miR172 Regulates both Vegetative and Reproductive

Development in the Perennial Woody Plant Jatropha curcas

Mingyong Tang1, Xue Bai1,2, Long-Jian Niu1, Xia Chai1,2, Mao-Sheng Chen1 and Zeng-Fu Xu 1,
*
1
CAS Key Laboratory of Tropical Plant Resources and Sustainable Use, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, Menglun,
Mengla, Yunnan 666303, China

Regular Paper
2
College of Life Sciences, University of Chinese Academy of Sciences, Beijing 100049, China
*Corresponding author: E-mail, [email protected]; Fax, +86-691-8715070.
Subject area: Growth and development
(Received May 11, 2018; Accepted August 21, 2018)

Jatropha curcas is a promising feedstock for biofuel production have gained significant attention as a promising fuel (Mofijur

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

because its oil is highly suitable for processing bio-jet fuels and et al. 2016). Physic nut (Jatropha curcas L.), a perennial woody
biodiesel. However, Jatropha exhibits a long juvenile stage in plant belonging to the Euphorbiaceae family, is monoecious,
subtropical areas. miR172, a conserved small non-protein- with male and female flowers borne on the same inflorescence
coding RNA molecule with 21 nucleotides, regulates a wide (Divakara et al. 2010, Wu et al. 2011, Pandey et al. 2012). The
range of developmental processes. To date, however, no studies genome sequence and genetic mapping of Jatropha have been
have examined the function of miR172 in Jatropha. There are published (Sato et al. 2011, Hirakawa et al. 2012, Wu et al. 2015,
five miR172 precursors encoding two mature miR172s in Xia et al. 2018), and several genetic transformation methods
Jatropha, which are expressed in all tissues, with the highest mediated by Agrobacterium tumefaciens have been established
expression level in leaves, and the levels are up-regulated with (Kumar et al. 2010, Pan et al. 2010, Kajikawa et al. 2012, Misra
age. Overexpression of JcmiR172a resulted in early flowering, et al. 2012, Fu et al. 2015, Gu et al. 2015). Hence, compared to
abnormal flowers, and altered leaf morphology in transgenic other perennial woody plants, it is fully realizable to isolate
Arabidopsis and Jatropha. The expression levels of miR172 Jatropha genes and analyse their functions. Jatropha has been
target genes were down-regulated, and the flower identity suggested to have oil-crop potential because of its high oil
genes were up-regulated in the JcmiR172a-overexpressing content, high biomass productivity, adaptability to marginal
transgenic plants. Interestingly, we showed that JcmiR172 land under a wide range of climatic conditions, and non-
might be involved in regulation of stem vascular development competitiveness with food production (Pua et al. 2011,
through manipulating the expression of cellulose and lignin Akashi 2012, Pandey et al. 2012, Khalil et al. 2013). The highest
biosynthesis genes. Overexpression of JcmiR172a enhanced oil contents of Jatropha seeds and kernels are 40% and 50% by
xylem development and reduced phloem and pith develop- weight, respectively (Pan and Xu 2011, Sinha et al. 2015). Oil of
ment. This study helped elucidate the functions of miR172 Jatropha seed contains high concentration of polyunsaturated
in perennial plants, a known age-related miRNA involved in fatty acids which improves the crude oil flow; therefore,
the regulation of perennial plant phase change and organ Jatropha seed oil is suitable as a feedstock for the production
development. of bio-jet fuel and biodiesel (Pramanik 2003, Ong et al. 2011).
Jatropha cultivation can alleviate future energy crises and
Keywords: Age  Early flowering  Flower pattern 
reduce environment pollution. However, the potential of
Lignification  miR172  Physic nut.
Jatropha as an energy plant is limited by its low seed yield
Abbreviations: AP1, APETALA 1; AP2, APETALA 2; AP3, production character (King et al. 2015). Jatropha exhibits an
APETALA 3; AG, AGAMOUS; CAL, CAULIFLOWER; CaMV, overabundance and undesirable range of vegetative leaves and
cauliflower mosaic virus; FUL, FRUITFULL; FT, FLOWERING branches that could develop into reproductive branches under
LOCUS T; LD, long day; LFY, LEAFY; qRT-PCR, quantitative suitable conditions and exhibits a long juvenile phase in sub-
reverse transcriptase-polymerase chain reaction; SEP, tropical areas (Tang et al. 2016a, b). Thus, it is necessary to
SEPALLATA; SMZ, SCHLAFMUTZE; SNZ, SCHNARCHZAPFEN; reduce abundant vegetative growth (Ghosh et al. 2010, Song
SOC1, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1; et al. 2013, Tjeuw et al. 2015). In addition, unreliable and poor
SPL, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE; SVP, flowering are crucial factors that contributes to low seed yield
SHORT VEGETATIVE PHASE; TFL1, TERMINAL FLOWER 1; production in Jatropha (Divakara et al. 2010). Furthermore, soft
TOE, TARGET OF EAT. stems make Jatropha highly susceptible to lodging and root rot
diseases (Dhillon et al. 2009).
In animals and plants, stage transitions are necessary and vital
Introduction
in the developmental process (Moss 2007). In Caenorhabditis
With the decreasing availability of fossil fuels and the deterior- elegans, transitions between the stages of larval development
ation caused by environmental pollution, biodiesel resources are mediated by an increase in the expression of two sequentially

Plant Cell Physiol. 59(12): 2549–2563 (2018) doi:10.1093/pcp/pcy175, Advance Access publication on 24 August 2018,
available online at www.pcp.oxfordjournals.org
! The Author(s) 2018. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/
licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited.
For commercial re-use, please contact [email protected]
 M. Tang et al. | miR172 regulates both vegetative and reproductive development in the perennial woody plant Jatropha curcas

expressed miRNAs, lineage (lin)-4 and lethal (let)-7 (Pasquinelli soybean (Yan et al. 2013). Also miR172 was found to have a
and Ruvkun 2002, Carrington and Ambros 2003, Moss 2007). role in the abiotic response of Arabidopsis (Han et al. 2013) and
lin-4 and let-7 were the first miRNAs identified, and they have biotic stress resistance in tomato (Luan et al. 2018). In addition,
since served as paradigms for the functions of these regulatory miR172 causes early flowering and defects in floral organ iden-
molecules in animals (Bagga et al. 2005). MicroRNAs function as tity when overexpressed (Aukerman and Sakai 2003).
post-transcriptional modulators of gene expression in eukaryotic Furthermore, miR172 promotes flowering primarily by post-
cells (Inui et al. 2010). In the annual plants Arabidopsis and maize, transcriptionally repressing a set of AP2-like genes, such as
vegetative phase change was controlled by the sequential activity AP2, TOE1, TOE2, TOE3, SMZ, and SNZ (Fornara and
of miR156 and miR172 (Chuck et al. 2007a, Wu et al. 2009). Coupland 2009, Mathieu et al. 2009, Yant et al. 2010).
miR156 is highly expressed early in plant development and de- Previous studies have shown that miR172-overexpressing
creases with time, while miR172 exhibits the opposite expression Arabidopsis plants exhibit early flowering by regulating
pattern (Aukerman and Sakai 2003, Lauter et al. 2005, Jung et al. FLOWERING LOCUS T (FT) (Lee et al. 2007, Lee et al. 2010,
2007, Wang et al. 2009, Wu et al. 2009). In woody species, such as Diaz-Manzano et al. 2018). FRUITFULL (FUL) positively regu-

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

Acacia confusa, A. colei, Hedera helix, Eucalyptus globulus, and lates miR172c expression in fruit valves by directly binding to
Quercus acutissima, similar expression patterns were observed CArG motifs in the miR172c promoter (Jose Ripoll et al. 2015).
in the expression of miR156 and miR172 and their target genes Overexpression of miR172a and b in tomato increased resist-
(Wang et al. 2011). ance to Phytophthora infestans infection by suppressing an
The mature miR172 sequence is conserved in higher plants. AP2/ERF transcription factor (Luan et al. 2018).
However, the numbers of pri-miR172, mature miR172, and target To date, most of the known functions of miR172 were deter-
genes are varied. In Arabidopsis, five pri-miR172s encode three mined in annual herbaceous plants. miR172 was shown to have
mature miR172s, and these miR172s repress the expression of six the lowest abundance in seedlings and increased during the
members of the APETALA 2 (AP2)-like family of transcription fac- juvenile-to-adult transition in several perennial trees (Wang
tors—AP2 itself, three TARGET OF EAT (TOE) proteins (TOE1, et al. 2011). Although the microRNAs in Euphorbiaceae
TOE2, and TOE3), and SCHLAFMUTZE (SMZ) and its paralog plants, including Ricinus communis, Manihot esculenta, Hevea
SCHNARCHZAPFEN (SNZ) (Fornara and Coupland 2009, Mathieu brasiliensis, and Jatropha, were isolated and compared (Zeng
et al. 2009). In maize, five pri-miR172s encode only one mature et al. 2009, Wang et al. 2012), the functions of these microRNAs
miR172, which represses the expression of six members of the remain unknown. In this study, we analyzed the expression
AP2-like family of transcription factors—ZmGL15, ZmIDS1, profiles of Jatropha miR172 (JcmiR172) and further character-
ZmSTD1, ZmTOE1, TS6-ref, and TS6-GN2230 (Zhu and Helliwell ized the function of JcmiR172a in leaf morphology, flowering
2011). In rice, four pri-miR172s encode two mature miR172s and induction, floral organ specification, and fruit and seed
repress five members of the AP2-like family of transcription factors, morphologies using transgenic Arabidopsis and Jatropha. In
including OsSNB, Os03g60430, Os05g03040, Os04g55560, and particular, we found that miR172 plays a role in regulating
Os6g43220 (Zeng et al. 2009, Zhu and Helliwell 2011, Lee and An xylem development in both Arabidopsis and Jatropha.
2012). In Populus trichocarpa, nine pri-miR172s encode four mature
miR172s with six target genes (Zeng et al. 2009).
The transcription of miR172 is positively regulated by Results
SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 9 (SPL9)
and SPL10 (Wu et al. 2009), and SPLs are the direct targets of
Prediction of miR172 target genes and analysis of
miR156 (Wu and Poethig 2006, Wang et al. 2008, Fornara and expression patterns of miR172 in Jatropha
Coupland 2009), thus establishing a miR156-SPL-miR172 regu- According to the Arabidopsis miR172 sequence (http://www.
latory cascade (Yu et al. 2015). However, SHORT VEGETATIVE mirbase.org/) and the Jatropha genomic sequence database
PHASE (SVP) negatively regulates miR172a transcription by (http://www.ncbi.nlm.nih.gov/genome/genomes/915), five
direct binding to its promoter (Cho et al. 2012). TOE1 and miR172 precursors were found in Jatropha and named
TOE2 positively regulate miR172 by a negative feedback loop JcmiR172a-e (Supplementary Fig. S1). JcmiR172a-d encode a
(Wu et al. 2009). Recent research found that miRNA172 is mature miR172, whose sequence (AGAAUCUUGAUGAUGC
modulated by auxins (Diaz-Manzano et al. 2018).It has been UGCAU) is the same as that of Arabidopsis miR172, whereas
shown that miR172 is involved in various developmental pro- JcmiR172e encodes another mature miR172 with a sequence
cesses in plants, including stem cell fate (Zhao et al. 2007), (GGAAUCUUGAUGAUGCUGCAG) different from that of
developmental timing (Fornara and Coupland 2009, Wu et al. Arabidopsis miR172s (Supplementary Fig. S1A).
2009, Jung et al. 2011, Wang et al. 2011, Lee et al. 2014, Yu et al. The Jatropha genomic database was screened by TBLASTN
2015, Fouracre and Poethig 2016), sex determination (Chuck using the amino acid sequence of the miR172-targeted
et al. 2007b, Tang and Chu 2017), floral organ identity and Arabidopsis AP2-like family of transcription factors as a query.
flower pattern (Aukerman and Sakai 2003, Lee and An 2012), By this screening, four putative cDNAs with high homology to
fruit growth (Xue et al. 2009, Gasser 2015, Jose Ripoll et al. 2015), AP2-like were identified in the Jatropha genomic database.
spike architecture and grain threshability in bread wheat Based on this similarity, we named these four genes JcAP2,
(Debernardi et al. 2017, Liu et al. 2018), tuberization in potato JcTOE1, JcTOE2, and JcTOE3 (GenBank accession numbers are
(Martin et al. 2009, D’Ario et al. 2017), and nodulation in listed in Supplementary Table S1). Further analysis found the

2550
 Plant Cell Physiol. 59(12): 2549–2563 (2018) doi:10.1093/pcp/pcy175

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

Fig. 1 Prediction of JcmiR172 target genes and the expression patterns of JcmiR172 in Jatropha. (A) Predicted JcmiR172a target genes and
positions of miR172a target sites within the putative JcmiR172 target genes are shown; pink UGA in JcTOE3 indicates the termination codon. The
cDNA sequences of JcAP2 (sequence ID XM_012223882), JcTOE1 (sequence ID XM_012209527), JcTOE2 (sequence ID NW_012124616), and
JcTOE3 (sequence ID XM_012218287) were downloaded from the NCBI web site (http://www.ncbi.nlm.nih.gov/). (B) Expression levels of
JcmiR172 in cotyledons and young leaves of plants of different ages; Co, cotyledon; FL, the first leaf of Jatropha seedlings; 3M, young leaves
of 3-month-old non-flowering Jatropha; 6M, young leaves of 6-month-old non-flowering Jatropha; 1Y, young leaves of 1-year-old non-flowering
Jatropha; 3Y, young leaves of 3-year-old non-flowering Jatropha; 3YF, young leaves of 3 years old flowering Jatropha; 5YF, young leaves of 5-year-
old flowering Jatropha. (C) Expression levels of JcmiR172 in different tissues of a mature Jatropha plant. R, roots; S, stems; YL, young leaves; ML,
mature leaves; SA, shoot apex; IF, inflorescence buds; MF, male flowers; FF, female flowers; Fr, fruits. The qRT-PCR results were obtained from
three independent biological replicates and three technical replicates for each sample; the error bars show the standard deviation. The levels of
detected amplicons were normalised using the amplified products of JcActin1.

miR172 target sites are contained in the coding sequences and Jatropha. Similar miR172 expression patterns had also been
30 -UTR regions of the target genes (Fig. 1A). observed in Arabidopsis, rice and maize (Aukerman and Sakai
To determine where miR172 is expressed during Jatropha 2003, Lauter et al. 2005, Zhu et al. 2009).
development, we analyzed the miR172 expression profiles in
various tissues by qRT-PCR according to Varkonyi-Gasic et al. Characterisation of the JcmiR172a functions in
(2007). The mature miR172a–e sequences differ only in their 50 transgenic Arabidopsis
and 30 end bases (Supplementary Fig. S1), and therefore, a pair of To test the functions of JcmiR172a, we transformed the 35S:
miR172a primers can detect the expression of all mature JcmiR172a construct into Arabidopsis for preliminary analysis.
miR172s; qRT-PCR was performed with total RNAs extracted Transgenic plants were confirmed by qRT-PCR analysis the
from various tissues. The results indicated that there was an expression level of miR172 (Supplementary Fig. S2). We selected
age-related increase in miR172 expression in Jatropha (Fig. 1B), two independent homozygous lines, L2 and L4, in the T2 gener-
which is consistent with a recent study of dynamics of miR172s ation to further examine the phenotypes. L2 and L4 generated
during a production cycle of Jatropha (Sánchez-Gutiérrez et al. flowers 14–15 days earlier and produced approximately nine
2018). The lowest expression level was observed in the first leaf fewer rosette leaves than that of WT plants under LD conditions
of the seedlings rather than cotyledons; with the age increasing, (Fig. 2A–C; Table 1). Therefore, overexpression of JcmiR172a in
the transcription level of miR172 was increased continually. The Arabidopsis significantly reduced vegetative growth time.
highest level was observed in five-year-old plants (Fig. 1B). The Furthermore, compared with WT plants, the transgenic
expression pattern of miR172 in Jatropha plants of different ages plants showed altered leaf sizes and morphologies (Fig. 2D
was consistent with that in other trees (Wang et al. 2011). We and E). The sizes of rosette and cauline leaves were reduced
also examined the miR172 expression levels in different organs of in transgenic Arabidopsis. In contrast to the rosette leaves of
Jatropha plants. As shown in Fig. 1C, miR172 was expressed in all WT, which exhibited obvious serrations, the rosette leaves of
organs. The highest level was exhibited in the leaves, and high transgenic plants showed a smooth edge. Furthermore, the leaf
expression was observed in the shoot apex; miR172 expression basal angle was smaller than that of the WT plants (Fig. 2D–G),
varied considerably between organs and developmental stages of which is similar to the results reported by Jung et al. (2011).

2551
 M. Tang et al. | miR172 regulates both vegetative and reproductive development in the perennial woody plant Jatropha curcas

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

Fig. 2 JcmiR172a promoted vegetative to reproductive phase change in Arabidopsis. (A-C) Wild-type (WT, A), 35S: JcmiR172a transgenic L2 (B) and L4
(C) Arabidopsis grown in long-day (LD) conditions for 15 days; flower buds appeared in the transgenic plants. (D) Rosette leaves of WT and 35S: JcmiR172a
transgenic Arabidopsis; the first, second, and third rosette leaves are shown, and the leaf basal angle is labeled. (E) Cauline leaves of WT and 35S: JcmiR172a
transgenic Arabidopsis. Bar = 1 cm. (F) The fourth rosette leaf of WT, bar = 2 mm. (G) The fourth rosette leaf of 35S: JcmiR172a transgenic plants; bar = 2 mm.

Table 1 Overexpression of JcmiR172a promotes flowering in We further analyzed the gene expression in 35S: JcmiR172a
Arabidopsis under LD conditions transgenic Arabidopsis plants showing early flowering and ab-
Lines Number of Rosette leaves Flower bud normal flowers via qRT-PCR. The results showed that high
plants formation time/Day miR172 levels down-regulated several AP2-like genes, including
WT 25 12.21 ± 1.04 24.56 ± 1.33 AtAP2, AtTOE1, AtTOE2, AtSMZ, and AtSNZ, in seedlings and
L2 35 3.56 ± 0.75** 9.47 ± 1.44** flowers (Supplementary Fig. S2), which act as flowering repres-
L4 37 3.92 ± 0.63** 10.13 ± 1.38** sors (Aukerman and Sakai 2003). In addition, the expression of
WT plants and two independent JcmiR172a-overexpressing lines (L2 and L4)
the floral meristem identity genes AtLEAFY (AtLFY), AtFUL,
grown under LD conditions (16 h light/8 h dark) were subjected to the analysis AtAP1 and AtCAL and the floral organ identity genes AtSEPs
of rosette leaves and flowering times. The rosette leaves and flowering times are (AtSEP1, AtSEP2, AtSEP3) were significantly up-regulated in ten-
presented as the mean ± standard deviation. **Significantly different from the
control at the 1% level.
day-old transgenic seedlings (Supplementary Fig. S2). However,
the floral organ identity genes AtAGAMOUS (AtAG), AtAP3 and
AtSEP2 were down-regulated in transgenic Arabidopsis flowers
The fourth rosette leaf of the 35S: JcmiR172a transgenic plants (Supplementary Fig. S2).
was ovate with few trichomes on the adaxial side (Fig. 2G, The phenotypes of early flowering and abnormal flowers
Supplementary Fig. S3), which represents a leaf morphology produced by ectopic expression of JcmiR172a in transgenic
associated with the adult vegetative phase (Wu et al. 2009). Arabidopsis were similar to those produced by miR172 over-
More trichomes on the abaxial side, however, were found in expression (Chen 2004). Gene expression analysis indicated
transgenic Arabidopsis than that in WT plants (Supplementary that miR172 caused early flowering by down-regulating AP2-
Fig. S3). These observations indicate that miR172 also regulates like floral repressors. The abnormal flowers appeared due to
developmental timing in addition to floral induction. miR172 directly repressing the floral identity gene AP2 and in-
The floral pattern was also changed in transgenic directly repressing other floral identity genes, including AtAP3,
Arabidopsis. The sepals, petals, and pistils were all smaller AtAG, and AtSEP2 (Supplementary Fig. S2).
than that in WT (Fig. 3B–G and J); the petals of each flower
were variable in size (Fig. 3G). Petals and stamens were partially Overexpression of JcmiR172a in Jatropha changed
absent (Fig. 3C, I), and the absent stamens in the third the leaf and stem morphologies
whorl were fused to the petals in the second whorl in transgenic We generated transgenic Jatropha plants overexpressing the
Arabidopsis (Fig. 3G). The major phenotypes of JcmiR172a- JcmiR172a precursor driven by the 35S promoter. Elevated
overexpressing plants were similar to those of the Arabidopsis levels of miR172 were detected in JcmiR172a overexpression
ap2 mutants described by Kunst et al. (1989). plants (Supplementary Fig. S4A). The leaves of the transgenic

2552
 Plant Cell Physiol. 59(12): 2549–2563 (2018) doi:10.1093/pcp/pcy175

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

Fig. 3 Flower phenotypes of 35S: JcmiR172a transgenic Arabidopsis. (A) Flower of WT. (B and C) Flowers of 35S: JcmiR172a transgenic
Arabidopsis; the petals are shown by red arrows. (D) Sepal anatomy of WT Arabidopsis. (E) Sepal anatomy of 35S: JcmiR172a transgenic
Arabidopsis. (F) Petal anatomy of WT Arabidopsis. (G) Petal anatomy of 35S: JcmiR172a transgenic Arabidopsis; a stamen fused to petal is
shown by a pink arrow. (H) Stamen anatomy of WT Arabidopsis. (I) Stamen anatomy of 35S: JcmiR172a transgenic Arabidopsis; one stamen
absent in 35S: JcmiR172a transgenic Arabidopsis. (J) Comparison of the carpels in WT and transgenic plants; bar = 1 mm.

Jatropha were smaller, the leaf shape and leaf margin were diameter of miR172-overexpressing Arabidopsis was reduced
altered, and the petiole length, leaf length and width were by approximately 0.4–0.6 mm (Supplementary Fig. S5D); the
all significantly reduced compared to those of the WT results of transgenic Arabidopsis stem were similar to those
plants (Fig. 4A, B, Table 2). The leaf lobes disappeared in of transgenic Jatropha. A comparison of the stem structure
mature leaves of transgenic Jatropha plants (Fig. 4A, B). The from pictures of shoot cross-sections of stems from different
stem morphologies also changed in transgenic Jatropha. We genotype plants showed that the number of vascular bundles
compared 20 progeny seedlings of L32 and L47 transgenic was reduced in transgenic Arabidopsis. Generally, there are
plants with WT plants and found that the transgenic progeny eight vascular bundles in WT Arabidopsis, but there were
seedings exhibited a thinner but harder stem phenotype only 5 or 6 vascular bundles in 35S: JcmiR172a transgenic
(Fig. 4C–F). A comparison of stems of miR172 transgenic plants (Fig. 5A–C). To further examine xylem-related
Jatropha and WT via cross-sections and longitudinal sections traits, we prepared paraffin cross-sections of basal stems, and
revealed that the thickness of transgenic Jatropha xylem was different vascular bundle attributes, including area and number
0.36–0.75 mm thicker than that of WT in two-month-old of cell rows and lines, were evaluated (Fig. 5D, Supplementary
seedlings (Fig. 4C, E) and 1.5 mm thicker in five-month-old Fig. S5). Both numbers of xylem cell rows and lines were signifi-
seedlings (Fig. 4D). The percentage of xylems of transgenic cantly higher in 35S: JcmiR172a transgenic plants than WT
Jatropha increased by approximately 10% compared to that of plants (Supplementary Fig. S5E, F). Furthermore, we recorded
WT, whereas the percentages of phloem and piths were sig- the ratio of the xylem/stem area calculated as the fraction of
nificantly reduced (Fig. 4C–F). total xylem area with respect to the total stem area ratio. This
parameter reflected the proportion of xylem in the total stem
Overexpression of JcmiR172a enhanced xylem
area. Notably, we observed a significant increase in the xylem
development via regulation of cell size and
ratio among the 35S: JcmiR172a transgenic plants and WT
number in vascular tissues of Arabidopsis and plants (Fig. 5D).
Jatropha The increased xylem may result in an increase of xylem cell
In this study, we first found the miR172 regulates xylem devel- volume. To verify this hypothesis, we analyzed the paraf-
opment. To confirm this function of miR172, we further sur- fin cross-sections with an oil immersion lens. Unexpectedly, a
veyed the stem traits in JcmiR172a transgenic Arabidopsis using comparison of the xylem cell morphologies showed that the
40-day-old T2 seedings. Notably, we also found that the stem xylem cell size in 35S: JcmiR172a plants was smaller than that in

2553
 M. Tang et al. | miR172 regulates both vegetative and reproductive development in the perennial woody plant Jatropha curcas

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

Fig. 4 Leaf and stem phenotypes of 35S: JcmiR172a transgenic Jatropha. (A) The mature leaves of WT and 35S: JcmiR172a transgenic T0 plants
L32 and L47. (B) The mature and young leaves of WT and 35S: JcmiR172a transgenic T1 plants L32 and L47; mature leaves are the eighth leaf from
the shoot apex, young leaves are the third leaf from the shoot apex. (C) Cross sections of the stem of 2-month-old seedlings of WT and transgenic
T1 plants L32 and L47. (D) Longitudinal sections of the stem of 4-month-old seedlings of WT and transgenic T1 plants L32 and L47, bar = 1 cm.
(E) The thickness of phloem and xylem was determined with paraffin sections using toluidine blue O, bar = 0.5 mm. (F) Analysis of stem diameter
and percentages of phloem, xylem and pith. The areas of phloem, xylem and pith were calculated according to each diameter. Values are the
mean ± standard deviation. *Statistically different from the control at the 5% level. **Statistically different from the control at the 1% level; error
bars indicate standard deviations for 50 seedlings.

Table 2 Characteristics of mature leaves and flowering time of JcmiR172a transgenic plants
Sample N Petiole length (cm) Leaf length (cm) Leaf width (cm) Flower bud formation
time/Day
T0 WT 24 17.67. ± 1.65c 15.00 ± 1.05c 16.07 ± 1.71b -
L32 19 12.72 ± 1.13b 12.07 ± 1.07b 11.13 ± 1.00a -
L47 21 10.96 ± 1.42a 10.93 ± 0.92a 10.47 ± 0.99a -
T1 WT 15 6.95 ± 1.58c 10.42 ± 0.95c 11.53 ± 0.81c 324.56 ± 53.61B
L32 15 5.47 ± 0.74b 8.17 ± 0.85b 8.97 ± 0.91b 139.47 ± 15.42A
L47 15 4.48 ± 0.43a 6.49 ± 0.73a 7.15 ± 0.51a 120.13 ± 13.24A
Leaves of WT plants and two independent JcmiR172a-overexpressing lines (L32 and L47) grown in the field were subjected to an analysis of leaf size. N = sample
number. The petiole length, leaf length, leaf width, and flower bud formation time are presented as the mean ± standard deviation. Values with different lowercase
letters are significantly different at P < 0.05 by Tukey’s test. Values with different capital letters are significantly different at P < 0.01 by Tukey’s test.

WT plants (Fig. 6). However, the xylem cell density was higher We further analyzed the lignification-related genes in 35S:
than that in WT. Analysis of the microphotographs showed JcmiR172a transgenic Jatropha via qRT-PCR. Total RNA samples
that in WT plants there were only 150 xylem cells in a were extracted from stems of two-month-old T1 transgenic
200 mm  200 mm zone, but in miR172 overexpression plants, and WT seedings. The results showed that the expression
there were 220–230 xylem cells in a 200 mm  200 mm zone levels of the lignin biosynthesis genes Cinnamyl alcohol de-
(Fig. 6D–F). In transgenic Arabidopsis, the xylem cell size was hydrogenase 6 (CAD6) and caffeoyl CoA O-methyltransferase
also smaller than that in WT (Fig. 5E–G), and the smallest cell (CCoAOMT) were strongly up-regulated (Fig. 7A, B), and the
size was observed in plant line 2, which had the highest miR172 cellulose synthase A (CesA) genes JcCesA1, JcCesA3, JcCesA4,
expression level (Supplementary Fig. S2A). These results were JcCesA7, and JcCesA8 were also substantially up-regulated
consistent with the findings in transgenic Jatropha. The (Fig. 7C, F, H–J). However, the expression levels of JcCesA2,
changes in xylem traits were mostly explained by an increased JcCesA2-L, and JcCesA3-L showed no significant increases
number of xylem cell rows, which caused increased total xylem (Fig. 7D, E, G). These results indicated that JcmiR172 acceler-
thickness and ratio (Figs. 5, 6, Supplementary Fig. S5). ates transgenic Jatropha xylem development by indirectly

2554
 Plant Cell Physiol. 59(12): 2549–2563 (2018) doi:10.1093/pcp/pcy175

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

Fig. 5 Comparison of stem characteristics between transgenic Arabidopsis and WT. (A-C) Cross-section of the first internode of the main stem,
which was stained by toluidine blue O, bar = 500 mm. (D) Analysis of the xylem/stem area ratio (N = 15), **indicates P < 0.01. (E–G) Comparison
of phloem, xylem, and pith cell morphologies; xylem cells were stained light blue, bar = 200 mm.

Fig. 6 Comparison of the xylem cell morphology and density between WT and 35S: JcmiR172a transgenic Jatropha. (A–C) Paraffin sections of
WT (A), 35S: JcmiR172a L32 (B) and L47 (C), 200 mm  200 mm zones are marked by red squares. (D–F) Magnifying marked zone of (A–C)
respectively, the number of cells in this zone were counted; bar = 100 mm.

2555
 M. Tang et al. | miR172 regulates both vegetative and reproductive development in the perennial woody plant Jatropha curcas

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

Fig. 7 qPCR analysis of lignification-related genes in the transgenic Jatropha overexpressing miR172. The expression levels of the lignin biosyn-
thesis genes Cinnamyl alcohol dehydrogenase 6 (JcCAD6) and caffeoyl CoA O-methyltransferase (JcCCoAOMT) and cellulose synthase A (JcCesA)
genes. RNA samples were extracted from 2-month-old T1 seedling shoots; error bars indicate standard deviations for three replicates.

promoting the expression of lignin biosynthesis and cellulose that the transcript levels of the miR172 target genes JcAP2,
synthase genes. JcTOE1, and JcTOE2 were down-regulated (Supplementary Fig.
S4B–D), and the transcript levels of JcFT, JcLFY, and JcAP1 were
Overexpression of JcmiR172a in Jatropha caused slightly altered in the transgenic seedlings (Supplementary Fig.
early flowering and abnormal development of S4F–H). However, the expression levels of JcSOC1 and JcSEP2
reproductive organs were increased more than 10-fold (Supplementary Fig. S4I, M).
Transgenic analysis performed in Arabidopsis suggested that These results indicated that miR172 is involved in floral meri-
miR172 might act as a flowering accelerator in Jatropha. To stem determination in Jatropha.
test this hypothesis, we generated transgenic Jatropha with Comparing the flowers, we found that the floral organ patterns
the 35S: JcmiR172a construct as previously described. Non- were obviously different (Fig. 8A, B). We dissected the flowers and
transgenic/WT plants were used as control. Fifty independent found that the flower organs were partially absent in transgenic
transgenic lines were confirmed via PCR. To our surprise, all plants; in the first and second whorls, there were 2–4 sepals and 2–
the transgenic Jatropha lines lacked the early-flowering pheno- 3 petals. In addition, 2–3 nectaries were observed. In WT flowers,
type in a tropical area (Xishuangbanna). When regenerated there were five sepals, petals and nectaries (Fig. 8A–F; Table 3). In
plantlets (Supplementary Fig. S6) were grown in the field for male flowers, 5–6 stamens were observed, while WT flowers had 10
5 months, flower buds emerged in both transgenic and control stamens (Fig. 8G, H; Table 3), and similar to transgenic Arabidopsis
plants (Supplementary Fig. S6D–G). In contrast, two (L8 and (Fig. 3G), there were two stamens fused to the petals (Fig. 8F). The
L21) of the 15 transgenic lines of the 35S: JcmiR172a-overex- carpels were present, but the ovules are partially absent in female
pressing Jatropha grown in a subtropical area (Kunming) pro- flowers (Fig. 8I, J; Table 3). The expression profiles showed that the
duced flowers in the second year (Supplementary Fig. S7B–C, transcript levels of floral organ identity genes, including JcAP2,
E–F). The transgenic plants produced flowers only once and JcAP3, JcAG, JcSEP1, and JcSEP3 (Supplementary Fig. S4B and J–L,
only in spring every year, while the WT plants did not produce N), were down-regulated in transgenic flowers. Because the abun-
flowers until 5 years after they were planted in the same con- dance of miR172 in wild-type plants is low in young seedlings and
ditions (Supplementary Fig. S7A, D). We further analyzed the T1 high in inflorescences, the increase in miR172 abundance in the 35S:
seedling phenotypes and several floral identity-related genes in JcmiR172a lines was more evident in young seedlings than in in-
a greenhouse in a tropical area. We found that the T1 trans- florescences. In addition, in 35S: JcmiR172a transgenic plants, the
genic plants generated flower buds at least 5 to 6 months earlier miR172 levels were not significantly different at different ages
than the WT plants (Table 2). The expression results showed (Supplementary Fig. S4A).

2556
 Plant Cell Physiol. 59(12): 2549–2563 (2018) doi:10.1093/pcp/pcy175

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

Fig. 8 Changes in the floral organ number in JcmiR172a transgenic Jatropha. (A, B) Female (A) and male (B) flowers of WT and 35S: JcmiR172a
transgenic Jatropha. (C, D) Female flower anatomy of WT (C) and 35S: JcmiR172a transgenic plants (D). (E, F) Male flower anatomy of WT (E) and
35S: JcmiR172a transgenic plants (F); a stamen fused to petal is shown by a red arrow. (G, H) Stamen of WT (G) and 35S: JcmiR172a transgenic
(H) male flowers. (I, J) Cross-Sections of WT (I) and 35S: JcmiR172a transgenic (J) pistils; ovules are indicated by pink arrows; bar = 1 mm.

Table 3 Number of floral organs in JcmiR172a transgenic plants

Sample N sepals petals nectaries stamens carpels ovules
WT male 25 5.00 ± 0.00a 5.00 ± 0.00a 5.00 ± 0.00a 9.92 ± 0.28a – –
a a a
WT female 25 5.00 ± 0.00 5.00 ± 0.00 5.00 ± 0.00 – 1.00 ± 0.00 3.00 ± 0.00a
b b b b
L32 male 18 4.33 ± 0.59 3.28 ± 0.46 3.72 ± 0.46 6.28 ± 0.46 – –
L32 female 15 4.00 ± 0.53bc 3.13 ± 0.64bc 3.40 ± 0.51bc – 1.00 ± 0.00 2.80 ± 0.41b
L47 male 33 3.21 ± 0.65d 2.88 ± 0.60cd 3.42 ± 0.56bc 5.15 ± 0.57b – –
cd d c
L47 female 25 3.64 ± 0.70 2.72 ± 0.46 3.24 ± 0.51 – 1.00 ± 0.00 2.84 ± 0.47b
The male and female flowers of WT plants and two independent JcmiR172a-overexpressing lines (L32 and L47) were subjected to the analysis of flower organ numbers.
N = flower number. The flower organ numbers are presented as the mean ± standard deviation. Values with different letters are significantly different (P < 0.05,
Tukey’s test).

The results obtained from the transgenic Jatropha indicate bigger, but the weight and oil contents of these seeds were
that miR172 is important in regulating flower organ develop- decreased compared to those of WT seeds (Fig. 9E, F,
ment and sustaining normal patterns through regulation of the Table 4). The changes in size, number, weight, and oil contents
expression of floral organ identity genes. of seeds in JcmiR172a-overexpressing transgenic plants suggest
Jatropha plants overexpressing JcmiR172a showed signifi- that miR172 may be involved in seed development.
cant floral organ defects, altered fruit shape, and reduced
seed yield compared to WT plants. In transgenic plants, the
length of the fruits was longer than that of WT plants, Discussion
the width of the fruits was narrower than that of WT, and
the ratio of length to width (L/W) was increased (Fig. 9A, B).
Functional conservation and divergence of
Further analysis of the transgenic fruits showed that some seeds miR172 in Arabidopsis and Jatropha
in the fruits were aborted (Fig. 9C). One or two abortive seeds There are five pri-miR172s in both Arabidopsis and Jatropha.
were observed in each fruit; on average, the normal seed The sequences of the mature JcmiR172a-d and JcmiR172e,
number in each fruit was 1.31.6 (Fig. 9D), but in WT, the which have been isolated in Jatropha seeds (Galli et al. 2014),
seed number of each fruit was three, indicating a significant differ only in their 50 and 30 end bases (Supplementary Fig. S1A).
reduction in transgenic fruits. We compared the transgenic JcmiR172e, which is different from that of Arabidopsis miR172,
seeds to WT seeds and found that the transgenic seeds were shows higher similarity to that of some woody plants, such as

2557
 M. Tang et al. | miR172 regulates both vegetative and reproductive development in the perennial woody plant Jatropha curcas

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

Fig. 9 Fruit and seed phenotypes of 35S: JcmiR172a transgenic Jatropha. (A) Mature fruits of WT and 35S: JcmiR172a transgenic Jatropha.
(B) Analysis of the fruit size of WT and 35S: JcmiR172a transgenic Jatropha; error bars indicate standard deviations for 30 fruits. (C) Some seeds
were aborted in 35S: JcmiR172a transgenic Jatropha; aborted seeds are shown by red arrows. (D) Analysis of seed numbers in each fruit; error bars
indicate standard deviations for 30 seeds; (E) Mature seeds of WT and 35S: JcmiR172a transgenic Jatropha. (F) Comparison of the oil contents in
WT and 35S: JcmiR172a transgenic seeds. Values are the mean ± standard deviation; *statistically different from the control at the 5% level;
**statistically different from the control at the 1% level; error bars indicate standard deviations for 50 seedlings; bar = 1 cm.

Table 4 Seed characteristics of JcmiR172a transgenic Jatropha

Sample N Length (mm) Width (mm) Height (mm) Weight/seed (g)
WT 30 18.36 ± 0.48 10.85 ± 0.34 8.55 ± 0.23 0.72 ± 0.04
L32 30 19.36 ± 0.45* 11.50 ± 0.48* 9.28 ± 0.59* 0.70 ± 0.05
L47 30 19.23 ± 0.50* 11.42 ± 0.53* 9.59 ± 0.72* 0.68 ± 0.04*
Values are the mean ± standard deviation (N = 30 seeds).
*Statistically different from the control at the 5% level.
**Statistically different from the control at the 1% level.

apple (Malus  domestica), P. trichocarpa, Vitis vinifera, R. com- showed an increase in xylem thickness (Fig. 4C–F); further-
munis, and Citrus sinensis (http://www.mirbase.org/). more, transgenic Jatropha exhibited early flowering in a sub-
According to the alignment of nucleotide sequences, we tropical area (Supplementary Fig. S7). These results indicate
found JcmiR172e showed higher matching scores with tar- miR172 is an age marker gene in Jatropha, which is similar to
get genes than that of JcmiR172a-d (Fig.1A, Supplementary its role in other plants (Wang et al. 2011, Zhu and Helliwell
Fig. S1B). And the apple Md-miR172e, a homolog of 2011, Lee et al. 2014). In transgenic Arabidopsis and Jatropha,
JcmiR172e, has been shown to alter flowering time and floral the leaf morphologies were changed, the leaves were smaller,
organ identity when ectopically expressed in Arabidopsis (Zhao and the leaf margins were smoother than those in WT (Fig. 2E,
et al. 2015). F; and Fig. 4A, B). The flower organs were partially defective in
In this study, we showed the results of JcmiR172a overex- transgenic Arabidopsis and Jatropha (Figs. 3, 8). Comparing the
pression in both Arabidopsis and Jatropha. In Arabidopsis, results in these two species, and together with characterization
miR172 overexpression plants showed extremely early flower- of miR172 in other non-model plants (Glazińska et al. 2009, Nair
ing (Fig. 2). This result indicates that miR172 promotes the et al. 2010, Debernardi et al. 2017, Anwar et al. 2018, Shivaraj
transition from the vegetative phase to the adult phase. In et al. 2018), we concluded that the miR172 has conservative
Jatropha, JcmiR172a expression level continuously increased functions in regulating phase change, controlling leaf morphol-
with age (Fig. 1B), and JcmiR172a overexpression plants ogies, and sustaining normal flower development.

2558
 Plant Cell Physiol. 59(12): 2549–2563 (2018) doi:10.1093/pcp/pcy175

In Arabidopsis three mature miR172s and six target genes, produce flowers continuously and did not produce flowers at
including AP2, SMZ, SNZ, TOE1, TOE2, and TOE3, were identified other seasons. The results indicated that miR172 cannot pro-
(Fornara and Coupland 2009, Mathieu et al. 2009). However, mote flowering independently; it also depends on suitable en-
there are only two mature miR172s in Jatropha (Supplementary vironmental conditions.
Fig. S1) and only four target genes of miR172, including JcAP2, Similar to our findings, overexpression of the rice miR172b in
JcTOE1, JcTOE2, and JcTOE3 (Fig. 1). Different target gene num- rice did not lead to early flowering (Zhu et al. 2009). Recent
bers may lead to divergent functions. studies in Cardamine flexuosa and Arabis alpine demonstrated
In transgenic Arabidopsis, the flower bud appeared that age is necessary but not sufficient to promote flowering
14–15 days earlier than that of WT, and it produced only 3–4 in perennial herbaceous plants, and other factors, such as low
rosette leaves. This phenotype was as strong as that shown by temperature, are also necessary (Bergonzi et al. 2013, Zhou et al.
Aukerman and Sakai (2003) and Lee et al. (2010). However, we 2013). Jatropha is a perennial woody plant. The molecular mech-
did not obtain transgenic Arabidopsis plants that completely anisms controlling flowering in perennial woody plants have not
lacked flower organs, but the absent flower organ phenotypes been studied as extensively as those of herbaceous plants (Albani

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

in transgenic Jatropha plants are much more serious than that and Coupland 2010). In this study, miR172-overexpressing
in transgenic Arabidopsis (Figs. 3 and 8). Thus, because the pri- Arabidopsis showed extremely early flowering, and all floral meri-
miR172a is from Jatropha, the sequence is distinctive from that stem identity genes were up-regulated in 10-day-old seedlings
of Arabidopsis. (Supplementary Fig. S2); miR172-overexpressing Jatropha did not
In Arabidopsis, the role of miR172 in flowering time and floral show extremely early flowering, and only JcSOC1and JcSEP2 were
organ identity gene was characterized (Aukerman and Sakai up-regulated in 2-month-old seedlings (Supplementary Fig. S4).
2003). In Arabidopsis, 35S: miR172a plants showed early flower- The molecular mechanism of flowering control in the woody
ing, and the late-flowering phenotype of 35S: AP2 plants rescued. plant Jatropha is likely very complex; thus, a single floral identity
The flower closely resembles ap2 flowers, which had sepal and factor, such as age, is not sufficient to promote early flowering.
petal identity defects (Chen 2004). In Jatropha 35S: JcmiR172a, Suitable environmental conditions are necessary to regulate
there were flower organ defects exhibited in all flower organs, flowering in Jatropha. Various environmental factors affecting
including the sepals, petals, stamens, pistils, and nectaries (Fig. 8, flowering need to be characterized in Jatropha in future studies.
Table 3). There were bundles of stigmatic papillae projecting
from the sepal margins of miR172-overexpressing Arabidopsis JcmiR172 might be involved in regulation of xylem
(Fig. 3E) (Aukerman and Sakai 2003). However, the stigmatic development
papillae structures were not found in transgene Jatropha. In In perennial woody plants, xylem cell formation is age dependent
Arabidopsis, miR172 is critical for fruit growth, as fruit growth (Rossi et al. 2008). In this study, the miR172 expression profile
was blocked when miR172 activity is compromised (Jose Ripoll indicates that miR172 is an age marker gene. High miR172 ex-
et al. 2015). In this study, we found that high miR172 expression pression is closely correlated with the adult phases of several
level influenced fruit morphogenesis (Fig. 9A, B), seed number, woody species (Wang et al. 2011). In this study, we found ele-
size, morphogenesis, and oil content, and led to seed abortion in vated age markers of Jatropha by constitutive overexpression of
transgenic Jatropha (Fig. 9). JcmiR172a, which accelerated the lignification of the second-
These results indicated that the functions of miR172 are ary xylem by indirectly promoting lignin biosynthesis and the
different between annual herbaceous plants and perennial expression of cellulose synthase genes (Fig. 7). The transgenic
woody plants. A former study reported the divergence of Jatropha stem xylems were thicker than those of WT plants
microRNAs and their functions in Euphorbiaceous plants (Fig. 4C–F), and the xylem cell density was higher in transgenic
during plant growth and in response to abiotic stresses (Zeng Jatropha than in WT (Fig. 6). However, the size of xylem cell was
et al. 2009). smaller than that of WT (Fig. 6), and these results were similar to
those in transgenic Arabidopsis (Fig. 5E and F). The expression
Overexpression of miR172 shortened the juvenile levels of lignin biosynthesis genes and cellulose synthase genes
stage in Jatropha were also strongly up-regulated (Fig. 7C, F, H–J). These results
In contrast to JcmiR172a-overexpressing Arabidopsis, indicated that JcmiR172 accelerates the expansion of transgenic
JcmiR172a-overexpressing Jatropha did not exhibit early flower- Jatropha xylems by promoting lignin biosynthesis and cellulose
ing in the field in a tropical area (Supplementary Fig. S6). Both synthase gene expressing. However, this phenotype was not
the WT and JcmiR172a transgenic plants can produce flowers in found in previous studies examining rice (Zhu et al. 2009, Lee
the first year in the tropical area. However, the JcmiR172a trans- et al. 2014), Arabidopsis (Aukerman and Sakai 2003, Mathieu
genic Jatropha plants produced flowers in the second year et al. 2009), Cardamine flexuosa (Zhou et al. 2013), barley
when they were planted in a subtropical area, whereas the (Houston et al. 2013), soybean (Zhao et al. 2007), and maize
WT plants did not produce flowers (Supplementary Fig. S7). (Lauter et al. 2005).
Under normal conditions, WT Jatropha plants have a juvenile Many genes participating in lignin biosynthesis and second-
stage of at least 3–5 years before producing flowers in subtrop- ary cell wall formation in Acacia hybrids were identified by
ical areas. The transgenic plants showed a shortened juvenile transcriptome sequencing; target genes of three putative
stage and accelerated flowering time, but these plants did not miRNAs, e.g. miR160, miR172, and miR396, were predicted as

2559
 M. Tang et al. | miR172 regulates both vegetative and reproductive development in the perennial woody plant Jatropha curcas

wood-related genes (Wong et al. 2011). However, a functional restriction enzymes KpnI and SalI and then cloned into the pOCA30 vector
containing the CaMV 35S promoter, resulting in the binary vector pMYT34.
analysis of these putative miRNAs with potential roles in wood
Transformation of WT Arabidopsis with Agrobacterium strain EHA105 carrying
formation has not been carried out. In this study, we demon- the pMYT34 (35S: JcmiR172a) was performed using the floral dip method
strated the function of miR172 in regulating wood formation in (Clough and Bent 1998). Transformation of Jatropha with Agrobacterium
Jatropha and Arabidopsis. strain EHA105 carrying the same construct was performed according to the
Several factors, such as the plant hormones gibberellin protocol described by Pan et al. (2010) and Fu et al. (2015). All transgenic plants
(Wang et al. 2017), auxin (Moreno-Piovano et al. 2017), jasmo- were confirmed by genomic PCR and RT-PCR.
nic acid and cytokinin (Jang et al. 2017), and some transcription qRT-PCR analysis
factors, e.g. bHLH complexes (Ohashi-Ito and Fukuda 2016),
Jatropha total RNA was extracted from frozen tissues according to the methods
LAX2 (Moreno-Piovano et al. 2017), VND6, VND7, NST3, and
described by Ding et al. (2008). Arabidopsis total RNA was extracted from
WOX4 (Stein et al. 2016), are involved in these processes. frozen tissues using TRIzol reagent (Transgene, China). First-strand comple-
However, the secondary xylem thickening phenotype was mentary DNA (cDNA) was synthesized from 1 mg of total RNA using the
never reported in miR172-overexpressing plants because the PrimeScriptÕ RT Reagent Kit (TaKaRa, Dalian, China) according to the instruc-

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

previous studies on overexpression of miR172 were performed tion manual and Tang et al. (2016a). The miR172-specific reverse transcription
(RT) primer XA822 was used for miR172. The cDNA templates were diluted
in annual herbaceous plants. The miR172 transgenic Jatropha
5–10 times using sterilized double distilled water for first-strand cDNA accord-
plants referred to in this study can be used in agriculture to ing to Tang et al. (2016b); qRT-PCR experiments were performed using SYBRÕ
improve lodging resistance due to the thickened xylems (Zheng Premix Ex TaqTM II (TaKaRa, Dalian, China) on a Roche LightCycler480 II Real-
et al. 2017). The specific functions of miR172 were also found in Time PCR Detection System (Roche Diagnostics) as previously described Tang
other plants; for example, miR172 is essential for nodulation in et al. (2016b). All primers used for qRT-PCR are listed in Supplementary Table
S1. qRT-PCR was performed as previously described Tang et al. (2016b), pre-
soybean and Lotus japonicus (Yan et al. 2013, Holt et al. 2015).
cisely using three independent biological replicates and three technical repli-
cates for each sample. Data were analyzed using the 2–

CT method (Livak and
Schmittgen 2001). The transcript levels of specific genes were normalized using
Materials and Methods Jatropha curcas actin1(JcActin1) (Zhang et al. 2013) or Arabidopsis actin2 (Soni
and Mondal 2018). For determination of the mature miR172 abundance, qRT-
Plant materials and growth conditions PCR was performed according to Varkonyi-Gasic et al. (2007).
The roots, stems, young and mature leaves, inflorescence buds, female and male
flowers, and fruits in one mature tree of Jatropha were collected as previously Analysis of flower and fruit phenotypes
described Tang et al. (2016b) to compare the expression levels of miR172 in The flower and fruit anatomy was examined and photographed with a light Leica
different tissues. The cotyledons and young leaves from Jatropha plants of DM IRB anatomical lens (Leica, Heerbrugg, Switzerland) equipped with a Leica
various ages were collected to analyse the miR172 expression levels in plants DFC425 C camera. The length and width of Jatropha fruits and the length, width,
of different ages from Kunming, Yunnan province, China. All tissues prepared and thickness of seeds were measured with an electronic vernier caliper (to 0.1 mm).
for qRT-PCR were immediately frozen in liquid nitrogen and stored at 80 C
until use. The Arabidopsis seeds were germinated on 1/2 MS medium over a Analysis of stem components
one-week period, after which seedlings were transferred to peat soil in plant
Two- and five-month-old T1 transgenic Jatropha seedlings grown in a green-
growth chambers at 22 ± 2 C under long-day (LD) (16 h light/8 h dark) condi-
house were harvested to measure the middle stem diameter. Then, the stems
tions. Phenotypic analysis was performed on homozygous (T2) Arabidopsis
were used for paraffin sections (Sakai 1973) to observe the cell morphologies
plants as well as T0 and T1 Jatropha plants. For each Arabidopsis genotype,
and measure and calculate the thickness and area of phloem, xylem, and pith.
more than 20 plants were used for characterisation. The number of rosette
leaves was counted along with the number of days between transfer to soil and
when the first flower bud was visible. Ten-day-old Arabidopsis seedlings and
inflorescences from 40-day-old plants were harvested to analyse mRNA tran- Supplementary Data
scription levels. The shoot apexes of two-month-old T1 transgenic Jatropha and
flower buds of two-year-old T0 transgenic Jatropha were harvested to analyse Supplementary data are available at PCP online.
mRNA transcription levels.

Cloning of JcmiR172a precursor Funding

Total RNA was extracted from the young leaves of Jatropha using the protocol
described by Ding et al. (2008). First-strand cDNA was synthesized using This work was supported by funding from the Natural Science
M-MLV-reverse transcriptase according to the manufacturer’s instructions Foundation of China (31700273, 31670612, and 31771605), the
(TaKaRa, Dalian, China). The full-length JcmiR172a precursor cDNA Young Elite Scientists Sponsorship Program by CSTC (CSTC-
(GenBank accession number XR_002283652) (Sato et al. 2011) (http://www.
QN201701), and the Program of Chinese Academy of Sciences
kazusa.or.jp/jatropha/) was amplified by PCR using the primers XA401 and
XA402 (all primers used in this study are listed in Supplementary Table S1), (kfj-brsn-2018–6-008, 2017XTBG-T02).
which had KpnI and SalI recognition sites, respectively. The PCR product
(422 bp) was subsequently cloned into the pGEM-T vector (Promega
Corporation, Madison, WI, USA). The resultant plasmid pTMY004 was used Acknowledgments
as a template for sequencing.
We thank Dongyun Bao, Congcong Gao, Qingfeng Zhang,
Construction of the overexpression binary vector Xiulan Wang, Zhiyu Pu, and Yang Ai for helping to transplant
and plant transformation the transgenic Jatropha plantlets. The authors gratefully ac-
For construction of the plant overexpression binary vector 35S: JcmiR172a, the knowledge the Central Laboratory of the Xishuangbanna
JcmiR172a precursor cDNA (422 bp) was excised from pTMY004 using the Tropical Botanical Garden for providing the research facilities.

2560
 Plant Cell Physiol. 59(12): 2549–2563 (2018) doi:10.1093/pcp/pcy175

Divakara, B., Upadhyaya, H., Wani, S. and Gowda, C. (2010) Biology and
Author contributions
genetic improvement of Jatropha curcas L.: a review. Appl. Energy 87:
Mingyong Tang designed and performed the experiments, ana- 732–742.
lyzed the data, and wrote the paper. Xue Bai, analyzed data and Fornara, F. and Coupland, G. (2009) Plant phase transitions make a SPLash.
Cell 138: 625–627.
revised the paper. Long-Jian Niu, Xia Chai, and Mao-Sheng Chen
Fouracre, J.P. and Poethig, R.S. (2016) The role of small RNAs in vegetative
helped to collect data. Zeng-Fu Xu conceived the study and shoot development. Curr. Opin. Plant Biol. 29: 64–72.
revised the paper. Fu, Q., Li, C., Tang, M., Tao, Y.-B., Pan, B.-Z., Zhang, L., et al. (2015) An
efficient protocol for Agrobacterium-mediated transformation of the
biofuel plant Jatropha curcas by optimizing kanamycin concentration
References and duration of delayed selection. Plant Biotechnol. Rep. 9: 405–416.
Galli, V., Guzman, F., de Oliveira, L.F., Loss-Morais, G., Korbes, A.P., Silva,
Akashi, K. (2012) Jatropha research: a new frontier for biofuel develop- S.D., et al. (2014) Identifying microRNAs and transcript targets in
ment. Plant Biotechnol. 29: 121. Jatropha seeds. PLoS One 9: e83727.
Albani, M.C. and Coupland, G. (2010) Comparative analysis of flowering in Gasser, C. (2015) Fruit development: miRNA pumps up the volume. Nat.

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

annual and perennial plants. In Current Topics in Developmental Plants 1: 15037.
Biology Vol. 91, Edited by Timmermans, M.C.P. pp. 323–348. Ghosh, A., Chikara, J., Chaudhary, D.R., Prakash, A., Boricha, G. and Zala, A.
Academic Press, San Diego, California, USA. (2010) Paclobutrazol arrests vegetative growth and unveils unexpressed
Anwar, N., Ohta, M., Yazawa, T., Sato, Y., Li, C. and Tagiri, A. (2018) miR172 yield potential of Jatropha curcas. J. Plant Growth Regul. 29: 307–315.
downregulates the translation of cleistogamy 1 in barley. Ann. Bot. Glazińska, P., Zienkiewicz, A., Wojciechowski, W. and Kopcewicz, J. (2009) The
doi:10.1093/aob/mcy1058. putative miR172 target gene In APETALA2-like is involved in the photo-
Aukerman, M.J. and Sakai, H. (2003) Regulation of flowering time and floral periodic flower induction of Ipomoea nil. J. Plant Physiol. 166: 1801–1813.
organ identity by a microRNA and its APETALA2-like target genes. Plant Gu, K., Tian, D., Mao, H., Wu, L. and Yin, Z. (2015) Development of marker-
Cell 15: 2730–2741. free transgenic Jatropha curcas producing curcin-deficient seeds
Bagga, S., Bracht, J., Hunter, S., Massirer, K., Holtz, J., Eachus, R., et al. (2005) through endosperm-specific RNAi-mediated gene silencing. BMC
Regulation by let-7 and lin-4 miRNAs results in target mRNA degrad- Plant Biol. 15: 242–251.
ation. Cell 122: 553–563. Han, Y.Y., Zhang, X., Wang, Y.F. and Ming, F. (2013) The suppression of
Bergonzi, S., Albani, M.C., Loren van Themaat, E.V., Nordstrom, K.J.V., WRKY44 by GIGANTEA-miR172 pathway is involved in drought re-
Wang, R., Schneeberger, K., et al. (2013) Mechanisms of age-dependent sponse of Arabidopsis thaliana. PLoS One 8: e73541.
response to winter temperature in perennial flowering of Arabis alpina. Hirakawa, H., Tsuchimoto, S., Sakai, H., Nakayama, S., Fujishiro, T., Kishida,
Science 340: 1094–1097. Y., et al. (2012) Upgraded genomic information of Jatropha curcas L.
Carrington, J.C. and Ambros, V. (2003) Role of microRNAs in plant and Plant Biotechnol. 29: 123–130.
animal development. Science 301: 336–338. Holt, D.B., Gupta, V., Meyer, D., Abel, N.B., Andersen, S.U., Stougaard, J.,
Chen, X. (2004) A microRNA as a translational repressor of APETALA2 in et al. (2015) Micro RNA 172 (miR172) signals epidermal infection and is
Arabidopsis flower development. Science 303: 2022–2025. expressed in cells primed for bacterial invasion in Lotus japonicus roots
Cho, H.J., Kim, J.J., Lee, J.H., Kim, W., Jung, J.-H., Park, C.-M., et al. (2012) and nodules. New Phytol. 208: 241–256.
SHORT VEGETATIVE PHASE (SVP) protein negatively regulates miR172 Houston, K., McKim, S.M., Comadran, J., Bonar, N., Druka, I., Uzrek, N., et al.
transcription via direct binding to the pri-miR172a promoter in (2013) Variation in the interaction between alleles of HvAPETALA2 and
Arabidopsis. FEBS Lett. 586: 2332–2337. microRNA172 determines the density of grains on the barley inflores-
Chuck, G., Cigan, A.M., Saeteurn, K. and Hake, S. (2007a) The heterochro- cence. Proc. Natl. Acad. Sci. USA 110: 16675–16680.
nic maize mutant Corngrass1 results from overexpression of a tandem Inui, M., Martello, G. and Piccolo, S. (2010) MicroRNA control of signal
microRNA. Nat. Genet. 39: 544–549. transduction. Nat. Rev. Mol. Cell Biol. 11: 252–263.
Chuck, G., Meeley, R., Irish, E., Sakai, H. and Hake, S. (2007b) The maize Jang, G., Chang, S.H., Um, T.Y., Lee, S., Kim, J.K. and Choi, Y.D. (2017)
tasselseed4 microRNA controls sex determination and meristem cell fate Antagonistic interaction between jasmonic acid and cytokinin in
by targeting Tasselseed6/indeterminate spikelet1. Nat. Genet. 39: 1517–1521. xylem development. Sci. Rep. 7: 10212.
Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method for Jose Ripoll, J., Bailey, L.J., Mai, Q.A., Wu, S.L., Hon, C.T., Chapman, E.J., et al.
Agrobacterium-mediated transformation of Arabidopsis thaliana. (2015) MicroRNA regulation of fruit growth. Nat. Plants 1: 15036.
Plant J. 16: 735–743. Jung, J.-H., Seo, P.J., Kang, S.K. and Park, C.-M. (2011) miR172 signals are
D’Ario, M., Griffiths-Jones, S. and Kim, M. (2017) Small RNAs: big impact incorporated into the miR156 signaling pathway at the SPL3/4/5 genes
on plant development. Trends Plant Sci. 22: 1056–1068. in Arabidopsis developmental transitions. Plant Mol. Biol. 76: 35–45.
Debernardi, J.M., Lin, H.Q., Chuck, G., Faris, J.D. and Dubcovsky, J. (2017) Jung, J.H., Seo, Y.H., Seo, P.J., Reyes, J.L., Yun, J., Chua, N.H., et al. (2007) The
microRNA172 plays a crucial role in wheat spike morphogenesis and GIGANTEA-regulated microRNA172 mediates photoperiodic flowering
grain threshability. Development 144: 1966–1975. independent of CONSTANS in Arabidopsis. Plant Cell 19: 2736–2748.
Dhillon, R., Hooda, M., Jattan, M., Chawla, V., Bhardwaj, M. and Goyal, S. Kajikawa, M., Morikawa, K., Inoue, M., Widyastuti, U., Suharsono, S.,
(2009) Development and molecular characterization of interspecific Yokota, A., et al. (2012) Establishment of bispyribac selection protocols
hybrids of Jatropha curcas  J. integerrima. Indian J. Biotechnol. 8: for Agrobacterium tumefaciens-and Agrobacterium rhizogenes-mediated
384–390. transformation of the oil seed plant Jatropha curcas L. Plant Biotechnol.
Diaz-Manzano, F.E., Cabrera, J., Ripoll, J.J., Del Olmo, I., Andres, M.F., Silva, 29: 145–153.
A.C., et al. (2018) A role for the gene regulatory module microRNA172/ Khalil, H.P.S.A., Aprilia, N.A.S., Bhat, A.H., Jawaid, M., Paridah, M.T. and
TARGET OF EARLY ACTIVATION TAGGED 1/FLOWERING LOCUS T Rudi, D. (2013) A Jatropha biomass as renewable materials for biocom-
(miRNA172/TOE1/FT) in the feeding sites induced by Meloidogyne java- posites and its applications. Renew. Sustain. Energy Rev. 22: 667–685.
nica in Arabidopsis thaliana. New Phytol. 217: 813–827. King, A.J., Montes, L.R., Clarke, J.G., Itzep, J., Perez, C.A., Jongschaap, R.E.,
Ding, L.-W., Sun, Q.-Y., Wang, Z.-Y., Sun, Y.-B. and Xu, Z.-F. (2008) Using et al. (2015) Identification of QTL markers contributing to plant growth,
silica particles to isolate total RNA from plant tissues recalcitrant to oil yield and fatty acid composition in the oilseed crop Jatropha curcas
extraction in guanidine thiocyanate. Anal. Biochem. 374: 426–428. L. Biotechnol. Biofuels 8: 17.

2561
 M. Tang et al. | miR172 regulates both vegetative and reproductive development in the perennial woody plant Jatropha curcas

Kumar, N., Anand, K.G.V., Pamidimarri, D.V.N.S., Sarkar, T., Reddy, M.P., Pan, B.-Z. and Xu, Z.-F. (2011) Benzyladenine treatment significantly in-
Radhakrishnan, T., et al. (2010) Stable genetic transformation of creases the seed yield of the biofuel plant Jatropha curcas. J. Plant
Jatropha curcas via Agrobacterium tumefaciens-mediated gene transfer Growth Regul. 30: 166–174.
using leaf explants. Ind. Crops Prod. 32: 41–47. Pandey, V.C., Singh, K., Singh, J.S., Kumar, A., Singh, B. and Singh, R.P. (2012)
Kunst, L., Klenz, J.E., Martinez-Zapater, J. and Haughn, G.W. (1989) AP2 Jatropha curcas: a potential biofuel plant for sustainable environmental
gene determines the identity of perianth organs in flowers of development. Renew. Sustain. Energy Rev. 16: 2870–2883.
Arabidopsis thaliana. Plant Cell 1: 1195–1208. Pasquinelli, A.E. and Ruvkun, G. (2002) Control of developmental timing
Lauter, N., Kampani, A., Carlson, S., Goebel, M. and Moose, S.P. (2005) by microRNAs and their targets. Annu. Rev. Cell Dev. Biol. 18: 495–513.
microRNA172 down-regulates glossy15 to promote vegetative phase Pramanik, K. (2003) Properties and use of Jatropha curcas oil and diesel
change in maize. Proc. Natl. Acad. Sci. USA 102: 9412–9417. fuel blends in compression ignition engine. Renew. Energy 28: 239–248.
Lee, D.Y. and An, G. (2012) Two AP2 family genes, SUPERNUMERARY Pua, F-L., Fang, Z., Zakaria, S., Guo, F. and Chia, C-h. (2011) Direct produc-
BRACT (SNB) and OsINDETERMINATE SPIKELET 1 (OsIDS1), synergistic- tion of biodiesel from high-acid value Jatropha oil with solid acid cata-
ally control inflorescence architecture and floral meristem establish- lyst derived from lignin. Biotechnol. Biofuels 4: 56.
ment in rice. Plant J. 69: 445–461. Rossi, S., Deslauriers, A., Anfodillo, T. and Carrer, M. (2008) Age-dependent
Lee, Y.-S., Lee, D.-Y., Cho, L.-H. and An, G. (2014) Rice miR172 induces xylogenesis in timberline conifers. New Phytol. 177: 199–208.

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

flowering by suppressing OsIDS1 and SNB, two AP2 genes that nega- Sakai, W.S. (1973) Simple method for differential staining of paraffin
tively regulate expression of Ehd1 and florigens. Rice 7: 1–13. embedded plant material using toluidine blue O. Stain Technol. 48:
Lee, H., Yoo, S.J., Lee, J.H., Kim, W., Yoo, S.K., Fitzgerald, H., et al. (2010) 247–249.
Genetic framework for flowering-time regulation by ambient tempera- Sánchez-Gutiérrez, A., Ovando-Medina, I., Adriano-Anaya, L., Vázquez-
ture-responsive miRNAs in Arabidopsis. Nucleic Acids Res. 38: 3081– Ovando, A. and Salvador-Figueroa, M. (2018) Dynamics of miR156
3093. and miR172 involved in the flowering of Jatropha curcas L. Acta Bot.
Lee, J.H., Yoo, S.J., Park, S.H., Hwang, I., Lee, J.S. and Ahn, J.H. (2007) Role of Bras. 32: 99–106.
SVP in the control of flowering time by ambient temperature in Sato, S., Hirakawa, H., Isobe, S., Fukai, E., Watanabe, A., Kato, M., et al.
Arabidopsis. Genes Dev. 21: 397–402. (2011) Sequence analysis of the genome of an oil-bearing tree, Jatropha
Liu, P., Liu, J., Dong, H. and Sun, J. (2018) Functional regulation of Q by curcas L. DNA Res. 18: 65–76.
microRNA172 and transcriptional co-repressor TOPLESS in controlling Shivaraj, S.M., Jain, A. and Singh, A. (2018) Highly preserved roles of
bread wheat spikelet density. Plant Biotechnol. J. 16: 495–506. Brassica MIR172 in polyploid Brassicas: ectopic expression of variants
Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression of Brassica MIR172 accelerates floral transition. Mol. Genet. Genomics.
data using real-time quantitative PCR and the 2

CT method. Methods doi:10.1007/s00438-00018-01444-00433.
25: 402–408. Sinha, P., Islam, M.A., Negi, M.S. and Tripathi, S.B. (2015) Changes in oil
Luan, Y., Cui, J., Li, J., Jiang, N., Liu, P. and Meng, J. (2018) Effective enhance- content and fatty acid composition in Jatropha curcas during seed
ment of resistance to Phytophthora infestans by overexpression of development. Ind. Crops Prod. 77: 508–510.
miR172a and b in Solanum lycopersicum. Planta 247: 127–138. Song, J., Chen, M.-S., Li, J.-L., Niu, L.-J. and Xu, Z.-F. (2013) Effects of soil-
Martin, A., Adam, H., Diaz-Mendoza, M., Zurczak, M., Gonzalez-Schain, applied paclobutrazol on the vegetative and reproductive growth of
N.D. and Suarez-Lopez, P. (2009) Graft-transmissible induction of biofuel plant Jatropha curcas. Plant Divers. Resour. 35: 173–179.
potato tuberization by the microRNA miR172. Development 136: Soni, M. and Mondal, K.K. (2018) Xanthomonas axonopodis pv. punicae
2873–2881. uses XopL effector to suppress pomegranate immunity. J. Integr. Plant
Mathieu, J., Yant, L.J., Murdter, F., Kuttner, F. and Schmid, M. (2009) Biol. 60: 341–357.
Repression of flowering by the miR172 target SMZ. PLoS Biol. 7: e1000148. Stein, O., Damari-Weissler, H., Secchi, F., Rachamilevitch, S., German, M.A.,
Misra, P., Toppo, D.D., Mishra, M.K., Saema, S. and Singh, G. (2012) Yeselson, Y., et al. (2016) The tomato plastidic fructokinase SlFRK3 plays
Agrobacterium tumefaciens-mediated transformation protocol of a role in xylem development. New Phytol. 209: 1484–1495.
Jatropha curcas L. using leaf and hypocotyl segments. J. Plant Tang, J. and Chu, C. (2017) MicroRNAs in crop improvement: fine-tuners
Biochem. Biotechnol. 21: 128–133. for complex traits. Nat. Plants 3: 17077.
Mofijur, M., Rasul, M., Hyde, J., Azad, A., Mamat, R. and Bhuiya, M. (2016) Tang, M., Tao, Y.B., Fu, Q., Song, Y., Niu, L. and Xu, Z.F. (2016b) An ortholog
Role of biofuel and their binary (diesel–biodiesel) and ternary (ethanol– of LEAFY in Jatropha curcas regulates flowering time and floral organ
biodiesel–diesel) blends on internal combustion engines emission re- development. Sci. Rep. 6: 37306.
duction. Renew. Sustain. Energy Rev. 53: 265–278. Tang, M., Tao, Y.-B. and Xu, Z.-F. (2016a) Ectopic expression of Jatropha
Moreno-Piovano, G.S., Moreno, J.E., Cabello, J.V., Arce, A.L., Otegui, M.E. curcas APETALA1 (JcAP1) caused early flowering in Arabidopsis, but
and Chan, R.L. (2017) A role for LAX2 in regulating xylem development not in Jatropha. PeerJ 4: e1969.
and lateral-vein symmetry in the leaf. Ann. Bot. 120: 577–590. Tjeuw, J., Slingerland, M. and Giller, K. (2015) Relationships among
Moss, E.G. (2007) Heterochronic genes and the nature of developmental Jatropha curcas seed yield and vegetative plant components under
time. Curr. Biol. 17: R425–R434. different management and cropping systems in Indonesia. Biomass
Nair, S.K., Wang, N., Turuspekov, Y., Pourkheirandish, M., Sinsuwongwat, S., Bioenergy 80: 128–139.
Chen, G., et al. (2010) Cleistogamous flowering in barley arises from the Varkonyi-Gasic, E., Wu, R., Wood, M., Walton, E.F. and Hellens, R.P. (2007)
suppression of microRNA-guided HvAP2 mRNA cleavage. Proc. Natl. Protocol: a highly sensitive RT-PCR method for detection and quanti-
Acad. Sci. USA 107: 490–495. fication of microRNAs. Plant Methods 3: 12.
Ohashi-Ito, K. and Fukuda, H. (2016) Functional mechanism of bHLH Wang, J.-W., Czech, B. and Weigel, D. (2009) miR156-regulated SPL tran-
complexes during early vascular development. Curr. Opin. Plant Biol. scription factors define an endogenous flowering pathway in
33: 42–47. Arabidopsis thaliana. Cell 138: 738–749.
Ong, H., Mahlia, T., Masjuki, H. and Norhasyima, R. (2011) Comparison of Wang, C.M., Liu, P., Sun, F., Li, L., Liu, P., Ye, J., et al. (2012) Isolation
palm oil, Jatropha curcas and Calophyllum inophyllum for biodiesel: a and Identification of miRNAs in Jatropha curcas. Int. J. Biol. Sci. 8:
review. Renew. Sustain. Energy Rev. 15: 3501–3515. 418–429.
Pan, J., Fu, Q. and Xu, Z.-F. (2010) Agrobacterium tumefaciens-mediated Wang, J.-W., Park, M.Y., Wang, L.-J., Koo, Y., Chen, X.-Y., Weigel, D., et al.
transformation of biofuel plant Jatropha curcas using kanamycin selec- (2011) miRNA control of vegetative phase change in trees. PLoS Genet.
tion. Afr. J. Agric. Res. 9: 6477–6481. 7: e1002012.

2562
 Plant Cell Physiol. 59(12): 2549–2563 (2018) doi:10.1093/pcp/pcy175

Wang, G.-L., Que, F., Xu, Z.-S., Wang, F. and Xiong, A.-S. (2017) Exogenous Yant, L., Mathieu, J., Dinh, T.T., Ott, F., Lanz, C., Wollmann, H., et al. (2010)
gibberellin enhances secondary xylem development and lignification in Orchestration of the floral transition and floral development in
carrot taproot. Protoplasma 254: 839–848. Arabidopsis by the bifunctional transcription factor APETALA2. Plant
Wang, J.-W., Schwab, R., Czech, B., Mica, E. and Weigel, D. (2008) Dual effects Cell 22: 2156–2170.
of miR156-targeted SPL genes and CYP78A5/KLUH on plastochron length Yu, S., Lian, H. and Wang, J.-W. (2015) Plant developmental transitions: the
and organ size in Arabidopsis thaliana. Plant Cell 20: 1231–1243. role of microRNAs and sugars. Curr. Opin. Plant Biol. 27: 1–7.
Wong, M.M., Cannon, C.H. and Wickneswari, R. (2011) Identification of Zeng, C., Wang, W., Zheng, Y., Chen, X., Bo, W., Song, S., et al. (2009)
lignin genes and regulatory sequences involved in secondary cell wall Conservation and divergence of microRNAs and their functions in
formation in Acacia auriculiformis and Acacia mangium via de novo Euphorbiaceous plants. Nucleic Acids Res. 38: 981–995.
transcriptome sequencing. BMC Genomics 12: 342. Zhang, L., He, L.-L., Fu, Q.-T. and Xu, Z.-F. (2013) Selection of reliable
Wu, J., Liu, Y., Tang, L., Zhang, F. and Chen, F. (2011) A study on structural reference genes for gene expression studies in the biofuel plant
features in early flower development of Jatropha curcas L. and the Jatropha curcas using real-time quantitative PCR. Int. J. Mol. Sci. 14:
classification of its inflorescences. Afr. J. Agric. Res. 6: 275–284. 24338–24354.
Wu, G., Park, M.Y., Conway, S.R., Wang, J.-W., Weigel, D. and Poethig, R.S. Zhao, L., Kim, Y., Dinh, T.T. and Chen, X. (2007) miR172 regulates stem cell
(2009) The sequential action of miR156 and miR172 regulates develop- fate and defines the inner boundary of APETALA3 and PISTILLATA

Downloaded from https://academic.oup.com/pcp/article/59/12/2549/5078893 by guest on 19 April 2022

mental timing in Arabidopsis. Cell 138: 750–759. expression domain in Arabidopsis floral meristems. Plant J. 51: 840–849.
Wu, G. and Poethig, R.S. (2006) Temporal regulation of shoot develop- Zhao, Q., Sun, C., Liu, D.-D., Hao, Y.-J. and You, C.-X. (2015) Ectopic ex-
ment in Arabidopsis thaliana by miR156 and its target SPL3. pression of the apple Md-miR172e gene alters flowering time and floral
Development 133: 3539–3547. organ identity in Arabidopsis. Plant Cell Tissue Organ Cult. 123: 535–546.
Wu, P.Z., Zhou, C.P., Cheng, S.F., Wu, Z.Y., Lu, W.J., Han, J.L., et al. (2015) Zheng, M., Chen, J., Shi, Y., Li, Y., Yin, Y., Yang, D., et al. (2017) Manipulation
Integrated genome sequence and linkage map of physic nut (Jatropha of lignin metabolism by plant densities and its relationship with lodging
curcas L.), a biodiesel plant. Plant J. 81: 810–821. resistance in wheat. Sci. Rep. 7: 41805.
Xia, Z., Zhang, S., Wen, M., Lu, C., Sun, Y., Zou, M., et al. (2018) Construction Zhou, C.-M., Zhang, T.-Q., Wang, X., Yu, S., Lian, H., Tang, H., et al. (2013)
of an ultrahigh-density genetic linkage map for Jatropha curcas L. and Molecular basis of age-dependent vernalization in Cardamine flexuosa.
identification of QTL for fruit yield. Biotechnol. Biofuels 11: 3. Science 340: 1097–1100.
Xue, L.-J., Zhang, J.-J. and Xue, H.-W. (2009) Characterization and expres- Zhu, Q.-H., Upadhyaya, N.M., Gubler, F. and Helliwell, C.A. (2009) Over-
sion profiles of miRNAs in rice seeds. Nucleic Acids Res. 37: 916–930. expression of miR172 causes loss of spikelet determinacy and floral
Yan, Z., Hossain, M.S., Wang, J., Valdés-López, O., Liang, Y., Libault, M., et al. organ abnormalities in rice (Oryza sativa). BMC Plant Biol. 9: 149–161.
(2013) miR172 regulates soybean nodulation. Mol. Plant. Microbe Zhu, Q.H. and Helliwell, C.A. (2011) Regulation of flowering time and floral
Interact. 26: 1371–1377. patterning by miR172. J. Exp. Bot. 62: 487–495.

2563