Molecular identification and phylogenesis analysis of gastrointestinal

nematode in different populations of Kazakh sheep

Xiaofei yan 
Xinjiang Agricultural University
Sangang He 
Xinjiang Academy of Animal Science
Yiyong Liu 
Animal Husbandry Terminus of Ili Kazakh Autonomous Prefecture
Bing Han 
Xinjiang Academy of Animal Science
Ning Zhang 
Xinjiang Academy of Animal Science
Haifeng Deng 
Zhaosu Horse Farm, Ili Kazakh Autonomous Prefecture
Yuqi Wang 
Xinjiang Agricultural University
Mingjun Liu 
(

[email protected]
)
Xinjiang Academy of Animal Science

Research Article

Keywords: Kazakh sheep, Gastrointestinal nematodes, Molecular epidemiology, Phylogenesis, The second internal transcription spacer of
ribosomal DNA

Posted Date: September 6th, 2022

DOI: https://doi.org/10.21203/rs.3.rs-1978124/v1

License:


This work is licensed under a Creative Commons Attribution 4.0 International
License.
 
Read Full License

Page 1/17
Abstract
Three dominant species of gastrointestinal nematodes, Haemonchus contortus, Trichostrongylus spp., and Teladorsagia circumcincta from the
various populations of Kazakh sheep were subjected to molecular identification and phylogenetic analysis. The internal transcribed spacer 2
(ITS-2) sequences of ribosomal DNA (rDNA) was used as the target sequence and specific primers. The results showed that all the three species
had their ITS-2 specific bands amplified. The infection rates based on fecal DNA were 35.59% of H. contortus, 25.55% of Trichostrongylus spp.,
and 11.24% of T. circumcincta respectively, and the infection rates based on larva DNA were 19.75% of H. contortus, 23.54% of Trichostrongylus
spp., and 10.03% of T. circumcincta respectively. The results were consistent with the PCR results of fecal samples and larval DNA from
Trichostrongylus spp. and T. circumcincta, except H. contortus. The phylogenetic tree showed that the ITS-2 sequences of the three species were
on the same branch as the ITS-2 sequences of the same species in NCBI, and on different branches from those of the ITS-2 sequences of
different families, genera and species. The same 93 fecal samples were analyzed by molecular identification and saturated saline solution
floatation method respectively. The molecular identification of hatched larva from fecal samples exhibited an infection rate of 100.00% with
respect to the three dominant species, higher than the infection rate of 96.77% by the saturated saline solution floatation method. Therefore, the
present molecular identification is more reliable in specificity and accuracy of these three species.

Introduction
Chronic wasting disease (CWD) caused by gastrointestinal nematode (GIN) infection is one of the important factors affecting sheep health and
production performance. Weight loss, death, and direct costs of deworming drugs caused by GIN infection have caused tremendous losses to
farming enterprises and herdsmen. It was reported that the annual cost of H. contortus treatment was $26 million in Kenya, $46 million in South
Africa, and $103 million in India (Peter et al. 2005). Various epidemiological surveys have shown that the infection rates and infection intensities
of H. contortus, Trichostrongylus spp., and T. circumcinctar in GIN were generally higher than the other species worldwide (Baihaqi et al. 2019;
Domke et al. 2013; Zajac et al. 2020). Our previous study also demonstrated that these three species were the dominant species of GIN in the
study area (Zhaosu County, Yili) (Yan et al. 2021). GIN usually presents as a mixed infection, and the infectious species distribution and numbers
vary with the season, weather conditions (especially precipitation and temperature), ruminant species and individual differences (Waller 2006).
There may be significant differences in fecundity and pathogenicity among different species, and they are also factors contributing to
differences in infectivity. Accurate diagnosis of GIN infection is the core of epidemiological survey and disease control. The conventionally
adopted method is the saturated saline flotation microscopy (Bowman 2009), which is labor-intensive and time-consuming, and cannot
accurately identify or differentiate single eggs or larva of different species of GIN. In particular, culturing larva is laborious and takes one week
(Dobson et al. 1992). In addition, the morphological identification of third stage (L3) larva as a genus or species requires experience but may still
be unreliable. Therefore, there is an urgent need to establish molecular identification techniques.

The internal transcribed spacer (ITS) of ribosomal DNA (rDNA) usually contains many insertion-deletion mutations (INDELs), and the
interspecific differences of INDELs can be used as markers for taxonomic identification (Blouin 2002). As of now, genetic markers in the first and
second ITS regions (ITS-1 and ITS-2, respectively) and external transcribed spacer regions (ETS) of rDNA have been used to successfully develop
PCR assays for identification and analysis of GIN eggs and larva (Gasser et al. 1993, 1997; Newton et al. 1998; Heise et al. 1999; Samson-
Himmelstjerna et al. 2002). For example, Zarlenga et al. (1998, 2001) used rDNA ITS and ETS sequences to develop a sensitive PCR method for
specific identification of GIN eggs in cattle for the first time. Subsequently, Schnieder et al. (1999) reported genus-specific PCR for the
identification of eggs or larva of Ostertagia, Cooperia, Nematodirus, Haemonchusand, and Trichostrongylus in ruminants. Zhao (2013) used the
ITS-1 and ITS-2 sequences of rDNA to develop polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and specific
PCR technology, and established molecular identification method for three types of nematodes. Avramenko et al. (2015) applied deep
sequencing of ITS-2 to investigate nematode community structure and further estimated the relative abundance of GINs in different species of
ruminants. In addition, understanding the genetic variation within and between GIN species is helpful to learn the transmission of GIN and
develop control strategies. Kampfer et al. (1998) proposed a molecular phylogeny of Nematoda based on ITS-2. However, the available high-
rank-level molecular phylogenetic study was restricted to Strongylida based on the ITS-2 sequences (Chilton et al. 1997). Studies in Italy (Cerutti
et al. 2010) and Brazil (Brasil et al. 2012) reported that H. contortus in domestic and wild animals showed high genetic variation and relatively
low host specificity. H. contortus population genetics surveys have been conducted worldwide, involving Australia, Brazil, Europe, Malaysia, and
the United States (Blouin et al. 1995; Troell et al.2006; Hunt et al. 2008). In this study, based on the previous epidemiological survey results in
Zhaosu County, Xinjiang (Yan et al. 2021), combined with the feeding practices on pasture, we took fecal samples and hatched single larva as
test materials and used the ITS-2 sequences of rDNA as genetic markers. We then conducted molecular identification and phylogenetic analysis
of H. contortus, Trichostrongylus spp., and T. circumcinctar in Kazakh sheep and the F1- and F2-generations of Kazakh × Texel sheep crosses.
Our study laid a foundation for the establishment of GIN-specific molecular diagnostic methods.

Materials And Methods

Sample collection
Page 2/17
All animals utilized in this research were prospectively approved and granted a formal waiver of ethics approval by the Animal Welfare
Committee of Shihezi University (Xinjiang, China). In the four seasons, April (spring), July (summer), September (autumn), and December (winter)
2020, in Zhaosu County and the Nilka County, Yili, the rectal fecal samples were collected from the female adult Kazakh sheep (4–5 years old),
the female adult F1-generation (3–4 years old) of Texel × Kazakh crosses, and the female adult F2-generation (2 years old) of Texel × F1
crosses. The net sample count was 916 with the details shown in Table 1. Each fecal sample weighed 20 g ~ 30 g, was put in a clean zip bag,
with variety, gender, age, chip number (unique for each sheep), and clinical symptoms recorded. The samples were transported to the laboratory
and stored in the refrigerator at 4 ℃. Deworming was carried out in 1–2 days after sampling in Spring and Autumn, respectively. In Spring,
intramuscular injection of ivermectin (0.04 ml/kg) and closantel sodium (0.1–0.2 ml/kg) was administered in April, and in Autumn,
intramuscular injection of ivermectin (0.04 ml/kg) and oral albendazole (0.1–0.15 ml/kg) were administered in September. Both the sampling
intervals and deworming intervals were at least 3 months.

Table 1
Number of fecal samples (number of samples)
Population Spring Summer Autumn Winter Overall

Kazakh 137 100 126 102 465

F1 122 50 80 79 331

F2 44 5 41 30 120

Overall 303 155 247 211 916

Reagents and instruments

The fecal DNA kit (spin-column type) and 2 × Taq PCR Master Mix were purchased from Tiangen Biotech (Beijing) Co., Ltd. The 10 × Taq PCR
buffer with KCl was purchased from Thermo Fisher Scientific, and etc. Optical microscope (Motic, model: SK200); Gradient thermal cycler
(Eppendorf, Germany, model: Mastercycler pro); microcentrifuge (Eppendorf, German, model: Eppendorf 5424); Nucleic acid and protein
quantification instrument (Eppendorf, Germany, model: BioSpectrometer basic); multifunctional gel imaging system (ProteinSimple, the United
States, model: AlphaImager HP); UV meter (Beijing Liuyi Biotechnology Co., LTD., model: WD-9403 F), and etc.
Primer synthesis
The specific primers for rDNA ITS-2 sequences of the three species of nematodes reported by Bott NJ et al. (2009) were synthesized by Sangon
Biotech (Shanghai) Co. Ltd. (Table 2).

Table 2
rDNA ITS-2 specific primers of three parasites species
Species Primer sequence Amplification length (bp)

H. contortus Forward: CAAATGGCATTTGTCTTTTAG 265

Reverse: TTAGTTTCTTTTCCTCCGCT

T. circumcinctar Forward: TATGCAACATGACGTACGACGG 218

Reverse: TTAGTTTCTTTTCCTCCGCT

Trichostrongylus spp. Forward: TATGCAACATGACGTACGACGG 267–268

Experiment method
Conventional fecal analysis
This entailed the use of the egg/oocyst floating method (Yan et al. 2021). Saturated NaCl was used as the floating fluid (specific gravity 1.2
kg/m3) to check the infecting species in the feces samples. The cover slip was then subjected to microscopic examination. The digital
microscope and microscopic image acquisition and analysis system were used to observe the morphology, structure, color, and size of the
samples. Subsequently, the images of eggs were captured and saved. The species identification was conducted in accordance with reference
literature (Bott et al. 2009; Kong 2016).
Fecal DNA extraction
Fecal DNA extraction was performed following the fecal DNA extraction kit instruction. An amount of 2 µl of the extracted DNA was used to
measure the OD and determine the concentration with a BioSpectrometer.

Incubation and isolation of L3 larva

Page 3/17
Partial fecal samples were randomly selected from each population in each season. The single and the mixed fecal samples were placed in an
electrothermal constant temperature incubator and cultured at 25°C for 7 days. After hatching, L3 larvae were isolated using Baermann's
Technique (Zajac et al. 2012), and they were picked under the microscope.
Genomic DNA extraction of single L3 larva
The single larva was rinsed and added with 8 µl ddH2O, 1 µl 10 × Taq Buffer with KCl, and 15 mM MgCl2, followed by flash frozen in liquid
nitrogen for 1 min, and then heated at 85°C for 2 min. Then the sample was added with 1 µl proteinase K (20 mg/µL), incubated at 56°C for 15
min, 95°C for 10 min, and stored at -20°C.

PCR identification
Using the DNA of fecal samples and the DNA of single L3 larvae as templates, ITS-2 sequences of the three species H. contortus,
Trichostrongylus spp., and T. circumcinctar, were amplified. The PCR reaction system had a total volume of 20.0 µL, including Mix 10.0 µL,
fecal/larva DNA 2.0 µL, ddH2O 6.0 µL, forward primer 1.0 µL, and reverse primer 1.0 µL. The PCR reaction program was as follows, 94°C for 5
min, a total of 35 cycles of (94°C for 30 s, 55°C for 30 s, and 72°C for 30 s), and then 72°C for 7 min. Samples without genomic DNA were
included as negative controls for each PCR. The PCR products were subjected to electrophoresis on 2% agarose gel at 100 V for 30 min,
photographed and documented by a gel imaging system.
Data analysis
The samples with positive PCR results were sent to Sangon Biotech (Shanghai) Co. Ltd. for sequencing. The obtained sequences were subjected
to BLAST homology analysis with the sequences of these three species published in Genbank to verify their species. DNAMAN8 was used to
compare and analyze the sequencing results, which were further subjected to homology analysis with the three species sequences (MN845169.1,
KP663663.1, and JQ989274.1) published in Genbank
Construction of the phylogenetic tree
The phylogenetic tree was constructed using MEGA 6.0. A total of 25 sequences of each of the three species and the ITS-2 sequences of the
three species in Genbank were included. The sequences of Nematodirus oiratianus (AJ239112.1), Marshallagia marshallli (AJ400715.1),
Cooperia oncophora (AJ544389.1), and Oesophagostomum dentatum (AJ889571.1), and the ITS-1 sequences of the three species were taken as
outgroups. The phylogenetic tree was constructed with MEGA 6.0 using neighbor joining method (NJ). Then Bootstrap with 500 replications was
conducted for confidence interval test, using 50% as the critical value of confidence, and those less than 50% would not be displayed. The other
settings were as default. SPASS 19.0 was used to analyze the difference in calculated infection rates between conventional fecal assay and
molecular identification method.

Results And Analysis

PCR amplification of ITS-2 sequences of the dominant species of GIN in sheep
The ITS-2 sequences of H. contortus, Trichostrongylus spp., and T. circumcincta were amplified respectively using the fecal genomic DNA of
Kazakh sheep and the F1- and F2-generations of sheep crosses and the DNA from the lysate of hatched larva as templates. The PCR products
were subjected to agarose gel electrophoresis, showing specific single bands at 200–300 bp, with a size of 265 bp for H. contortus, 267 ~ 268 bp
for Trichostrongylus spp., and 218 bp for T. circumcincta, respectively (Fig. 1). To test the specificity of the three pairs of primers, the DNA
template of a single larva was used to check whether there was crossover among the three pairs of primers, and the results revealed no non-
specific amplification for any pair of primers (Fig. 2).

ITS-2 sequences analysis of the dominant species of GIN in sheep

The obtained sequences of the three species were analyzed and compared online by BLAST. It was found that that these sequences were highly
(all > 95%) homologous to the ITS-2 sequences of H. contortus, Trichostrongylus spp., and T. circumcincta in GenBank. DNAMAN8 was used to
conduct intraspecific comparison between the obtained six sequences of each species and the ITS-2 sequences of the three species in GenBank,
and the results showed small intraspecific differences. In detail, they shared 99.31% homology with the ITS-2 sequence of H. contortus in
GenBank (accession number MN845169.1), as shown in Fig. 3-N; shared 99.12% homology with the ITS-2 sequence of Trichostrongylus
colubriformis in GenBank (accession number KP663663.1), as shown in Fig. 3-M; and shared 98.76% homology with the ITS-2 sequence of T.
circumcincta in GenBank (accession number JQ989274.1), as shown in Fig. 3-O.

The H. contortus study sequence had four mutation sites, the G-C transversion at position 27, the G-A transition and G-T transversion at position
48, the T-A transversion at position 57, and the G-C transversion at position 103 (as shown in Table 3). The Trichostrongylus spp. study sequence
had 19 mutation sites, including 8 transitions, 13 transversions, and 5 deletions. Among them, M-F-H (the Trichostrongylus spp. ITS-2 sequence
of the fecal DNA from Kazakh sheep) had the most mutation sites (as shown in Table 4). The T. circumcincta study sequence had 20 mutation
Page 4/17
sites, including 4 transitions, 26 transversions, and 2 deletions. Among them, O-Y-F2-41 (the T. circumcincta ITS-2 sequence of the larva DNA
from the F2-generation sheep crosses) has 8 mutation sites (as shown in Table 5).

Table 3
H.contortus ITS-2 gene sequence nucleotide variation sites
序列 位点

27 48 57 103

MN845169.1 G G T G

N-F-F1 Cb . . Cb

N-F-F2 . . . .

N-Y-F1 . . . .

N-Y-F2 . Aa . .

N-Y-H . . Ab .

N-Y-F2-16 . . . .

N-Y-F2-17 . . . .

N-F-H-50 . . . .

N-F-H-46 . . . .

N-Y-F2-20 . Tb . .

N-Y-F2-10 . Aa . .

N-Y-F2-11 . . . .

N-Y-F2-15 . . . .

N-Y-F2-8 . . Ab .

N-Y-F2-5 . . Ab .

N-Y-F2-13 . . Ab .

N-F-H-49 . . . .

N-Y-H-25 . . . .

Note: N: H.contortus; F: ITS-2 sequence obtained from fecal DNA; Y: ITS-2 sequence obtained from larval DNA; h: Kazakh sheep; F1: hybrid F1
sheep; F2: hybrid F2 sheep ; shoulder a: conversion, b: transversion, c: deletion, d: insertion.

Page 5/17
 Table 4
Trichostrongylus spp. ITS-2 gene sequence nucleotide variation sites
序列 位点

1 2 3 9 22 23 35 37 59 60 61 70 115 123 126 144 145 146 147

KP663663.1 G T A A T A T T A G T G A T A A T T A

M-F-F1 . . . . . . . . . . . . . . . . . . .

M-F-F2 . . . . . . . . . . . . . . . . . . .

M-F-H Tb Gb Tb . Ca . Ca Ca . . Ab . . . . . . . .

M-Y-F1 . . . . . . . . . . . . . . . . . . .

M-Y-F2 . . . . . . . . . . . . . . . . . . .

M-Y-H . . . . . . . . . . . . . . . . . . .

M-F-F1-4 . . Ac . . . . . . . . . . Gb Cb . . . .

M-Y-F2-15 . . . . . . . . . . . . . . . . . . Cb

M-Y-F2-16 . . . . . . . . . . . . . . . Tb Ca Ca .

M-Y-H-24 . . Ac . . . . . . . . . . . . . . . .

M-F-F2-12 . . . . . . . . . . . . . . . . . . .

M-F-F1-6 . . . . . . . . . Aa . . . Gb . . . . Cb

M-Y-H-21 . . . . . . . . . . . . . . . . . Ca .

M-F-F1-7 . . . . . . . . . . . . . . . . . . .

M-F-F2-14 . . . . . . . . . . . . . . . . . . .

M-Y-F1-9 . . . . . . . . Cb . . Aa . . . . . . .

M-Y-H-22 . . . . . . . . . . . . . . . . . . .

M-Y-H-19 . .   Ac Gb Ac . . . . . . Tb . . . Ac . .

Note: M: Trichostrongylus spp.; other labels are the same as in Table 3

Page 6/17
 Table 5
T. circumcincta ITS-2 gene sequence nucleotide variation sites
序列 位点

0 2 15 18 19 20 22 23 24 31 36 78 96 103 110 115 116 118 119 134

MN845174.1 T A T A G A A G A T T A A G A G C G A A

O-F-F1 . . . . . . . . . . . . . . . . . . . .

O-F-F2 . . . . . . . . . . . . . . . . . . . .

O-F-H . . . . . . .   . . . . . . . . . . . .

O-Y-F1 Tc . . . . . . . . . . . . . . . . . . .

O-Y-F2 . . . . . . . . . . . . . . . . . . . .

O-Y-H . . . . . . . . . . . . . . . . . . . .

O-F-F2-40 . . . . . . . . . . . . . Cb . Cb . . . .

O-Y-H-47 . . . . . . . . . . . . . . . . . . . .

O-Y-F1-33 . . . . Cb . . . . . . . . . . . . . . .

O-Y-H-48 . Cb . . . . . Ab Tb . . . . . . Cb . . . .

O-F-F1-28 . Cb . Cb . . . . . . . . . . . . . . . .

O-F-F2-38 . Cb . Cb . . Cb . . . Ca Cb Cb . . . . . . .

O-F-F1-30 . . . Cb Cb . . . . . . . . . . . Gb . . .

O-Y-F2-41 . . . . Cb Cb Cb . . Ca . . . . Tb Cb . Aa . Ad

O-Y-F1-32 . . . . . . . . . . . . . . . . . . . .

O-F-H-43 . . . . . . . . . . . . . . . . . . . .

O-Y-H-49 . . . . . . . . . . . . . . . . . . . .

O-F-F2-35 . . Tc Cb Cb Cb . . . . . . . . . Cb . . Ga .

Note: O: T. circumcincta; other labels are the same as in Table 3

Cluster analysis of ITS-2 sequences of the three dominant species of GIN

MEGA 6.0 was used to conduct multiple sequence alignment and construct a phylogenetic tree involving the fecal DNA and larva DNA ITS-2
sequences of different populations of the three nematode species, ITS-2 and ITS-1 sequences of the three nematode species from NCBI, and the
ITS-2 sequences of other nematode species. In this study, the 25 obtained H. contortus ITS-2 sequences were closely related to the H. contortus
ITS-2 sequences AY647245.1 and X78803.1 from NCBI, sharing the same branch. They were remotely related to the H. contortus ITS-1
sequences JX289536.1 and MG675030.1 from NCBI, presenting on different branches. They were also remotely related to the ITS-2 sequence of
other genus of Trichostrongylidae, such as Cooperia oncophora (AJ544389.1), Marshallagia marshalli (AJ400715.1), and Nematodirus
oiratianus (AJ239112.1), and Oesophagostomum dentatum (AJ889571.1) of Strongylida, locating in different branches (Fig. 4). The 25 obtained
Trichostrongylus spp. ITS-2 sequences in this study were closely related to the ITS-2 sequences of Trichostrongylus spp. (MH047849.1) and
Trichostrongylus colubriformis (KP663663.1) from NCBI, locating in the same branch, closer to T. colubriformis. They were remotely related to
the ITS-1 sequences of T. colubriformis (Y15876.1) and Trichostrongylus spp. (MG707739.1), on different branches. And they were also remotely
related to the ITS-2 sequences of other genus of Trichostrongylidae, such as H. contortus (AY647245.1), N. oiratianus (AJ239112.1), M. marshalli
(AJ400715.1), C. oncophora (AJ544389.1), and O. dentatum (AJ889571.1), on different branches (Fig. 5). The 25 obtained T. circumcincta ITS-2
sequences obtained in this study were closely related to the ITS-2 sequences of Teladorsagia circumcincta (JQ989274.1, JF747153.1) and
Ostertagia trifurcata (MN845174.1) from NCBI, locating in the same branch. And Ostertagia and Teladorsagia were closely related, belonging to
the same genus. They were remotely related to the ITS-1 sequences of Ostertagia ostertagi (AF044933.1) and Ostertagia circumcincta
(AF044934.1), locating in different branches. They were also remotely related to the ITS-2 sequences of other genus of Trichostrongylidae, such
as H.contortus (AY647245.1), O. dentatum (AJ889571.1), and N. oiratianus (AJ239112.1), in different branches. The results indicated that the
adopted three pairs of ITS-2 primers could accurately separate H.contortus, Trichostrongylus spp, and T. circumcincta (Fig. 6).

Page 7/17
Infection of the three dominant species of GIN
Detection of infection of the three dominant species in fecal DNA
A total of 916 fecal samples from the four seasons were subjected to molecular identification (Table 1). A number of 477 samples showed
infection with at least one dominant species, with an overall infection rate of 52.07%. Among them, 326 samples showed infection with H.
contortus, with an infection rate of 35.59%, 234 samples had infection with Trichostrongylus spp., showing an infection rate of 25.55%, and 103
samples were infected with T. circumcincta, having an infection rate of 11.24%. A number of 242 samples collected in the spring showed
infection (infection rate 80%), 69 summer samples showed infection (infection rate 70%), 108 autumn samples showed infection (infection rate
43.72%), and 58 winter samples showed infection (infection rate 37.42%). A number of 253 samples from Kazakh sheep showed infection, with
an infection rate of 55.05%; 159 samples from the F1-generation sheep crosses showed infection, with an infection rate of 48.04%; and 65
samples from the F2-generation sheep crosses showed infection, with an infection rate of 54.17%.
Detection of infection of the three dominant species in larva DNA
Molecular identification of the 977 larvae hatched from mixed fecal samples in the four seasons was carried out (Table 6). A total of 521
nematodes were identified in the three dominant species, including 193 H. contortus (infection rate 19.75%), 230 Trichostrongylus spp. (infection
rate 23.54%) and 98 T. circumcincta (infection rate 10.03%). A total of 95 nematodes in the three dominant species were identified from the
sample collected in the spring (infection rate 70.59%), 138 were identified from the summer samples (infection rate 46.46%), 45 from the autumn
samples (infection rate 18.44%), and 243 from the winter samples (infection rate 81.00%). A number of 165 samples from Kazakh sheep showed
infection, with an infection rate of 48.25%; 185 samples from the F1-generation sheep crosses showed infection, with an infection rate of
53.62%; and 171 samples from the F2-generation sheep crosses showed infection, with an infection rate of 58.97%.

Table 6
Number of hatched larvae samples in mixed fecal samples
Spring Summer Autumn Winter Overall Kazakh F1 F2 Overall

136 297 244 300 977 342 345 290 977

Comparison of saturated saline solution floatation method and molecular

identification
A number of 93 fecal samples were used to compare the two detection methods. The infection rate given by the saturated saline flotation
method was 96.77% regarding the three dominant species (90/93). Furthermore, the 93 fecal samples were cultured to collect individual larva,
which was subsequently subjected to molecular identification. Molecular identification demonstrated an infection rate of 100.00% (93/93). The
saturated saline flotation method revealed 37 fecal samples infected with all three dominant species, while molecular identification only revealed
three such samples. The differences in the average infection rates of H. contortus and Trichostrongylus spp. revealed by the two methods were
extremely significant (P < 0.001), but the difference in the average infection rates of T. circumcincta revealed by the two methods was not
significant (P > 0.001) (Table 7).

Table 7
he average infection rate of the three dominant species was detected by the two methods
Methods H.contortus(%) Trichostrongylus spp.(%) T. circumcincta(%)

Floatation method 59.62 ± 30.79A 6.34 ± 9.47A 11.62 ± 23.00A

Molecular identification 15.72 ± 20.73B 25.05 ± 24.07B 12.44 ± 16.93A

Note: Data in the same column, without the same uppercase superscripts (A, B) indicate a highly significant difference (P < 0.01)

Discussion
In order to effectively prevent and treat sheep GIN infection, we need to deeply understand its epidemiological pattern. Infection rate is an
essential indicator to determine the risk factors of population health, and a same infection intensity of different species may result different
pathogenic potential. Therefore, accurate identification of different species and understanding of the parasitic epidemiology are the basis for
developing sustainable parasite control measures. The conventional method of sheep GIN diagnosis is mostly by fecal examination. The
nematode species are identified based on the biological characteristics of eggs and infectious larva found in fecal. For example, Trichuris and
Nematodirus are easily identified according to their shapes and sizes. However, most species of Strongyloides are similar in size and shape, and
usually cannot be accurately identified at the genus level, such as Haemonchus, Trichostrongylus, Teladorsagia, Cooperia, Bunostomum, etc.

Page 8/17
Therefore, fecal culture and morphometric analysis of the third stage larva (L3) must be conducted to identify the species, which requires
considerable time and effort to identify the morphology of larva at various stages.

DNA molecular diagnostic technology has excellent specificity and sensitivity, and it is often used for the specific identification of GINs in
livestock (Santos et al. 2020; Gasser 1999, 2006; Zarlenga et al. 2001). The most popular molecular markers are cytochrome c oxidase subunit I
(cox1) of mitochondrial DNA (mtDNA), NADH dehydrogenase subunit 4 (Nad4) and the first and second internal transcribed spacers (ITS1 and
ITS2, respectively) of ribosomal DNA (rDNA). Most studies consistently demonstrated that the ITS regions of rDNA could serve as reliable genetic
markers for the specific identification of Strongyloides in domestic animals (Gasser 1999, 2006; Zarlenga et al. 2001; Chilton et al. 2004; Wimmer
et al. 2004). The results of other studies have shown that the intraspecies sequence variation of ITS-1 and ITS-2 (usually < 1.5%) was much
smaller than interspecies variation (Huby-Chilton et al. 2006). In this study, the sequence homological analysis of the three nematode species
revealed intraspecific differences between 0.88% and 1.24%. By amplification and sequence analysis of the ITS-2 regions of parasite eggs or
larva DNA, Santos et al. (2020) identified 12 species of seven genera, including Chabertia, Cooperia, Haemonchus, Oesophagostomum,
Ostertagia, Teladorsagia, and Trichostrongylus. Elmahalawy (2018) used Droplet Digital™ PCR with designed ITS-2 primer/probe combinations
of Haemonchus, Trichostrongylus, and Teladorsagiato and achieved effective results, distinguishing the most important sheep GINs in Sweden.
In the present study, three pairs of ITS-2 primers targeting H.contortus, Trichostrongylus spp, and T. circumcincta were selected to amplify the
fecal DNA and single larva DNA of naturally infected Kazakh sheep. As a result, single clear bands were obtained. In addition, no PCR
amplification was detected using single larva DNA templates that belonged to different nematode species from the primers. It also provided
evidence for the specificity of PCR. Through phylogenetic tree analysis, sequences of the same genus were clustered in one branch, while
sequences of different genera were present in different branches, showing clear interspecific grouping. The ITS-2 sequences from different
samples that located in the same branch of the same species cannot be effectively distinguished, therefore such intraspecies conserved genes
with large interspecies differences could be used as ideal molecular markers for the taxonomic identification and evolutionary genetic research
of various GIN species. In this study, Bunostomum trigoncephalum, Oesophagostomum, Nematodirus, and Marshallagia were all attempted to
amplify respectively, but not all species could be detected. Presumably, it is because of the difference in infection levels of nematode species
from different samples.

In this study, the same 93 fecal samples were used to carry out morphological identification of eggs and DNA molecular identification of hatched
larva, respectively, and given different results. The infection rate tested by the saturated saline solution flotation method was 96.77%, whereas
that by molecular identification was 100.00%, providing evidence for the high sensitivity of PCR. In addition, 37 samples were infected with all
three dominant species as shown by saline solution flotation method, inconsistent with the results from molecular identification, which only
showed three 3 triple infected fecal samples. Because of the similar size and shape of the eggs of Trichoencephalae, different species of
nematodes may not be accurately distinguished when examining the eggs following the saturated saline solution flotation method. Different
genera of nematodes may be mixed up too. For example, the egg size of H. contortus is (70–81) µm × (39–55) µm, and the egg size of
Oesophagostomum. spp is (70–90) µm × (34–45) µm, and both of them are oval-shaped (Kong 2016; Zajac et al., 2012). Hence, the saturated
saline solution flotation method may mistake the eggs of other species of nematodes as one of the three dominant species, thereby increasing
the triple infection rate. In contrast, the primers for molecular identification were species-specific. The sequences of the obtained PCR products
only identified nematodes of these three species and will not be mixed up with other species of nematodes. Therefore, molecular identification
has a higher sensitivity that made the triple infection rate lower than the result of the saline solution flotation method. Other scholars have also
conducted related research. For instance, to overcome the limitations of conventional methods such as fecal egg count (FEC) and/or larva
culture (LC) in terms of sensitivity and specificity, Roeber et al. (2012)developed and evaluated a semi-automated, high-throughput multiplexed-
tandem PCR (MT-PCR) platform that can be used for species- or genus-specific diagnosis of GIN infection within 24 hours, while the LC method
requires 7–10 days. Hence the primary advantage of molecular identification is that it could run at least 96 samples in one day and eliminate
any potential risk of “cross contamination”. Though the conventional saline solution flotation methods can diagnose an overt infection of
Strongyloides within 1–2 days, only after the larva culture and microscopic identification by an experienced specialist, genus or species-specific
diagnosis can be achieved. However, this culture method requires at least one week, and the fecal composition and culture conditions may cause
significant changes in larva development, leading to bias in identification results (Roeber et al. 2011).

Conclusion
In this study, the ITS-2 sequences of rDNA were used to perform molecular identification on fecal samples and hatched larvae of Kazakh sheep
and the F1- and F2-generations of Kazakh × Texel sheep crosses.That infections with three dominant species, H. contortus, Trichostrongylus spp,
and T. circumcincta were successfully identified. The molecular identification method showed more accurate and convenient than the
conventional saline solution flotation method regarding specific identification of nematode species by differential analysis of the two methods
based on the same fecal samples. Therefore, the present study laid a foundation for the establishment molecular identification method and the
grasp molecular epidemiology of GIN.

Declarations
Page 9/17
Acknowledgments

We would like to thank all organizations which funded this work and all the teachers who cooperated in technical assistance.

Funding Information

This study was funded by the Scientific Research Project of University of Xinjiang Autonomous Region (No. XJED2020Y049), and the National
innovation and entrepreneurship Training Program for college students of China (No.2020KJ0018), and the KeyLab funding of Xinjiang Ugrus
Autonomous region: identification of genes with resistance to sheep gastrointestinal nemotode infection by genome-wide association study, The
Tianshan Innvation Team (No. 2018D14004), and the Regional Collaborative Innovation Project of Xinjiang Uygur Autonomous Regioin
(Shanghai Cooperation Organization Science and Technology Partnershi and International Cooperation Program).Cooperative Research and
Application of Genomic Selection Technology for sheep Meat Traits (No. 2020E01004).

Conflict interest

The authors declare that they have no competing interests.

Availability of data and material

The date that support the findings of this study are available from the corresponding author upon reasonable request.

Authors' contributions

Conceived and designed the experiments: Xiaofei Yan, Mingjun Liu, Sangang He. 

Performed the experiments: Xiaofei Yan, Yiyong Liu, Haifeng Deng, Bing Han.

Analyzed the data: Xiaofei Yan, Ning Zhang, Yuqi Wang.

Contributed reagents/materials/analysis tools: Mingjun Liu, Sangang He, Yiyong Liu, Haifeng Deng.  

Wrote the paper: Xiaofei Yan, Mingjun Liu. 

Ethics approval

All animal procedures were approved by the Animal Welfare Committee of Shihezi University (Xinjiang, China). Experiments were conducted in
accordance with animal ethics guidelines and approved protocols.

Consent to participate and Consent for publication

All authors read and approved the final manuscript, and consent for publication.

References
1. Avramenko RW, Redman EM, Lewis R, Y azwinski TA, Wasmuth JD, Gilleard JS (2015) Exploring the gastrointestinal“nemabiome”: deep
amplicon sequencing to quantify the species composition of parasitic nematode communitie. PLoS One 10: 1–18.
https://doi.10.1371/journal.pone.0143559.
2. Baihaqi ZA,Widiyono I, Nurcahyo W (2019) Prevalence of gastrointestinal worms in Wonosobo and thin-tailed sheep on the slope of Mount
Sumbing, Central Java, Indonesia. Vet World 12: 1866–1871. https://doi.10.14202/vetworld.2019.1866-1871
3. Bowman DD (2009) Georgis’ Parasitology for Veterinarians, ninth ed. Saunders Elsevier, Edinburgh.
4. Blouin MS (2002) Molecular prospecting for cryptic species of nema-todes: mitochondrial DNA versus internal transcribed spacer. Int J
Parasitol 32: 527–531. https://doi.10.1016/s0020-7519(01)00357-5.
5. Brasil BSAF, Nunes RL, Bastianetto E, Drummond MG, Carvalho DC, Leite RC, Molento MB, Oliveira DAA (2012) Genetic diversity patterns of
H. placei and H. contortus populations isolated from domestic ruminants in Brazil. International Journal for Parasitology 42: 469–479.
https://doi.10.1016/j.ijpara.2012.03.003.
6. Blouin MS, Yowell CA, Courtney CH, Dame JB (1995) Host movement and the genetic structure of populations of parasitic nematodes.
Genetics 141: 1007–1014. https://doi.10.1093/genetics/141.3.1007.
7. Bott NJ, Campbell BE, Beveridge I, Chiltonb NB, Rees D, Hunt PW, Gasser RB (2009) A combined microscopic-molecular method for the
diagnosis of strongylid infections in sheep. Int J Parasitol 39: 77–87. https://doi.10.1016/j.ijpara.2009.03.002.

Page 10/17
 8. Chilton NB, Gasser RB, Beveridge I (1997) Phylogenetic relationships of Australian strongyloid nematodes inferred from ribosomal DNA
sequences data. International Journal for Parasitology 27: 1481–1494. https://doi.10.1016/s0020-7519(97)00134-3.
9. Cerutti MC, Citterio CV, Bazzocchi C, Epis S, Amelio SD', Ferrari N, Lanfranch P (2010) Genetic variability of Haemonchus contortus
(Nematoda: Trichostrongyloidea) in alpine ruminant host species. Journal of Helminthology 84: 276–283.
https://doi.10.1017/S0022149X09990587.
10. Chilton NB (2004) The use of nuclear ribosomal DNA markers for the identification of bursate nematodes (order Strongylida) and for the
diagnosis of infections. Anim Health Res Rev 5: 173 – 87. https://doi.10.1079/ahr200497.
11. Domke AV, Chartier C, Gjerde B, Leine N, Vatn S, Stuen S (2013) Prevalence of gastrointestinal helminths, lungworms and liver fluke in sheep
and goats in Norway. Vet Parasitol 194: 40–48. https://doi.10.1016/j.vetpar.2012.12.023
12. Dobson RJ, Barnes EH, Birclijin SD, Gill JH (1992) The survival of Ostertagia circumcincta and Trichostrongylus colubriformisin faecal
culture as a source of bias in apportioning egg counts to worm species. Int J Parasitol 22:1005–1008. https://doi.10.1016/0020-
7519(92)90060-x.
13. Elmahalawy ST, Halvarsson P, Skarin M, Höglund J (2018) Droplet digital polymerase chain reaction (ddPCR) as a novel method for
absolute quantification of major gastrointestinal nematodes in sheep. Vet Parasitol 261: 1–8. https://doi.10.1016/j.vetpar.2018.07.008.
14. Gasser RB, Chilton NB, Hoste H, Beveridge I (1993) Rapid sequencing of rDNA from single worms and eggs of parasitic helminths. Nucleic
Acids Res 21: 2525–2526. https://doi.10.1093/nar/21.10.2525.
15. Gasser RB, Monti JR (1997) Identification of parasitic nematodes by PCR-SSCP of ITS-2 rDNA. Mol Cell Probes 11: 201–209.
https://doi.10.1006/mcpr.1997.0106.
16. Gasser RB (1999) PCR-based technology in veterinary parasitology. Vet Parasitol 84: 229–258. https://doi.10.1016/s0304-4017(99)00036-
9.
17. Gasser RB (2006) Molecular tools—advances, opportunities and prospects. Vet Parasitol 136: 69–89.
https://doi.10.1016/j.vetpar.2005.12.002.
18. Gasser RB, Bott NJ, Chilton NB, Hunt P, Beveridge I (2008) Toward practical DNA-based diagnostic methods for parasitic nematodes of live-
stock–bionomic and biotechnological implications. Biotechnol Adv 26: 325–334. https://doi.10.1016/j.biotechadv.2008.03.003.
19. Heise M, Epe C, Schnieder T (1999) Differences in the second internal transcribed spacer (ITS-2) of eight species of gastrointestinal
nematodes of ruminants. J Parasitol 85: 431–435. PMID: 10386433.
20. Hunt PW, Knox MR, Le Jambre LF, McNally J, Anderson LJ (2008) Genetic and phenotypic differences between isolates of Haemonchus
contortusin Australia. Int J Parasitol 38: 6, 885–900. https://doi.10.1016/j.ijpara.2007.11.001.
21. Huby-Chilton F, Chilton NB, Lankester MW, Gajadhar AA (2006) Single-strand conformation polymorphism (SSCP) analysis as a new
diagnostic tool to distinguish dorsal-spined larvae of the Elaphostrongylinae (Nematoda: Protostrongylidae) from cervids. Vet Parasitol 135:
153–162. https://doi.10.1016/j.vetpar.2005.08.001.
22. Kampfer S, Strumbauer C, Ott J (1998) Phylogenetic analysis of rDNA sequences from adenophorean nematodes and implications for the
Adenophorea–Secernentea controversy. Invertebrate Biology 117: 29–36. https://doi.10.2307/3226849.
23. Kong FY (2016). Livestock Parasitology(second edition). China Agricultural University Press, Beijing(in Chinese).
24. Newton LA, Chilton NB, Beveridge I, Hoste H, Nansen P, Gasser RB (1998) Genetic markers for strongylid nematodes of livestock defined by
PCR-based restriction analysis of spacer rDNA. Acta Trop 69: 1–15. https://doi.10.1016/s0001-706x(97)00105-8.
25. Peter JW, Chandrawathani P (2005) Haemonchus contortus: Parasite problem No. 1 from Tropics - Polar Circle. Problems and prospects for
control based on epidemiology. Trop Biomed 22: 131–137. PMID: 16883278.
26. Roeber F, Jex AR, Campbell AJD, Nielsen R, Anderson GA, Stanley KK, Gasser RB (2012) Establishment of a robotic, high-throughput platform
for the specific diagnosis of gastrointestinal nematode infections in sheep. Int J Parasitol 42: 1151–1158.
https://doi.10.1016/j.ijpara.2012.10.005
27. Roeber F, Jex AR, Campbell AJD, Campbell BE, Anderson GA, Robin B. Gasser RB (2011) Evaluation and application of a molecular method
to assess the composition of strongylid nematode populations in sheep with naturally acquired infections. Infection, Genetics and Evolution
11(5): 849–854. https://doi.10.1016/j.meegid.2011.01.013.
28. Schnieder T, Heise M, Epe C (1999) Genus-specific PCR for the differentiation of eggs or larvae from gastrointestinal nematodes of
ruminants. Parasitol Res 85: 895–898. https://doi.10.1007/s004360050654.
29. Santos LL, Salgado JA, Drummond MG, Bastianetto E, Santos CP, Brasil BSAF, Taconeli CA, Oliveira DAA (2020) Molecular method for the
semiquantitative identification of gastrointestinal nematodes in domestic ruminants. Parasitol Res 119: 529–543.
https://doi.10.1007/s00436-019-06569-3.
30. Troell K, Engstrom A, Morrison DA, Mattsson JG, Hoglund J (2006) Global patterns reveal strong population structure in H. contortus, a
nematode parasite of domesticated ruminants. International Journal for Parasitology 36: 1305–1316.

Page 11/17
 https://doi.10.1016/j.ijpara.2006.06.015.
31. Samson-Himmelstjerna VG, Harder A, Schnieder T (2002) Quantitative analysis of ITS2 sequences in trichostrongyle parasites. Int. J.
Parasitol 32: 1529–1535. https://doi.10.1016/s0020-7519(02)00163-7.
32. Waller PJ (2006) Sustainable nematode parasite control strategies for ruminant livestock by grazing management and biological control.
Animal Feed Science and Technology 126: 277–289. https://doi.10.1016/j.anifeedsci.2005.08.007.
33. Wimmer B, Craig BH, Pilkington JG, Pemberton JM (2004) Non-invasive assessment of parasitic nematode species diversity in wild Soay
sheep using molecular markers. Int J Parasitol 34: 625–631. https://doi.10.1016/j.ijpara.2003.11.022.
34. Yan XF, Liu Mj, He SG, Tong T, Liu YY, Ding KQ, Deng HF, Wang PM (2021) An epidemiological study of gastrointestinal nematode and
Eimeria coccidia infections in different populations of Kazakh sheep. PLoS One 16: e0251307. https://doi.10.1371/journal.pone.0251307.
35. Zajac AM, Garza J (2020) Biology, Epidemiology, and Control of Gastrointestinal Nematodes of Small Ruminants. Vet Clin North Am Food
Anim Pract 36:73–87. https://doi.10.1016/j.cvfa.2019.12.005.
36. Zarlenga DS, Gasbarre LC, Boyd PC, Leighton E, Lichtenfels JR (1998) Identification and semi-quantitation of Ostertagia ostertagieggs by
enzymatic amplification of ITS-1 sequences. Veterinary Parasitology 77: 245–257. https://doi.10.1016/s0304-4017(98)00114-9.
37. Zarlenga DS, Chute MB, Gasbarre LC, Boyd PC (2001) A multiplex PCR assay for differentiating economically important gastrointestinal
nematodes of cattle. Veterinary Parasitology 97: 199–209. https://doi.10.1016/s0304-4017(01)00410-1.
38. Zhao GH, Jia YQ, Bian QQ, Nisbet AJ, Cheng WY, Liu Y, Fang YQ, Ma XT, Yu SK (2013) Molecular approaches to differentiate three species of
Nematodirus in sheep and goats from China based on internal transcribed spacer rDNA sequences. J Helminthol 89: 259–266.
https://doi.10.1017/S0022149X13000825.
39. Zajac AM, Conboy GA (2012) Veterinary clinical parasitology(8th Edition). Johnwiley&Sons.Inc, USA.
40. Zarlenga DS, Higgins J (2001) PCR as a diagnostic and quantitative technique in veterinary parasitology. Vet Parasitol 101: 215–230.
https://doi.10.1016/s0304-4017(01)00568-4.

Figures

Figure 1

PCR amplification products of H.contortus, Trichostrongylus spp., T. circumcincta ITS-2 sequences

Note: M: 100 bp DNA Mark; 1: negative; 2-4: H.contortus larval DNA PCR product; 5-7: H.contortus fecal DNA PCR product; 8-10: Trichostrongylus
spp. larval DNA PCR product; 11-13 : Trichostrongylus spp. fecal DNA PCR product; 14-16: T. circumcincta larvae DNA PCR product; 17-19: T.
circumcincta fecal DNA PCR product

Page 12/17
Figure 2

H.contortus, Trichostrongylus spp., T. circumcincta ITS-2 sequence primer specificity detection

Note: M: 100 bp DNA Mark; 1: negative; 2: H.contortus primer positive sample; 3: Trichostrongylus spp. positive sample; 4: T. circumcincta
positive sample; 5: Trichostrongylus spp. primer positive sample; 6: H.contortus positive sample; 7: T. circumcincta positive sample; 8: T.
circumcincta primer positive sample; 9: H.contortus positive sample; 10: Trichostrongylus spp. positive sample.

Page 13/17
Figure 3

Homology analysis of ITS-2 sequences 

Note: H.contortus ITS-2 sequence homology analysis; M: Trichostrongylus spp. ITS-2 sequence homology analysis; O: T. circumcincta ITS-2
sequence homology analysis

Page 14/17
Figure 4

Neighbour joining tree of the ITS-2 sequences from H.contortus isolated in this study and selected data base entries

Page 15/17
Figure 5

Neighbour joining tree of the ITS-2 sequences from Trichostrongylus spp. isolated in this study and selected data base entries

Page 16/17
Figure 6

Neighbour joining tree of the ITS-2 sequences from T. circumcincta isolated in this study and selected data base entries

Page 17/17