compute the set of all maximally
consistent assignments and let this set be given as f O 1 ; O 2 ; : : : ; O m g. Then we can
define a scoring function W F 7! RC , as follows:
1 ˇˇ ˇ
u .f / WD fi W O i .u/ D f gˇ:
m
To avoid the computational problems associated with determining maximally con-
sistent assignments, the authors of [38] employ a stochastic optimization technique
called simulated annealing to compute approximations to the maximally consistent
assignments. Using this technique they generate 100 assignments f Q 1 ; : : : ; Q 100 g
at random (note that the method does not guarantee that Q i 6D Q j for all .i; j / so
the solution set may contain multiple copies of the same solution) and then define a
scoring function Q as follows:
1 ˇˇ ˇ
Qu .f / WD fi W Q i .u/ D f gˇ:
100
To assess the performance of the method, the authors follow a common approach.
They apply the algorithm to a test set Vtest Va comprising only annotated nodes,
which, for the purpose of assessment, are treated as if unannotated. For a given node
v 2 Vtest , a prediction is considered successful if Q .v/ 2 .v/. The rate of success
is defined as the ratio of the number of successful predictions to the total number of
predictions, jVtest j (this is analogous to the specificity measure (18.7) defined below).
The authors show that, roughly speaking, the likelihood of the method making a
successful prediction increases with the degree of a node. The results indicate that
the Vazquez method outperforms the Majority Rule in terms of overall success rate,
although the percentage difference between the two is on average no more than 10%,
and 20% at best.
The Karaoz Method
The Karaoz method was introduced in [20]. The basic idea is as follows. Let W
Va 7! 2F nf;g be given. We define W Va F 7! f0; 1gjVa j , as follows:
(
1 if f 2 .u/I
.u; f / WD
0 otherwise:
Let O W V 7! f0; 1gjV j be an extension of to the whole of V , and denote by ˙O the

set of all such extensions. We define the cost functional E W ˙O F 7! RC
Xˇ ˇ
O f / WD
E.; ˇfu 2 N.v/ W .u; O f /gˇ
O f / D .v;
v2V
We say that an assignment O 0 2 ˙O is maximally consistent with respect to a func-

tion f 2 F if E.; O f / E.O 0 ; f / for all O 2 ˙O . In theory, the Karaoz method
would assign a function f to a protein v 2 Vu if there exists a maximally consis-
tent assignment O such that O .v; f / D 1. As in the case of the Vazquez method,
however, finding such maximally consistent assignments is computationally chal-
lenging. In the paper the authors use a heuristic approach to generate approximate
solutions, which form the input to a leave-one-out cross-validation procedure. For
results, we refer to the original paper. We would like to offer two comments. The
first comment concerns the optimization criterion. In the paper, the authors point
out that maximizing E corresponds to maximizing the (weighted) sum of consistent
edges, where an edge is called consistent (with respect to a function f ), if either
both the endpoints have the function f or neither of the endpoints have the func-
tion f . The first possibility (both the endpoints have the function f ) would seem
more natural than the second (neither of the endpoints have the function f ), and
one would expect this requirement to carry more weight than the other. However,
as it is, they are given equal importance. The second comment concerns the heuris-
tic optimization procedure employed by the authors, details of which can be found
in the paper. The said procedure involves an update rule, which is applied serially
to each node in the network. It is not clear whether, and to what extent, the order
in which the update rule is applied affects the overall outcome of the procedure.
More importantly, it is not clear how close the solutions obtained by this procedure
are to the maximally consistent solutions (the bound given in the paper is rather
loose). Lastly, even if some or all solutions obtained by this method are maximally
consistent, there is no guarantee that it will find all possible maximally consistent
solutions. In other words, there is no way of knowing that the sample is representa-
tive. This is important when assigning multiple functions to proteins as it affects the
scoring function.
452 O. Mason et al.
The Nabieva Method
Unlike the previous two methods, the functional flow algorithm [27], which we de-
scribe next, does not involve the optimization of a cost functional. In this method, a
protein is modelled as a “source” of functions. Associated with each protein there is
a number of reservoirs, one for each function, each of which holds a certain amount
of function. The amount of function in the reservoirs can change as a result of func-
tional flow between neighbouring proteins. The direction and the magnitude of this
flow are determined by the functional gradient and the link capacity, respectively.
More formally, let Rvf .k/ denote the amount of function f at protein v at time
step k. For all edges uv 2 E and all functions f 2 F , we assume that the flow
f
guv .k/ of function f at time k along the edge uv is given by
8
<0 if Ruf .k/ < Rvf .k/
f
guv .k/ WD n o
:min wuv ; P wuv
otherwise
y2N.u/ wuy
where wuv denotes the capacity or weight of the edge uv. A simple flow balance
analysis shows that Ruf .k/ satisfies the recurrence equation
X
Rvf .k/ D Rvf .k 1/ C f
guv f
.k/ gvu .k/ :
u2N.v/
It is assumed that the amount of function Rvf .0/ stored in the reservoir for function
f at protein v at time k D 0 is “1” if v 2 Vu and f 2 .v/ and 0 otherwise. The
functional score for function f at node v is defined as the total inflow of f during
a fixed number of iteration steps d , where d is taken to be half of the diameter of
the graph:
d
X X
f
v .f / D guv .k/:
kD1 u2N.v/
Functional flow is certainly a novel approach to the problem of protein annotation

and the results presented in [27] are promising. In particular, these indicate that it
outperforms the majority and the chi-squared methods, among others. On the other
hand, there are some fundamental theoretical questions concerning the algorithm.
The biological foundation for the concept of “flow” and for considering annotated
proteins as infinite sources needs to be clarified. From a more numerical point of
view, the algorithm is iterative in nature and in [27] is terminated after a finite
number of steps.2 However, no unambiguous criterion for determining when to
terminate the algorithm is provided; a loose justification based on network diameter
2
Functional flow clearly cannot converge in its current form.
is suggested. Before functional flow can be reliably employed, the impact of the
choice of stopping time on the predictions made needs to be more fully understood.
Moreover, a clear way of determining in advance when to stop the algorithm is
obviously necessary for its wider use.
18.5.4 Markov Random Fields and Level-2 Neighbours
Markov Random Field Approaches
Another promising approach to the problem of PFP has been proposed in [11, 23].
We focus on the details of the scheme described in [11]. Here, the authors adopt
the technique of Markov random fields, which was originally developed in the
area of image reconstruction. This is a probabilistic approach to the problem and
the output of the algorithm is a distribution function for each individual function
f 2 F , which specifies the probability P r.f 2 O .u// that a node u 2 Vu has
the function f . Specifically, in the scheme of [11], the nodes of V are labelled
as u1 ; : : : ; up ; upC1 ; : : : ; upCq where ui 2 Vu for i D 1; : : : ; p, ui 2 Va for
i D p C 1; : : : ; p C q and p C q D n. Then for a given function f 2 F , the
random variable X D .X1 ; : : : ; Xn / on V is defined as
(
1 if node i is annotated with f
Xi D (18.4)
0 if node i is not annotated with f:
Then the initial data specified by the annotation W Va ! 2F nf;g is combined

with the network topology to construct a prior distribution P r.X j/ where repre-
sents the parameters of the model. Using this prior distribution, an iterative Bayesian
approach is used to estimate the posterior probabilities
Pr.X1 ; : : : ; Xp jXpC1 D xpC1 ; : : : ; XpCq D xpCq /: (18.5)
After this is completed for each f 2 F and each node u 2 Vu , we will have
computed a probability Pr.u; f / indicating the likelihood that the node u has the
function f . In keeping with the general framework outlined in Sect. 18.3, this cor-
responds to the score function u .f / and can naturally be used to define a ranking
on the functions in F and to generate predictions for the possible functions of an
unannotated protein u 2 Vu .
The authors of [11] tested the performance of their algorithm on PPI network
data for S. cerevisiae obtained from the MIPS database and used the yeast functional
annotation in the Yeast Proteome Database (YPD). We discuss the details of their
results and their validation method in the following section.
454 O. Mason et al.
Algorithms Based on Level-2 Neighbours
The author of [18] suggested that the number of common interacting partners two
proteins possess be used as a measure of functional similarity. Building on this idea,
the same research group developed the PRODISTIN algorithm for PFP and clus-
tering of interaction networks in [7]. The core idea behind this algorithm is to use
the so-called Czekanowski–Dice (CD) distance on a PPI network G D .V; E/ as a
measure of functional similarity. Formally, for u 2 V , define the extended neigh-
bourhood of u as Ne .u/ D N.u/ [ fug. Then for any pair of nodes u; v 2 V , the CD
distance is given by
jNe .u/4Ne .v/j

CD.u; v/ D : (18.6)
jNe .u/ [ Ne .v/j C jNe .u/ \ Ne .v/j
The CD distance provides a quantitative measure of how significant an overlap there

is between the interacting partners of u and those of v. If Ne .u/ D Ne .v/, then
CD.u; v/ D 0, while on the other extreme if Ne .u/ and Ne .v/ are disjoint, then
CD.u; v/ D 1.
In [7], the matrix of CD distances was used to cluster the proteins in the network
and proteins belonging to the same cluster are assumed to have similar functions.
This allows the functions of annotated proteins within a cluster to be used to pre-
dict the functions of unannotated nodes within the same cluster. Using the YPD
classification scheme and a validation scheme based on artificially denoting anno-
tated proteins as unannotated, the PRODISTIN algorithm was found to significantly
outperform the majority rule.
A more complicated extension of the CD distance, Functional Similarity Weight
(FS-Weight) was introduced in [9]. Using this concept, the authors of [9] define a
likelihood score u .f / that a given protein u has a function f 2 F , which fits more
naturally into the framework described here. As with the MRF approach, functions
for which u .f / lies above a prespecified threshold are assigned to unannotated
proteins u. The authors of [9] compared the performance of their approach to that
of the chi-squared, majority, PRODISTIN, and functional flow schemes using the
FunCat classification. They found that the FS-Weight approach outperforms all of
the other methods. Note, however, that MRF-based approaches and the other op-
timisation schemes were not included in this comparison. An alternative approach
based on level-2 neighbours has also been proposed in [33].
18.6 Validation and Comparison of Methods
Given the variety of different approaches to network-based PFP available, it is im-

portant to have a clear understanding of the relative strengths and drawbacks of
the various methods proposed. We have already spent some time discussing the-
oretical issues that arise in connection with the methods described here; however,
the question of how well these methods actually perform in practice is clearly of
paramount importance. In this section, we review and summarise the results of
several comparative studies published in the literature and illustrate the key ideas
behind the metrics used in these comparisons.
The first question to be addressed in comparing the performance of different
methods is which metric or metrics to use to perform the comparison. In [11], the
“leave one out” validation method and the measures sensitivity and specificity were
introduced and used to compare the performance of their MRF method to the ma-
jority and chi-squared schemes. This is one of the earliest systematic comparative
studies of its kind and the core methodology of this paper has subsequently been
used by other authors [9].
The idea behind “leave one out” is simply to treat each annotated protein as unan-
notated in turn, run the algorithm and compare the predicted functions to the known
functions of the protein. Thus, the validation process only considers the annotated
part of the network (the induced subgraph on Va ) and treats one annotated protein u
as unannotated. The algorithm is then run on Va and functional predictions are made
for u using either a prediction threshold as in (18.1) or by choosing the highest m
scoring functions as in (18.2). In this way, predictions are generated for all annotated
proteins in the network, which can be compared to their known functions.
A number of standard metrics have been introduced to assess the performance
of classifiers and it is natural to ask if these can be adapted to evaluate PFP algo-
rithms. The notions of true-positive rate (tp-rate) and false positive rate (fp-rate)
and Receiver Operating Characteristic (ROC) graphs are basic in evaluating classi-
fier performance [13]. These concepts are usually defined for classification problems
with two classes – positive and negative. However, if we consider the set of all or-
dered pairs .v; f / where v 2 Va and f 2 F , and define a positive as a pair for
which f 2 .v/ and a negative as a pair for which f … .v/, it is possible to
introduce definitions of fp-rate and tp-rate for PFP algorithms. As a simple illus-
tration, we include a ROC graph based on these definitions comparing the majority
and chi-squared methods in Fig. 18.2. This plot was generated using functional data
from the FunCat annotation scheme and using PPI data obtained from the Database
of Interacting Proteins [41] in January 2008. For low values of fp-rate, the majority
rule outperforms the chi-squared rule, but the results are far from conclusive. Note
that the values of fp-rate are extremely low because, in the definition of positives
and negatives, the number of negatives will be considerably larger than the number
of positives [13]. An alternative definition of true and false positives was given in
[27] (which we discuss below) but in general it is not straightforward to apply ROC
techniques to PFP algorithms as the number of classes is far greater than two and
each protein can be assigned to more than one class.
We next describe some specific metrics introduced for assessing PFP algorithms
and discuss the results reported in the literature. In [11] the concepts specificity:
P
u2Va j O .u/ \ .u/j
SP D P (18.7)
O
u2V j .u/j
a
456 O. Mason et al.
0.7
0.6
0.5
0.4
TP Rate
Majority
Chi−squared
0.3
0.2
0.1
0
0 0.01 0.02 0.03 0.04 0.05 0.06 0.07
FP Rate
Fig. 18.2 TP-rate fP-rate plot for majority and chi-squared rules
and sensitivity:
P
u2Va j O .u/ \ .u/j
SN D P ; (18.8)
u2Va j .u/j
were introduced. Specificity measures the ratio of the total number of correct pre-
dictions to the total number of predictions while sensitivity measures the ratio of the
total number of correct predictions to the total number of known functions in the
initial assignment.
Notions of sensitivity and specificity are standard in the evaluation of classifier
performance. To avoid confusion, we briefly point out how the above definitions
relate to those in the ROC literature. Sensitivity and specificity are usually defined
for classification problems with two classes, positive and negative. The sensitivity of
a method is defined to be the ratio of the total number of correctly classified positives
to the total number of positives. As above, if we consider the set of all ordered pairs
.v; f / where v 2 Va and f 2 F , and define a positive as a pair for which f 2 .v/,
it is clear that the definition of sensitivity given above corresponds to the usual one
in this case. Specificity is usually defined as the ratio of the total number of correctly
classified negatives to the total number of negatives. This is slightly different from
the definition given above. To make it possible to discuss results from the published
literature, we have chosen to work with the definitions that have been adopted in
studying PFP.
When the threshold is low or when a large value of m is chosen, the scheme
will generate a large number of predictions, and on the average a large number of
correct predictions, leading to a higher value of SN but as the denominator of SP
will also be large in this case, the specificity is low. This essentially means that many
spurious predictions are generated at low thresholds, which is intuitively obvious.
The idea behind the use of these measures in comparing protein prediction algo-
rithms is the following. If two methods are being compared and for any fixed value
of specificity method 1 has a higher value of sensitivity than method 2, then method
1 is performing better than method 2. In practice, a plot of sensitivity against speci-
ficity is generated over a range of threshold values for the various methods being
compared and if the plot of one method lies above that of another, the former method
is deemed to be more accurate. To illustrate the idea we include in Fig. 18.3 a simple
plot of sensitivity versus specificity for the majority and chi-squared schemes. This
plot was generated using functional data from the FunCat annotation scheme and
using PPI data obtained from the Database of Interacting Proteins [41] in January
2008. Although the results plotted here cannot be said to be conclusive, they do
indicate that the majority rule outperforms the chi-squared rule over a range of
specificity values between 0.08 and 0.35. The chi-squared rule gives higher sen-
sitivity values when specificity is lower than 0.08 but at this stage the specificity is
arguably too low for any practical purposes anyway.
These results essentially agree with the comparison presented in [11] as to the
relative performance of the chi-squared and majority schemes; however, in [11], the
YPD classification scheme was used and the PPI data were obtained from the MIPS
0.7
Majority
Chi−squared
0.6
0.5
0.4
Sensitivity
0.3
0.2
0.1
0
0 0.05 0.1 0.15 0.2 0.25 0.3 0.35
Specificity
Fig. 18.3 Sensitivity-specificity plot for majority and chi-squared rules

458 O. Mason et al.
database. The primary interest of that study was to compare the MRF scheme to
the majority and chi-squared schemes. For each of the three basic categories in the
YPD classification scheme the sensitivity-specificity curve for the MRF algorithm
was found to lie above those of both the majority and the chi-squared schemes,
indicating that the MRF is the most accurate of these three PFP algorithms. It is
worth noting that in the results of [11] the majority rule appears to significantly
outperform the chi-squared scheme.
A more comprehensive comparative study was performed in [9]. Here using PPI
data from the GRID database [6], the majority, chi-squared, PRODISTIN, func-
tional flow and Functional Similarity Weight (FSW) methods were compared using
the MIPS FunCat classification scheme. Moreover, in a separate study in the same
paper, all of the aforementioned algorithms and the MRF scheme of Deng et al. [11]
were compared using the GO annotations. As in the study in [11], sensitivity-
specificity plots were used as a comparative tool; however, in the FunCat scheme,
only informative functional categories were used. A functional category f 2 F is
informative if jfv 2 Va W f 2 .v/gj 30 (at least 30 proteins are annotated
with f ). Based on the FunCat scheme, the results indicate that the PRODISTIN and
FSW schemes significantly outperform the others, with FSW a clear winner. Of the
other methods included in the study, the majority rule performs slightly better than
the rest but the difference is considerably less than that between majority and FSW.
There is no significant difference in performance between any of the other methods.
The MRF method was included in the comparison in [9] based on the GO scheme
and, with the exception of the FSW approach performed best in each of the three
basic categories of biochemical function, cellular role, and subcellular location. No
clear difference could be observed between the performances of any of the other
methods in any of the three schemes. As pointed out in the recent survey paper [35],
given that the FSW method was proposed by the authors of [9], their study can only
be viewed as an independent comparison of the methods other than FSW. As such, it
provides evidence that the MRF scheme outperforms other competing schemes, with
little significant difference between the results for majority, chi-squared, PRODIS-
TIN, and functional flow.
It should be noted here that another comparative study was presented in [27]
based on a different metric to the specificity-sensitivity plot described above. In this
paper, functional flow was compared to Genmulticut – a variation of the optimisa-
tion approach described in [38] – the majority rule, and the chi-squared scheme.
The PPI data used were obtained from the GRID database [6], while the FunCat
annotations were used; however, only categories at the second level in the hierarchy
were used in contrast to the study in [9], which employed the finest classification
in the FunCat database. In [27], to evaluate the performance of the algorithms, the
annotated proteins in Va were divided into two sets, Va1 , Va2 , and the functional
annotations of the proteins in Va1 were used to predict functions for Va2 using the
top-ranked functions as in (18.2). A ROC curve of true positives against false posi-
tives was then generated as the parameter m was varied. A prediction for a protein
was deemed true if more than half of the predicted function are true and false oth-
erwise. It is not easy to rigorously justify this definition of true and false positive
and there are clear problems with it. For instance, a protein which has only been
annotated with three functions can never generate a true positive if we choose to
predict seven functions per protein, even if the three true functions are the top three
ranked functions by the method. This is clearly unsatisfactory, and adapting the stan-
dard ROC approach along the lines suggested above appears to be a preferable way
to proceed. On a straight comparison, functional flow and majority were seen to
perform better than the chi-squared and the Genmulticut methods, with functional
flow performing marginally better than the majority method.
18.7 Discussion and Conclusions
The aim of this chapter has been to introduce the biological problem of PFP, pro-
vide a starting point into the literature on this topic, and highlight potential areas
of research for applied graph theorists to which this problem gives rise. For this
reason, we have provided the biological background to the problem, describing the
difficulties inherent in giving a consistent, unambiguous meaning to the term “func-
tion” and outlining how some of the main databases of functional annotation deal
with these issues. We have also provided a formal abstract framework for discussing
network-based function prediction and have formulated the major algorithms in the
literature within this framework using common notation throughout. In this final
section, we briefly discuss some general issues with the problem of PFP itself and
with the various algorithms described here.
First of all, it has been noted that there is a definite need for a systematic and uni-
form evaluation of the performance of the different techniques [9]. Currently, most
comparisons in the published literature, such as those discussed above in Sect. 18.6,
appear in papers by authors describing and, understandably, supporting their own
method and a comprehensive, independent comparison would be very welcome.
Also, the PPI data and the functional classification scheme used for evaluation
purposes vary from one paper to another making it yet more difficult to make an
objective judgement on the relative performance of the algorithms. To further com-
plicate the situation, a set of universally accepted measures that can be used to rate
performance is also lacking at the moment, with different measures again being used
in different papers. The sensitivity and specificity measures discussed above seem
to have attained some level of acceptance but it is far from universal at the time of
writing. Furthermore, the measures that have been proposed should be subjected to
a more thorough theoretical analysis so as to understand precisely what they have to
say about algorithm performance.
One fundamental issue that applies to all of the algorithms discussed here has
been previously highlighted in [11]. All current approaches, and the framework out-
lined in Sect. 18.3 assume that the annotations of the annotated proteins in Va are
complete. This assumption is clearly questionable as many proteins in Va may pos-
sess functions other than those in the list specified by the current annotation .
460 O. Mason et al.
Although this is a limitation of the methods, it is difficult to see how it can be

circumvented, as we can only ever work with the data available at the time.
From a theoretical point of view, two promising areas for research suggest them-
selves. First, the robustness of function prediction algorithms to data inaccuracies
should be studied. Results along the lines of those obtained for some centrality
measures used to predict essentiality would be very interesting and useful. Second,
as we have previously mentioned in Sect. 18.3, theoretically investigating how the
predictions of the various schemes relate to one another is also an important and
challenging question.
Acknowledgements This work was partially supported by Science Foundation Ireland (SFI) grant
03/RP1/I382 and the Irish Higher Education Authority (HEA) PRTLI Network Mathematics grant.
Neither Science Foundation Ireland nor the Higher Education Authority is responsible for any use
of data appearing in this publication.
References
1. Altschul SF et al (1990) Basic local alignment search tool. J Mol Biol 215:403–410
2. Altschul SF et al (1997) Gap-blast and psi-blast: a new generation of protein database search
programs. Nucleic Acids Res 25(17):3389–3402
3. Ashburner M et al (2000) Gene ontology: tool for the unification of biology. Nat Genet 25:
25–29
4. Baldi P, Hatfield GW (2002) DNA microarrays and gene expression. Cambridge University
Press, Cambridge
5. Barabasi L, Oltvai Z (2004) Network biology: understanding the cell’s functional organization.
Nat Rev Genet 5:101–113
6. Breitkreutz BJ et al (2003) The GRID: the general repository for interaction datasets. Genome
Biol 4:R23
7. Brun C et al (2003) Functional classification of proteins for the prediction of cellular function
from a protein–protein interaction network. Genome Biol 5:R6
8. Bu D et al (2003) Topological structure analysis of the protein–protein interaction network in
budding yeast. Nucleic Acids Res 31(9):2443–2450
9. Chua H, Sung W, Wong L (2006) Exploiting indirect neighbours and topological weight to
predict protein function from protein–protein interactions. Bioinformatics 22(13):1623–1630
10. Costanzo M et al (2001) YPD, PombePD and WormPD: model organism volumes of the
bioknowledge library, an integrated resource for protein information. Nucleic Acids Res
29(1):75–79
11. Deng M et al (2003) Prediction of protein function using protein–protein interaction data. J
Comput Biol 10(6):947–960
13. Fawcett T (2005) An introduction to ROC analysis. Pattern Recogn Lett 27(8):861–874
14. Gavin A et al (2002) Functional organization of the yeast proteome by systematic analysis of
protein complexes. Nature 415:141–147
15. Giot L et al (2003) A protein interaction map of Drosophila melanogaster. Science 302:
1727–1736
16. Hishigaki H et al (2001) Assessment of prediction accuracy of protein function from protein–
protein interaction data. Yeast 18:523–531
17. Ito T et al (2001) A comprehensive two-hybrid analysis to explore the yeast protein interac-
tome. Proc Natl Acad Sci USA 98(8):4569–4574
18. Jacq B (2001) Protein function from the perspective of molecular interactions and genetic
networks. Brief Bioinform 2(1):38–50
19. Jeong H, Mason S, Barabasi A, Oltvai Z (2001) Lethality and centrality in protein networks.
Nature 411:41–42
20. Karaoz U et al (2004) Whole-genome annotation by using evidence integration in functional-
linkage networks. Proc Natl Acad Sci USA 101:2888–2893
21. Karp P et al (2002) The ecoCyc database. Nucleic Acids Res 30(1):56–58
22. Kitano H (2002) Systems biology: a brief overview. Science 295:1662–1664
23. Letovsky S, Kasif S (2003) Predicting protein function from protein/protein interaction data:
a probabilistic approach. Bioinformatics 19:i197–i204
24. Li S et al (2004) A map of the interactome network of the metazoan C. elegans. Science
303:540–543
25. Mason O, Verwoerd M (2007) Graph theory and networks in biology. IET Syst Biol 1(2):
89–119
26. Mewes H et al (2002) MIPS: a database for genomes and protein sequences. Nucleic Acids
Res 30(1):31–34
27. Nabieva E et al (2005) Whole-proteome prediction of protein function via graph-theoretic
analysis of interaction maps. Bioinformatics 21:i302–i310
28. Pellegrini M et al (1999) Assigning protein function by comparative genome analysis: protein
phylogenetic profiles. Proc Natl Acad Sci USA 96(8):4285–4288
29. Pereira-Leal J, Enright A, Ouzounis C (2004) Detection of functional modules from protein
interaction networks. Protein Struct Funct Bioinform 54:49–57
30. Przulj N, Wigle D, Jurisica I (2004) Functional topology in a network of protein interactions.
Bioinformatics 20(3):340–348
31. Rain J et al (2001) The protein–protein interaction map of Heliobacter pylori. Nature 409:
211–215
32. Ruepp A et al (2004) The FunCat, a functional annotation scheme for systematic classification
of proteins from whole genomes. Nucleic Acids Res 32(18):5539–5545
33. Samanta M, Liang S (2003) Predicting protein functions from redundancies in large-scale
protein interaction networks. Proc Natl Acad Sci USA 100(22):12579–12583
34. Schwikowski B, Uetz P, Fields S (2000) A network of protein–protein interactions in yeast.
Nat Biotechnol 18:1257–1261
35. Sharan R, Ulitsky I, Shamir R (2007) Network-based prediction of protein function. Mol Syst
Biol, 3:88
36. Sontag E (2004) Some new directions in control theory inspired by systems biology. IET Syst
Biol 1:9–18
37. Twyman RM (2004) Principles of proteomics. Garland Science/BIOS Scientific Publishers
(Advanced Text Series), Taylor and Francis, London
38. Vazquez A et al (2003) Global protein function prediction from protein–protein interaction
networks. Nat Biotechnol 21(6):697–700
39. Venter C et al (2001) The sequence of the human genome. Science 291:1304–1351
40. Von Mering C et al (2002) Comparative assessment of large-scale data sets of protein–protein
interactions. Nature 417:399–403
41. Xenarios I et al (2000) DIP: the database of interacting proteins. Nucleic Acids Res 28(1):
289–291
42. Yu H et al (2004) Genomic analysis of essentiality within protein networks. Trends Genet
20(6):227–231
43. Zhou X, Kao M, Wong W (2002) Transitive functional annotation by shortest-path analysis of
gene expression data. Proc Natl Acad Sci USA 99(20):1278312788
Chapter 19
Applications of Perfect Matchings in Chemistry
Damir Vukičević
Abstract Perfect matchings or one factors in mathematics correspond to Kekulé

structures in chemistry. In this chapter, we present methods for determination of
the existence and enumeration of perfect matchings. The Pfaffian method of enu-
meration of perfect matchings in planar graphs is presented. The importance of the
enumeration of perfect matchings (Kekulé structures) is illustrated with several dif-
ferent chemical applications. A method for coding Kekulé structures which enables
efficient storing in the computer is presented. Also, the recently introduced notion of
algebraic Kekulé structures is explained and its role in the classification of Kekulé
structures according to their significance is discussed. The concept of the resonance
graph is presented and its role in the study of fullerene molecules is commented.
Keywords Perfect matching Kekulé structure Pfaffian Enumeration Resonance

graph Anti-Kekulé number
19.1 Introduction
Let G D .V; E/ be a graph. Matching (or independent set of edges) M E .G/

in G is a set of edges such that no two edges are adjacent (i.e., incident to the same
vertex). Vertex v 2 V .G/ is covered by M if it is incident to some edge in M:
Matching M is a perfect matching if it covers all vertices of G:
An alternative way to define the perfect matching in G is to say that it is a
1-regular subgraph of G: Note that these two definitions are not equivalent, because
D. Vukičević ()
Faculty of Mathematics and Natural Sciences, University of Split, Nikole Tesle 12,
HR-21000 Split, Croatia

464 D. Vukičević
the first one defines matching as a set of edges and the latter one as a graph. However,
these two notions are often incorrectly identified.
Kekulé structure is the term standardly used for perfect matchings in the chem-
ical literature. Throughout this chapter the terms perfect matchings and Kekulé
structures are used: perfect matchings in more mathematical contexts and Kekulé
structures in more chemical contexts.
In this chapter, several important mathematical methods that give relevant chem-
ical information are illustrated:
1. An algorithm that establishes the existence of the perfect matching (or Kekulé
structure in graph) is presented. The existence of Kekulé structure(s) of some
chemical compound gives important information about its stability. It is well
known that benzenoids that have Kekulé structures (so-called aromatic ben-
zenoids) can be stable, while those that do not have Kekulé structures are not
stable.
2. Algorithms for the enumeration of Kekulé structures are presented. It is described
how the number of perfect matchings of graphs (and some of their subgraphs) can
be used in chemistry. Three applications are described: estimation of resonance
energy, estimation of -electron energy, and estimation of bond lengths.
3. Algebraic Kekulé structures are presented and chemical information incorpo-
rated in them is analyzed. Also, the information content of algebraic Kekulé and
classic Kekulé structures is compared.
4. Possibilities of coding and storing information about Kekulé structures are
presented.
5. Several classification methods of Kekulé structures are analyzed. It is shown that
classifications obtained by these methods correlate well with the chemical sig-
nificance of Kekulé structures.
6. A resonance graph is presented and its application in nanotechnology is com-
mented.
The main goal of this chapter is to present a multidisciplinary study of Kekulé
structures. A dominant role is played by three sciences: mathematics, chemistry, and
computer science. Models presented here give an insight into the nature of some
chemical compounds. The most interesting feature of these models is the possibility
to predict the properties of chemical compounds that have never existed nor been
synthesized. Hence, this theory gives us a glimpse beyond our real world, a glimpse
into the world of almost infinite possibilities.
Here, we present only a very limited scope of mathematical analyses and possi-
ble chemical applications of this research. Much other information about chemical
structures can be extracted from the enumeration and classification of Kekulé struc-
tures. Therefore, Kekulé structures attracted much attention in both the mathemat-
ical (see [1] and references within) and chemical literature (see [2] and references
within).
Remark 1. Note that loops are not included in any matching, hence they are of no
interest for matching theory. Therefore throughout this chapter by the word graph,
we imply loopless graph.
19 Applications of Perfect Matchings in Chemistry 465
19.2 Existence and Enumeration of Perfect Matchings
Let us start by saying a few words about enumeration and existence of perfect
matchings. As described in the following sections, existence and number of perfect
matchings of a molecular graph (and some of its subgraphs) are used to give very
good estimates of much chemically relevant data. Existence of perfect matchings
can be determined in polynomial time [3] using the Hungarian method. In order to
present this method, we need the concept of the enlarged path. Let M be any match-
ing in graph G: An M -alternated path is a path whose edges alternate in sets M and
EnM: An M -alternated path is an M -augmented path if its first and last vertex are
not covered by M:
Let us describe the Hungarian method algorithm [3, 4] for bipartite graphs:
Input: bipartite graph with bipartition .X; Y / ; jX j D jY j.

Output: perfect matching or a set S X such that jN .S /j < jS j :
Step 1: Let M be any matching, e.g. M D ¿:
Step 2: If all vertices in X are covered by M stop (M is perfect matching). Other-
wise, let u 2 X be a vertex not covered by M: Denote S D fug ; T D ¿:
Step 3: If N .S / D T; stop (jN .S /j < jS j ; hence G has no perfect matching).
Otherwise, let y 2 N .S / nT:
Step 4: If y is covered by M , let yz 2 M: Replace S $ S [fzg and T $ T [fyg
and return to step 3: If y is not covered by M; let P be an M -augmented
.u; y/-path. We replace M by M 0 D ME .P / and return to step 2.
This algorithm can be easily modified [4] such that it solves the problem for all
graphs. Unfortunately, enumeration of perfect matchings is an NP-hard problem.
Simple (but nonpolynomial) recursive algorithms that enumerate all perfect match-
ings in graphs are based on the following theorems.
Theorem 1. Let G be a graph and uv 2 E .G/ :Then, the number .G/ of match-
ings of G is
.G/ D .G u v/ C .G uv/ :
Proof. The first summand is the number of perfect matchings M such that uv 2 M
and the second summand is the number of perfect matchings M such that uv … M:
t
u
Theorem 2. Let G be a graph and u 2 V .G/ :Then,

X
.G/ D .G u v/ :
v2V .G/Wuv2E .G/
Proof. Trivial. t
u
These recursive algorithms are very efficient for small graphs, but inefficient for
large graphs. Unfortunately, it can be shown that in general there is no efficient
method to enumerate perfect matchings. Let B be any 0/1 matrix of type n n.

Let G .B/ be a graph with bipartition .fu1 ; : : : ; un g ; fv1 ; : : : ; vn g/ such that bij is
the number of edges connecting vertices ui and vj . It can be easily seen that the
number of perfect matchings in B is equal to the permanent of matrix B: Hence,
the problem of calculation of permanents of matrices of type n n can be reduced
to the problem of finding perfect matchings in a graph with n vertices. From paper
[5], it follows that calculation of the permanent is an NP-hard problem. Therefore,
it is of interest to provide an algorithm that efficiently enumerates perfect matchings
in some special (interesting) classes of graphs. Such an algorithm is constructed by
Kasteleyin [6] for simple planar graphs. Here we present this algorithm following
the exposition style of [1, 6, 7].
Let G be a graph. For the sake of simplicity, we assume that V .G/ D
f0; : : : ; n 1g : Note that:
Lemma 1. If M and M 0 are two perfect matchings in G; then M [ M 0 is a collec-

tion of single edges and even (i.e., even length) cycles.
!

Let C be an even cycle in G and G an orientation of G: Cycle C is oddly oriented
if there is an odd number of co-oriented edges when the cycle is traversed in either
!

direction. An orientation G of G is Pfaffian if every cycle in M 0 [ M is oddly
oriented for every pair of perfect matchings
! M and M 0 :

The skew adjacency matrix As G is defined by
8 !

ˆ
ˆ 1; .i; j / 2 E G I
< !

aij D 1; .j; i / 2 E G I
ˆ
:̂
0; otherwise.
!
Denote by G the directed graph obtained from G by replacing each edge ij by a
!
pair of antiparallel edges .i; j / and .j; i / : An even cycle cover of G is a collection
!
S C of even directed cycles C in G such that every vertex of G is contained in
exactly one cycle in S C:
Let us prove:
Lemma 2. There is a bijection between (ordered) pairs of perfect matchings in G

!
and even cycle covers in G :
Proof. Let .M; M 0 / be a pair of perfect matchings in G: For each edge in M \ M 0

!
take both directed edges in G : Now, orient each cycle in M [M 0 (with length 4/.
in such a way that an edge in M incident to the vertex of the lowest number in C
is oriented away from that vertex. The resulting collection of directed cycles is an
even cycle cover in G: It can be easily checked that this assignment is bijective. u
t
Let us prove the Kasteleyn theorem.

!

Theorem 3. Forrany Pfaffian orientation G of G; the number of perfect matchings
!

of G is equal to det As G :
!

Proof. From the last lemma, it follows that it is sufficient to show that det As G
!
is equal to the even cycle covers in G : Note that
!
X n1
Y
det As G D sgn ./ ai;.i / ; ./
2Sn i D0
where Sn is the group of all permutations of f0; : : : ; n 1g :Consider permutation

and its decomposition to the cycleY D 1 k where j acts on some set
Vj V: The corresponding product ai;.i / is nonzero if and only if the edges
i 2Vj
˚
.i; .i // W i 2 Vj form a directed cycle.
Let us prove that the sum remains unchanged if we restrict it to permutation
with only even length cycles. Suppose that D 1 k is a permutation with
1
j corresponding to the odd cycle: Let 0 D 1 j 1 j j C1 n : Then
n1
Y n1
Y
ai;.i / D ai; 0 .i / and sgn./ D sgn . 0 /. Hence, permutations and 0
i D0 i D0
cancel out. Thus, we may pair up permutations with odd cycles so that they cancel
each other.
Now, consider permutation D 1 : : : k with only even cycles. We have
sgn./ D sgn .1 / : : : sgn .n / : Hence,
20 1 3
n1
Y k
Y Y
sgn ./ ai;.i / D 4@ ai;.i / A sgn j 5 :
i D0 j D1 i 2Vj
Y
Since ai;.i / D 1 and sgn j D 1; it follows that contributes 1 to ./ :u
t
i 2Vj
Using Euler’s formula, it can be proved that:

!

Lemma 3. Let G be a connected planar digraph embedded in the plane. Suppose
every face except the (outer) infinite face, has an odd number of edges that are
oriented clockwise. Then, in any simple cycle C; the number of edges oriented clock-
!
!

wise is of opposite parity to the number of vertices of G inside C: In particular G
is Pfaffian.
Proof. Let C be any cycle in G: Denote by v; k; c; f; and e numbers of vertices
inside C; vertices on C; edges on C oriented clockwise, faces inside C , and edges
inside C , respectively. Denote by ci the number of clockwise-oriented edges on

boundaries of faces in the interior of C for i D 0; : : : ; f 1: According to Euler’s
formula
.v C k/ C .f C 1/ .e C k/ D 2
„ ƒ‚ … „ ƒ‚ … „ ƒ‚ …
# vertices # faces # edges
which implies
e D v C f 1:
Assumption ci 1 .mod 2/ implies
f
X 1
f ci c C e c C .v C f 1/ .mod 2/
i D0
Hence, c C v is odd. t
u
It remains to prove that:
Theorem 4. Every planar graph has a Pfaffian orientation.
Proof. Let us assume that G is connected since otherwise we may treat each com-
ponent separately. We prove the claim by induction on the number of edges. If G is
a tree, then any orientation is Pfaffian. Now, let G be a graph such that jEj jV j :
There is an edge e such that its deletion merges two faces in one. By induction hy-
pothesis graph Gne has a Pfaffian orientation. It is sufficient to orient e in such way
that one of these two faces has an odd number of edges oriented clockwise (the same
will automatically hold for the other one, too). t
u
Also, chemists and mathematicians have developed many enumeration methods

for enumerating special classes of graphs and for some classes of graphs explicit for-
mulas have been obtained. Benzenoids (or benzenoid graphs) are connected graphs
inserted in the plane in such way that all their faces except infinite one are regular
congruent hexagons and two faces either have empty intersection or their intersec-
tion is a joint edge incident to two joint vertices. We say that two hexagons are
adjacent if they share an edge. The degree of a hexagon is the number of its adjacent
hexagons. A chain benzenoid is a benzenoid in which every hexagon has degree at
most two.
Here, we present (without proof) an algorithm for enumeration of Kekulé struc-
tures of chain benzenoids [8, 9]:
1. Start from an arbitrary side of the chain. Write an external numeral one.
2. Enter unity in all hexagons until the first kink.
3. Right after each kink the entry to be written into the next hexagon is the sum of
the numerals for the preceding linear segment.
4. The same numeral is the entered into all hexagons until the next kink, and so on.
Fig. 19.1 Benzenoid kink kink

structure with 79 Kekulé
structures
3 10 10
3 23
3 23
1 1 1 1
kink
1 ... p
1 ... p
2 ...
...
q q
Fig. 19.2 Graphs L .p; q/ and R .p; q/
Let us illustrate this procedure in Fig. 19.1.

Benzenoid on this figure indeed has 4 1 C 3 3 C 2 10 C 2 23 D 79 Kekulé
structures. Also for some classes of benzenoid explicit formulas are known. Two
such classes are presented in Fig. 19.2 [8, 10].

It has been shown [8] that L .p; q/ has pCq q Kekulé structures and that R .p; q/
q
has .p C 1/ Kekulé structures. For more information about enumeration the inter-
ested reader is referred to [8, 10, 11].
19.3 Applications of the Number of Kekulé Structures

in Chemistry
Let G be any graph. Denote by .G/ the number of Kekulé structures. Also denote
by 3 .G/ the number of unordered pairs of Kekulé structures M1 and M2 such that
symmetric difference M1 M2 is the cycle of length 6 and by 5 .G/ the number
of unordered pairs of Kekulé structures M1 and M2 such that symmetric difference

M1 M2 is the cycle of length 10. We present several chemically important relations
that are solely based on these three numbers.
Resonance energy RE is defined in chemistry as the difference in potential
energy between the actual molecular entity and the contributing structure of low-
est potential energy. The resonance energy cannot be measured, but only estimated,
since contributing structures are not observable molecular entities1 (for more infor-
mation on resonance energy, see [12]). It has been shown that resonance energy can
be well approximated by the following formula [8]:
2
RE .0:841eV 3 .G/ C 0:336eV 5 .G// :
.G/
Another, even simpler formula also gives a good approximation of resonance

energy [13]:
RE 1:185 ln . .G// ŒeV :
Electrons that create Kekulé structures are called -electrons. Total -electron energy
E can be estimated by [14, 15]:
p
E 0:7578 2 jEj jV j C 0:1899 jV j .G/jV j=2 :
One of the most interesting results is the classical result of L. Pauling [16] that
estimates bond length Duv between two adjacent atoms u and v using the value of
Puv D .G uv/ = .G/ as input:
1:84 Puv
Duv D D0 .D0 D1 / ;
0:84 Puv C 1
where D0 D 150:4pm and D1 D 133:4pm (values of D0 and D1 are not random;

D0 is the length of the single bond between sp 2 hybridized carbon atoms and D1 is
the length of a double bond).
19.4 Algebraic Kekulé Structures
Let G be a benzenoid graph with at least one Kekulé structure. Let K be a Kekulé
structure in G: Denote by SF the set of all congruent hexagonal faces in G: The
algebraic Kekulé structure [17] AKS .K/ is the function AKS .K/ W SF ! N0 that
assigns to each face F 2 SF number of edges in K that are on its boundary in such
a way that edges that are on the boundary of the infinite face and F are counted
twice.
1
http://www.iupac.org/goldbook/R05333.pdf.
Remark 2. The chemical motivation for such a definition is the following: each
double bond consists of two -electrons. Hence, if it belongs to a single hexagon,
we may assume that both electrons belong to this hexagon. If it is on the border of
two hexagons, then we may assume that each hexagon contains one of these two
electrons. In this way distribution of all electrons to faces is described which gives
chemically relevant data.
This concept is also defined for fullerenes. Fullerenes are allotropic modifica-
tions of carbon. In chemistry, they are defined as closed carbon-cage molecules
containing only pentagonal and hexagonal rings [18]. In mathematics fullerene
graphs (we call them fullerenes also for the sake of brevity) are defined as planar
3-regular 3-connected graphs in which all faces are pentagons and hexagons. Note
that fullerenes don’t have an irrelevant outer face. Hence for each Kekulé structure
K; AKS .K/ assigns to each face the number of edges in K: Algebraic Kekulé struc-
tures are also analyzed for nanotubes, phenylenes, and so on, but here we restrict
our attention to benzenoids and fullerenes.
Catacondensed benzenoids are benzenoids in which all vertices are on the outer
face and pericondensed benzenoids are benzenoids that contain internal vertices
(vertices that are not on the outer face). It can be easily seen that
Lemma 4. Let H be a graph whose vertices are faces of catacondensed benzenoid

and two vertices are adjacent if two faces are adjacent. Then, H is a tree.
It is of interest to see if the algebraic Kekulé structures encode all information

incorporated in Kekulé structures, i.e., if assignment K $ AKS .K/ is bijective for
every benzenoid. It is shown in paper [19] that there is a pericondensed benzenoid
in which this assignment is not bijective. Two Kekulé structures K1 and K2 such
that AKS .K1 / D AKS .K2 / are presented in Fig. 19.3.
However, it has been proved that:
Theorem 5. Let G be a catacondensed benzenoid with at least two hexagons.

Then, Kekulé structures of G are in 1-to-1 correspondence with algebraic Kekulé
structures.
Proof. We prove the claim by the induction on the number of hexagons h of G:

If h D 2; the claim is obvious. Hence, suppose that graph G has h > 2 hexagons
and two different Kekulé structures K1 and K2 such that AKS .K1 / D AKS .K2 /.
5 5
3 3 3 3
Fig. 19.3 Two Kekulé
structures that correspond to 5 5
the same algebraic Kekulé
structure
Note that G has at least one pendant hexagon H1 (a hexagon adjacent to only one
other hexagon H2 ): Note that AKS .K1 / .H1 / D AKS .K2 / .H1 / can only be 4; 5,
or 6 and in each case arrangement of edges in K is fixed. Let G 0 be a benzenoid that
has all faces the same as G, but has no face H1 andlet K10 and K20 be restrictions
of K1 and K2 to G: It can be easily seen that AKS K10 D AKS K20 : From the
inductive hypothesis, it follows that K10 D K20 ; but then K1 D K2 which is a
contradiction. t
u
19.5 Coding of Kekulé Structures
Every Kekulé structure K of graph G D .V; E/ can be represented by the function

fK W E ! f0; 1g. However, this representation is not particularly efficient. Namely,
the number of Kekulé structures is much smaller then 2jE j : If one is interested in
a the efficient storing of Kekulé structures in a computer, then alternative strategies
may be of interest. It can be shown that for the family of catacondensed benzenoids,
it is possible to reduce the number of bits requireds for the storage of Kekulé struc-
tures from jEj to the number of hexagons h [20]. Since, jEj D 1 C 5h; this is
a significant reduction. Let K be any Kekulé structure and let H0 be a pendant
hexagon in G: Let gK be the function defined by

1; AKS .K/ .H0 / > 4
gK .H0 / D
0; otherwise;
and by
gK .H / D AKS .K/ .H / mod 2
for every hexagon H ¤ H0 : It can be shown that [20]:
Theorem 6. Let G be a catacondensed benzenoid with at least two Kekulé struc-

tures; then function gK uniquely determines the Kekulé structure K:
Another idea of compacting the information about Kekulé structures is to try

to find the smallest set of edges E 0 E such that from restriction of fK to E;
function fK can be completely reconstructed. More precisely, let K be the set of all
0
functions fK that correspond to some Kekulé structure of G and let W K ! 2E be
a function defined as a restriction to E 0 : We say that E 0 is the total forcing set [21]
(or global forcing set [22]) if function is an injective function. The cardinality of
the smallest total forcing set is called the total forcing number.
In paper [21] the total forcing number tfn of triangular grids has been analyzed
and it has been shown that
5 2 21 41 5
n nC
tfn
n2 C n 2:
4 2 4 4
Moreover, when n tends to infinity, then ratio tf n= jEj tends to 5=12: Let us present
the results of paper [22]. Square grid Rpq is defined as a Cartesian product Pp Pq
of paths Pp and Pq with p and q vertices, respectively. Recall that Cartesian product
G1 G2 of graphs G1 and G2 is defined by
V .G1 G2 / D f.u; v/ W u 2 V .G1 / ; v 2 V .G2 /g I

E .G1 G2 / D f.uv1 / .uv2 / W u 2 V .G1 / ; v1 v2 2 E .G2 /g [
f.u1 v/ .u2 v/ W u1 u2 2 E .G1 / ; v 2 V .G2 /g :
It is proved in [22]
j thatk jthe total
k forcing number of rectangular grid Rpq is
p1 q1
.p 1/ .q 1/ 2 2
: Also total forcing numbers of benzenoids [23]
and toroidal polyhexes have been analyzed [24].
19.6 Classification of Kekulé Structures
It is well known in chemistry that all Kekulé structures are not of the same signifi-
cance. There are five simple purely graph-theoretical measures that can well predict
the importance of Kekulé structures in benzenoids and fullerenes. These five mea-
sures are [25, 26]:
1. Number of -electrons belonging to hexagons (applicable only for fullerenes).
2. Number of conjugated hexagons.
3. Degree of freedom.
4. Number of independent conjugated hexagons.
5. Number of independent conjugated cycles.
Let us explain these notions. In chemistry edges contained in the observed Kekulé
structures are called double bonds and others are called single bonds. A conjugated
cycle is a cycle in which single and double bonds alternate and a conjugated hexagon
is a conjugated cycle of length 6. We say that two cycles are independent if they
don’t have joint vertices. The degree of freedom of a Kekulé structure is the smallest
number of edges that completely determine the Kekulé structure. More precisely,
the forcing set of Kekulé structure K is the set K 0 K such that K is the only
Kekulé structure that contains K 0 : The degree of freedom is the cardinality of the
smallest forcing set. The number of -electrons that belong to a hexagon in a Kekulé
structure K is assumed to be
X
AKS .K/ .H / :
H is hexagon
Remark 3. Note that the forcing set identifies a single Kekulé structure while total
forcing set identifies all Kekulé structures.
Fig. 19.4
Buckminsterfullerene
Fig. 19.5 Most significant

Kekulé structure
The most famous fullerene is Buckminsterfullerene whose discovery was

rewarded by the Nobel prize [27]. It looks like a football. It consists of 60 carbon
atoms located in the vertices of the football and bonds on the football represent
chemical bonds between atoms. A planar projection of this molecule is presented in
Fig. 19.4.
This molecule has a single most significant Kekulé K structure that is presented
in Fig. 19.5.
Let us explain that this is indeed the most significant Kekulé structure using three
of the five proposed measures.
Number of -electrons belonging to hexagons. Note that each double bond is
shared by two hexagons, hence the number of -electrons belonging to hexagons is
equal to 60. Also, note that all single edges are shared by the pentagon and hexagons,
hence no other structure can have the same number of -electrons that belong to
hexagons.
Number of conjugated hexagons. All 20 hexagons are conjugated and in order
for all of them to be conjugated each of them has to be adjacent to three double
bonds. Since there are only 30 double bonds, it follows that each of them has to
be shared by two hexagons. Hence, K is the only structure with 20 conjugated
hexagons.
Degree of freedom. It is calculated by computer; details of the algorithm are pre-

sented in [28]. The degree of freedom of K is 10, while degrees of freedom of all
other structures go from 5 to 9.
Let K1 and K2 be Kekulé structures of graph G. We say that K1 and K2 are iso-
morphic if there is automorphism f D .fV ; fE / of G such that fE .K1 / D K2 : In
the last section, it was emphasized that many important measures of significance of
Kekulé structures are computationally demanding. It can be easily seen that isomor-
phic Kekulé structures have the same values of these invariants, hence it is sufficient
to calculate them for only one representative of each class. Buckminsterfullerene
has 120 automorphisms. They reduce 12,500 Kekulé structures to only 158 noni-
somorphic Kekulé structures. Hence, one can process just a fraction of the original
number of Kekulé structures. In paper [29] all these structures are presented and
some of their properties are described.
19.7 Resonance Graph
Let G be a planar graph with at least one Kekulé structure. Resonance graph
R D R .G/ of G is a graph whose vertices are Kekulé structures and two Kekulé
structures K1 and K2 are adjacent if K1 K2 is a face of G. Especially, if we
observe fullerenes or benzenoids, then we define that K1 and K2 are adjacent if
K1 K2 is a hexagon. The resonance graph has been independently introduced
by several authors [30–32] and by Zhang et al. under the name Z-transformation
[33]. These graphs have been extensively studied in mathematics and chemistry.
It has been proved that resonance graphs of catacondensed benzenoids are con-
nected, bipartite, and that they are either a path or have girth four. Also, it has been
proved that the resonance graph of catacondensed benzenoid has a Hamilton path
[34]. One of the most interesting results is that the resonance graphs of catacon-
densed benzenoid graphs are medians [35]. Let us explain the concept of the median
graphs.
The interval I .u; v/ consists of all vertices on the shortest paths between u and v:
A median of vertices u; v and w is a vertex that lies in I .u; v/ \ I .u; w/ \ I .v; w/ :
A connected graph is a median graph if every triple of its vertices has a unique
median.
This result has been generalized and published in the paper [36]. These results
are very important, because median graphs have been extensively studied (see ref-
erences in [36]). Another interesting consequence of these results is the fact that
every resonance graph can be isometrically embedded into a hypercube. These
results have been a basis for the creation of software for visualization of the res-
onance graph of the benzenoid graph. This software can be downloaded from the
Web page.2
2
http://www-mat.pfmb.uni-mb.si/personal/vesel/visual/visualHBG.html.
Fig. 19.6 Fullerene C70
As we have mentioned, the resonance graph of every catacondensed benzenoid

is connected. However, this is not the case for arbitrary graphs. Resonance graphs of
fullerenes are usually not connected, but have one large component. This large com-
ponent is very important in chemistry, because almost all most significant Kekulé
structures are contained within this component. For instance Buckminsterfullerene
has 5,828 out of 12,500 Kekulé structures in this component [28] and 5,828 struc-
tures (less then 50%) are responsible for more than 99.82% of the energy of the
whole space of Kekulé structures [37].
Let us in more detail present analyses of the fullerene C70 (the second most stable
fullerene). Its graph is presented in Fig. 19.6.
Denote by R the resonance graph of C70 : Let K 2 V the .R/ be any Kekulé
structure. Denote by ŒK the set of all Kekulé structures isomorphic to x and denote
QS D fŒK W K 2 K .C70 /g : Denote by RI the graph with the set of vertices
V .RI / D QS and set of edges
˚
E .RI / D ŒK1 ŒK2 W 9K10 2 ŒK1 9K20 2 ŒK2 .K1 K2 2 E .R// :
By K 0 and K 00 we denote respectively two Kekulé structures given in Fig. 19.7.

It has been shown in paper [38] that these are the only two structures that have
20 conjugate hexagons. Also, they have a maximal number of independent conju-
gated hexagons, independent conjugated cycles, and degree of freedom. However,
there are other structures that have the same values of these three measures, but a
smaller value of the number of conjugated hexagons. Therefore, we may conclude
that these are two of the most important Kekulé structures. One can easily see that
the distance of these the two Kekulé structures in graph R is dR .K 0 ; K 00 / D 5:
Hence, K1 R K2 I i.e., they are in the same component in R: Our aim is to iden-
tify the structures in the component that contains K 0 and K 00 : Graph R has 52,168
Kekulé structures which is quite, a substantial number, but only 2,780 nonisomor-
phic ones. Hence, it is much faster to detect the main component in RI (i.e., the
component that contains ŒK 0 D ŒK 00 ) than in R:The following theorem [38] allows
us just to detect the main component in RI .
Theorem 7. Let K 2 K .C70 /. Then, K R K 0 if and only if ŒK R ŒK 0 :

Fig. 19.7 Kekulé structures

K 0 and K 00
Proof. It is easy to prove that K R K 0 implies ŒK R ŒK 0 . Let us prove

by induction on dRI .ŒK ; ŒK 0 / that the opposite implication holds. Assume that
dRI .ŒK ; ŒK 0 / D 0: Then, K D K 0 or K D K 00 and in both cases K R K 0 : Now,
suppose that d D dRI .ŒK ; ŒK 0 / > 0 and that claim holds for all Kekulé struc-
tures on the smaller distance. Let K 2 V .R/ be such that d .ŒK 0 ; ŒK / D d 1
and that ŒK ŒK 2 E .RI /. From ŒK ŒK 2 E .RI /, it follows that there are
K0 2 ŒK and K0 2 ŒK such thatK0 K 0 2 E .R/. Let be an automorphism

such that .K0 / D K. Note that K0 .K0 / 2 E .R/, i.e.,
that K0 K 2
E .R/. Since K0 2 ŒK , it follows that K 0 R K0 . This implies that
K R K 0 : t
u
Using the computer [38] it has been found that there are 932 out of 2,780 vertices
in the main component of RI . Then, it was discovered that 17,454 out of 52,168
vertices are in the main component of R: Denote by chm .n/, ichm .n/, iccm .n/,
and df m .n/ the numbers of Kekulé structures in the main component that have n
conjugated hexagons, maximally n independent conjugated hexagons, maximally
n, independent conjugated cycles, and degree of freedom equal to n, respectively.
Denote analogously by cho .n/, icho .n/, icco .n/, and df o .n/, numbers of Kekulé
structures that are not in the main component.
Tables 19.1–19.4 show that the term main component is indeed justified.
It can be readily seen that almost all very significant Kekulé structures are within
the main component, while almost all not very significant Kekulé structures are
outside the main component.
19.8 Anti-Kekulé Number
Let G be a connected graph with at least one Kekulé structure. Anti-Kekulé set
E 0 E is the set such that G E 0 is connected, but has no Kekulé structures. Anti-
Kekulé number akn .G/ of graph G is the smallest cardinality of an anti-Kekulé set.
If there is no such set, then akn .G/ D 1: An anti-Kekulé set can be observed as
the measure of the aromaticity of the graph. Anti-Kekulé numbers of fullerenes C20
[39] and C60 and C70 have been determined.
A very important class of fullerenes are leapfrog fullerenes. Leapfrog fullerenes
are fullerenes obtained from other smaller fullerenes by leapfrog transformation.
Let us explain the concept of leapfrog transformation [18, 40].
To define the leapfrog transformation of a fullerene we have to introduce stella-
tion and dualization. Stellation, S t, of a face is achieved by adding a new vertex in
its center followed by connecting it with each boundary vertex. It is also called a
Table 19.1 Distribution of conjugated hexagons among Kekulé

structures
n chm .n/ cho .n/ 100 chm .n/ =
.chm .n/ C cho .n//
0 0 205 0.00
1 0 340 0.00
2 0 1;730 0.00
3 0 2;520 0.00
4 0 3;270 0.00
5 0 5; 400 0.00
6 50 6; 235 0.80
7 700 6;270 10.04
8 2;240 4;910 31.33
9 3;300 2;190 60.11
10 3;532 1;294 73.19
11 3;050 170 94.72
12 2;050 170 92.34
13 1;370 0 100.00
14 600 10 98.36
15 350 0 100.00
16 150 0 100.00
17 30 0 100.00
18 30 0 100.00
19 0 0 not defined
20 2 0 100.00
Table 19.2 Distribution of n ichm .n/ icho .n/ ichm .n/ =

maximal number of .ichm .n/ C icho .n//
independent conjugated
hexagons among Kekulé 0 0 205 0.00
structures 1 0 500 0.00
2 0 3;675 0.00
3 0 3;250 0.00
4 0 5;951 0.00
5 0 14;893 0.00
6 80 6;240 1.27
7 4;702 0 100.00
8 8;800 0 100.00
9 3;872 0 100.00
Table 19.3 Distribution of n iccm .n/ icco .n/ 100 iccm .n/ =
maximal number of .iccm .n/ C icco .n//
independent conjugated
cycles among Kekulé 4 0 1;645 0.00
structures 5 0 8;675 0.00
6 80 12;661 0.63
7 4;702 11;733 28.61
8 8;800 0 100.00
9 3;872 0 100.00
Table 19.4 Distribution of

degrees of freedom among
n df m .n/ df o .n/ 100 df m .n/ =
df m .n/ C df o .n/
Kekulé structures
5 0 2,080 0.00
6 70 13,540 0.51
7 3,020 15,390 16.40
8 8,750 3,652 70.55
9 4,902 52 98.95
10 680 0 100.00
11 32 0 100.00
capping operation or triangulation. When all the faces of a graph are thus operated
on, it is referred to as an omnicapping operation and the resulting graph is denoted
by S t .G/. Dualization, Du, of a graph is built as follows. Locate a point in the cen-
ter of each face. Join two such points if their corresponding faces have a common
edge. The new edge is called the edge dual. Leapfrog, Le, is a composite operation
that can be written as: Le .G/ D Du .S t .G//.
In paper [18], it has been proved that the anti-Kekulé number of all fullerenes
is either 3 or 4 and that for each leapfrog fullerene the anti-Kekulé number can be
established by observing a finite number of cases not depending on the size of the
fullerene.
19.9 Conclusion
In this chapter, several mathematical methods that provide chemically relevant data
have been illustrated. There are many more methods [1] and chemical applications
of perfect matchings [2]. There are whole theories about perfect matchings in math-
ematics, chemistry, and computer science. Also, there are a lot of problems that are
still open. Probably, the hardest and the most interesting one is:
Provide an algorithm for efficient enumeration of the Kekulé structure of any
graph or prove that such an algorithm does not exist.
This problem is directly related to one of the most important problems of theo-
retical computer science, namely: is it true that P D NP ‹
A simpler problem is to analyze different classes of chemically relevant nonpla-
nar compounds (i.e., some classes on nanotubes with specified types of junctions)
and to try to provide an efficient method for enumeration of Kekulé structures for
these types of chemical compounds.
Classification of Kekulé structures is also based on some nonpolynomial algo-
rithms (i.e., an algorithm for finding the degree of freedom). Hence, it is of interest
to try to find as efficient algorithms as possible for some interesting classes of these
structures.
Kekulé structures probably hide some still unknown information about cor-
responding chemical compounds. Hence, it is of interest to further study these
structures.
In conclusion, we may say that Kekulé structures play an important role in chem-
istry and that this fact provides a series of interesting issues in mathematics. Many
relevant problems are solved and many remain open. Many theoretical results have
been obtained and a lot of them are open challenges.
Acknowledgments Partial support of the Ministry of Science, Education and Sports of the
Republic of Croatia is gratefully acknowledged (grant no. 177–0000000-0884 and grant no.
037-0000000-2779).
References
1. Lovász L, Plummer MD (1986) Matching theory. North Holland, Amsterdam

2. Randić M (2003) Aromaticity of polycyclic conjugated hexagons. Chem Rev 103:3449–3605
3. Kuhn HW (1955) The Hungarian method for the assignment problem. Nav Res Logist
Q 2:83–97
4. Veljan D (2001) Combinatorial and discrete mathematics, algoritam, zagreb (in Croatian)
5. Valiant L (1979) The complexity of computing the permanent. Theor Comput Sci 8:189–201
6. Kasteleyn PW (1967) Chapter 2. In: Harary F (ed) Graph theory and theoretical physics. Aca-
demic, New York
7. Jerrum M. Lecture Notes from a Recent Nachdiplomvorlesung at ETH-Zürich “Count-
ing, sampling and integrating: algorithms and complexity” (draft, under construction).
http://www.dcs.ed.ac.uk/home/mrj/pubs.html.
8. Gutman I, Cyvin SJ (1999) Introduction to the theory of benzenoid hydrocarbons. Springer,
Berlin
9. Cyvin SJ, Gutman I (1986) Topological properties of benzenoid systems. Part XXXVI.
Algorithm for the number of Kekulé structures in some pericondensed benzenoids. MATCH
Commun Math Comput Chem 19:229–242
10. Klein DJ, Babić D, Trinajstić N (2002) Enumeration in chemistry. Chem Model Appl Theory
2:56–95
11. Cyvin SJ, Gutman I (1988) Kekulé Structures in benzenoid hydrocarbons. Springer, Berlin
12. Morrison R, Boyd R (1992) Organic chemistry. Prentice-Hall, Englewood Cliffs, NJ
13. Swinborne-Sheldrakem R, Herndon WC, Gutman I (1975) Kekulé structures and resonance
energies of benzenoid hydrocarbons. Tetrahedron Lett 16:755–758
14. Cioslowski J (1986) The generalized McClelland formula. MATCH Commun Math Comput
Chem 20:95–101
15. Gutman I, Markovic S, Marinkovic M (1987) Investigation of the Cioslowski formula. MATCH
Commun Math Comput Chem 22:277–284
16. Pauling L (1960) The nature of the chemical bond and the structure of molecules and crystals:
an introduction to modern structural chemistry. Cornell University Press, Ithaca, NY
17. Randic M (2004) Algebraic Kekulé formulas for benzenoid hydrocarbons. J Chem Inform
Comput Sci 44:365–372
18. Fowler PW, Manolopoulos DE (1995) An atlas of fullerenes. Clarendon Press, Oxford
19. Gutman I, Vukičević D, Graovac A, Randić M (2004) Algebraic kekulé structures of benzenoid
hydrocarbons. J Chem Inform Comput Sci 44:296–299
20. Vukičević D, Žigert P (2008) Binary coding of algebraic kekulé structures of catacondensed
benzenoid graphs. Appl Math Lett 21(7):712–716
21. Vukičević D, Sedlar J (2004) Total forcing number of the triangular grid, Math Commun
9:169–179
22. Vukičević D, Došlić T (2007) Global forcing number of grid graphs. Australas J Combinator
38:47–62
23. Došlić T (2007) Global forcing number of benzenoid graphs. J Math Chem 41:217–229
24. Wang H, Ye D, Zhang H, Wang H (2008) The forcing number of toroidal polyhexes. J Math
Chem 43:457–475
25. Vukičević D, Randić M (2005) On kekulé structures of buckminsterfullerene. Chem Phys Lett
401:446–450
26. Vukičević D, Gutman I, Randić M (2006) On instability of fullerene C72. Croat Chem Acta
79:429–436
27. Kroto HW, Heath JR, O’Brien SC, Curl RF, Smalley RE (1985) C60: Buckminsterfullerene.
Nature 318:162–163
28. Randić M, Kroto H, Vukičević D. Kekulé structures of buckminsterfullerene, Adv Quantum
Chem (submitted)
29. Vukičević D, Kroto HW, Randić M (2005) Atlas of Kekulé valence structures of buckminster-
fullerene. Croat Chem Acta 78:223–234
30. El-Basil S (1993) Kekulé structures as graph generators. J Math Chem 14:305–318
31. Gründler W (1982) Signinkante elektronenstrukturen fur benzenoide kohlenwasserstoffe. Wiss
Z Univ Halle 31:97–116
32. Randić M (1997) Resonance in catacondensed benzenoid hydrocarbons. Int J Quantum Chem
63:585–600
33. Zhang F, Guo X, Chen R (1988) Z-transformation graphs of perfect matchings of hexagonal
systems. Discrete Math 72:405–415
34. Chen R, Zhang F (1997) Hamilton paths in Z-transformation graphs of perfect matchings of
hexagonal systems. Discrete Appl Math 74:191–196
35. Klavžar S, Žigert P. Resonance graphs of catacondensed benzenoid graphs are median,
Manuscript
36. Klavžar S, Žigert P, Brinkmann G (2002) Resonance graphs of catacondensed even ring sys-
tems and medians. Discrete Math 253:35–43
37. Flocke N, Schmalz TG, Klein DJ (1998) Variational resonance valence bond study on the
ground state of C60 using the Heisenberg model. J Chem Phys 109:873–880
38. Randić M, Vukičević D (2006) Kekulé structures of Fullerene C70. Croat Chem Acta
79:471–481
39. Vukičević D. Total forcing number and Anti-forcing number of C20 , preprint
40. Kutnar K, Sedlar J, Vukičević D (2009) On the Anti-Kekulé number of Leapfrog Fullerenes.
J Math Chem 45:406–416
Index
G X, 320 centre, 50
G e, 320 centroid, 55
G v, 320 characteristic polynomial, 258
D .G/, 320 characteristic polynomials, 321
9rn.G/, 322 chord diagram, 269
8rn.G/, 321 signed, 269
sim.G; H /, 320 chordal graph, 55
k-connected, 221 chromatic distance, 352
n-cube, 56 chromatic metric, 352
r-regular graphs, 327 chromatic polynomial, 275
G .n; 12 /, 323 chromatic polynomials, 321
chromatically alien, 337, 340
chromatically related, 337, 340
circle graph, 274
a.e., 322 circuit, 221
active edge circuit partition polynomial, 270, 282, 283
externally, 225, 247 clique number, 348
internally, 225, 247 cocycle, 221
adversary reconstruction number, 321 -coloring, 232
alien, 337, 340, 352 complement of class, 338
ally reconstruction number, 322 complex
almost every, 322 face, 240
anticircuit, 231 facet, 240
automorphism group, 322 pure, 240
avalanche, 237 simplicial, 240
average distance, 58 configuration
critical, 237
ice, 236
bad coloring polynomial, 234 level, 237
symmetric function extension, 276 of a system, 237
stable, 237
ˇ invariant, 242
weight, 237
boundary components, 268
convex hull, 64
bouquet graph, 269
convexity, 64
bridge, 221
convolution, 248
cover polynomial, 287
critical configuration polynomial, 238
caterpillar, 329 cut, 221
cellular embedding, 267 -edge, see bridge
483
484 Index
cycle, 221 deletion, 221

cycle-complete graph, 51 dual, 222
cyclic graph polynomial, 267 dual-chordal, 244
cyclomatic number, 238 Eulerian, 270, 280
Eulerian digraph, 270
induced, 221
deck, 320 invariant, 221
degree sequence, 321, 328 medial, 229
diameter, 50 minor, 221
Dijkstra’s algorithm, 67 one-point join, 224
dissipation, 237 orientation, 230
distance, 50 planar, 222
distance between graphs, 320 plane, 222
distance hereditary, 57 reconstructible, 262
distant relatedness, 349 series–parallel, 243
spanning, 221
topological, 267
eccentricity, 50 weighted, 276
edge graph bipartite, 341
ordinary, 221 graph entropy, 105 ff
edge-deleted subgraph, 320 Graph Isomorphism Problem, 320, 331
edge-difference polynomial, 258 graph polynomial, 221
Eulerian digraph, 270 graph state, 259, 280
Eulerian graph, 280
Eulerian graph state, 270
existential reconstruction number, 322 h-vector, 241
Hamiltonian, 285
Hamming graph, 56
F-polynomial, 287
f -vector, 240
face enumerator, 240 idiosyncratic polynomial, 258
fat graph, 267 induced subgraph, 320
flow inexact graph matching, 320
H -flow, 235 interlace polynomial, 272, 283
nowhere zero, 235 isomorphic, 220
Floyd–Warshall algorithm, 67 isotropic system, 272
forest, 221
four-thirds conjecture, 61
Kauffman bracket, 282
generalized transition polynomial, 281

geodesic, 50 Laplacian matrix, 228
GI, 320, 331 linear subgraph, 261
girth-endvertex property, 343 local complementations, 273
GRAFFITI, 60 loop, 221
graph
bicycle space, 229
block of, 246 Martin polynomial, 229, 282
bouquet, 269 i -matching, 262
card, 262 matching generating polynomial, 263, 276
contraction, 221 matching polynomial, 262, 276
cycle space, 229 matrix
deck, 262 totally unimodular, 266
Index 485
median, 54 Tutte, 274, 276, 280, 285, 286

metric dimension, 66 Tutte-Martin, 272
U-, 276
vertex-nullity, 272
network motifs, 332 W-, 276
nullity, 222 polytope
convex, 265
Potts model partition function, 285
property Ak , 323
orientation
acyclic, 230
totally cyclic, 230
oriented graph, 63 radius, 50
rank, 222
RC, 321
Reconstruction Conjecture, 321
pair weight, 281 reconstruction number, 322
parametrized Tutte polynomial, 278 relatedness, 337, 352
path tree, 264 reliability polynomial, 238
path-complete graph, 52 resolving set, 66
Penrose polynomial, 259, 282 ribbon graph, 267
pivot operation, 272 ribbon graph polynomial, 267
polychromate, 277 rotation scheme, 267
polynomial
acyclic, 263
bad coloring, 234
Bollobás–Riordan, 267 score vector, 230
characteristic, 258, 260 shelling, 241
chromatic, 275 shelling polynomial, 241
circuit partition, 270, 282, 283 signed chord diagram, 269
cover, 287 similarity between two graphs, 320
critical configuration, 238 skein relation, 281
cyclic graph, 267 state model, 259
edge-difference, 258 state weight, 281
F, 287 status, 54
generalized transition, 281 Steiner distance, 68
idiosyncratic, 258 Subgraph Isomorphism Problem, 331
interlace, 283 subgraph similarity, 320
Kauffman bracket, 282 sunshine graph, 329
Martin, 229, 282 symmetric chromatic polynomial, 275
matching, 260, 262 systems biology, 332
matching defect, 263
matching generating, 263
parametrized Tutte, 278 topological graphs, 267
Penrose, 259, 282 topological Tutte polynomial, 268
quasi-, 265 tournament, 64
reference, 263 trail, 221
reliability, 238 transcription networks, 332
ribbon graph, 267 transition polynomial, 281, 282
rook, 263 tree, 221
symmetric bad coloring, 276 triangle inequality, 50
symmetric chromatic, 275 Tutte polynomial, 274, 276, 280, 285, 286
topological Tutte, 267, 268 uniqueness property, 227
transition, 281, 282 universal property, 226
486 Index
Tutte-Gröthendieck invariant, 226 vertex-deleted subgraph, 320

Tutte-Martin polynomial, 272 vertex-nullity interlace polynomial, 272
U-polynomial, 276
W-polynomial, 276
unicyclic graphs, 329
weight system, 281
universal reconstruction number, 321
vertex state, 280 zonotope, 266

vertex state weight, 281 unimodular, 266

Structural Analysis of Complex Networks 2011

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Structural Analysis of Complex Networks 2011

Uploaded by

Copyright:

Available Formats

Matthias Dehmer

ISBN 978-0-8176-4788-9 e-ISBN 978-0-8176-4789-6

Library of Congress Control Number: 2010938359

c Springer Science+Business Media, LLC 2011

Printed on acid-free paper

Because of the increasing complexity and growth of real-world networks, their

Hall in Tirol, April 2010 Matthias Dehmer

1 A Brief Introduction to Complex Networks

5 Spectrum and Entropy for Infinite Directed Graphs . . . .. . . . . . . . . . . . . . . . .105

6 Application of Infinite Labeled Graphs to Symbolic

7 Decompositions and Factorizations of Complete Graphs .. . . . . . . . . . . . . . .169

8 Geodetic Sets in Graphs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .197

9 Graph Polynomials and Their Applications I:

10 Graph Polynomials and Their Applications II:

11 Reconstruction Problems for Graphs, Krawtchouk

12 Subgraphs as a Measure of Similarity . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .319

13 A Chromatic Metric on Graphs .. . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .335

14 Some Applications of Eigenvalues of Graphs . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .357

15 Minimum Spanning Markovian Trees: Introducing

16 Link-Based Network Mining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . .403

17 Graph Representations and Algorithms in Computational

18 Inference of Protein Function from the Structure

19 Applications of Perfect Matchings in Chemistry . . . . . . . . .. . . . . . . . . . . . . . . . .463

Nawarat Ananchuen Department of Mathematics, Faculty of Science,

Jun Ichi Fujii Department of Arts and Sciences (Information Science),

Pang-Ning Tan Computer Science and Engineering Department,

Abstract In this chapter we present a brief introduction to complex networks and

Keywords Complex networks Centrality measures Comparative network

MSC2000: Primary 05C90; Secondary 65C60, 46N60, 94A17

M. Dehmer (ed.), Structural Analysis of Complex Networks, 1

1.2 Important Network Classes

We begin this chapter by reviewing well-known network classes. In the following

1.2.1 Simple Networks

1.2.2 Random Networks

probability p. The expected number of edges for a (undirected) network constructed

1.2.3 Degree Distribution

The degree distribution of a node i in a random network is binomial

1.2.4 Clustering Coefficient

In general the clustering coefficient of a node i is defined as the fraction Ei of

because the mean degree of a node is z D p.N 1/ pN .

1.2.5 Small-World Networks

1.2.6 Scale-Free Networks

Neither random nor small-world networks have a property frequently observed in

which means that there is no “top” or “bottom”

A graph G is a tree if it has no loops (cycles) in G. This means that a tree is an

Fig. 1.2 Trees

Fig. 1.4 Rooted binary trees

1.2.8 Generalized Trees

Fig. 1.5 Left: Tree. Right: Generalized tree

1.3 Structural Network Analysis

In this section, we summarize measures to characterize structural properties of

1.3.1 Degree Distribution

Degree distributions [16, 88] can be calculated by

P .k/ k ; > 1: (1.9)

1.3.2 Clustering Coefficient

1.3.3 Path-Based Measures

Graph-theoretical quantities or properties are often used to characterize special types

Mean or Characteristic Distance

E is the total number of edges in the network.

Eccentricity, Diameter, and Radius

Let G D .V; E/ be a graph. Then,

.v/ D max d.u; v/; (1.13)

is called the eccentricity of v 2 V .

.G/ D max .v/; (1.14)

for k 6D i . We want to emphasize that Q can be calculated by just evaluating

Classical information measures, e.g., entropy, conditional entropy, and mutual

f V .vi / WD ˛ c1 jS1 .vi ;G/jCc2 jS2 .vi ;G/jCCc.G/jS.G/ .vi ;G/j ;

mii D P D fG 2 I W diam.G/ kg: