Professional Documents
Culture Documents
A Detailed Lesson Plan in Science 10: (Genetic Mutation)
A Detailed Lesson Plan in Science 10: (Genetic Mutation)
Science 10
(GENETIC MUTATION)
Prepared By:
CYRIL BAUA CAUILAN
Pre-Service Teacher
Checked By:
Mrs. Catherine Balubal
Cooperating Teacher
I. Objectives:
At the end of the lesson the learners should be able to:
A.) examine different types of mutations;
B.) observe possible effects of mutations, and;
C.) manage issues pertaining to persons suffering from mutation
Gene1:
TACTTGTTTACATAACTTTGAATT
Step 1. Transcribe the DNA to mRNA
AUGAACAAAUGUAUUGAAACUUAA
Step 2. Draw lines to separate the
mRNA into codons (3 bases). AUG-AAC-AAA-UGU-AUU-GAA-
ACU-UAA
Step 3. Using the newly made mRNA,
translate it into its corresponding Start Codon (Methionine)-
protein fragment. Refer to Figure 1 Asparagine-Lysine-Cysteine-
(The Genetic Code Table). Don't forget Isoleucine-Glutamic Acid-Threonine-
to look for the start and stop codon. Stop Codon
Very good class that you were able to
master how to transcribe DNA into
RNA and translate RNA into proteins
Recalling Activity
Motivation
Very Good.
How about Its Hulk sir
this one?
X-Men sir
Excellent how about this last picture?
Presentation
Before we formally start our new A.) explain how mutations may
discussion this morning, let us check cause changes in structure and
first our objectives. functions of a protein;
Who ca read the first one? B.) distinguish the different types of
mutations, and;
Lesson Proper
Very Good
There are two types of mutation, the Sir the gene mutation is a
gene mutation and the chromosomal permanent change in the DNA
mutation. sequence that makes up a gene.
What is gene mutation? Sir in DNA cytosine is paired
guanine and adenine-is paired
thymine while in RNA is cytosine is
paired guanine and adenine to
Can you still remember the base pairs
uracil.
of our DNA and RNA? what are these?
What is translocation?
One or more gene(s) are removed
from one chromosome and inserted
into another chromosome.
Application
1. 2.
4.
3.
What are the two types of mutation? Sir under gene mutation is the point
mutation and frameshift mutation.
None sir.
What is chromosomal mutation?
IV. Evaluation
In 1 whole sheet of paper, answer the following questions: (10pts.)
1. If you have a family member with Down syndrome, what will you do?
2. Base on the causes of mutation, how can you prevent your DNA from
mutation?
V. Assignment
A. Follow Up
Create a Slogan or poster on how to promote the rights of people who are
suffering from genetic mutation.
B. Advance
For your assignment, search the following:
1. What are Fossils?
2. Give evidence from Fossil records
3. What is Geological Time Scale?
Alexander, P., Bahret, M.J., Chaves, J., Courts, G., and Naomi Skolky
D'Alessio. Biology: The Living World. Englewood Cliffs, New Jersey: Prentice
Hall, Inc., 1989.