Jurnal Aurelia Azalya Sofyan-7a - Compressed

RESEARCH ARTICLE
Transcriptome profiling and digital gene

expression analysis of sweet potato for the
identification of putative genes involved in the
defense response against Fusarium
oxysporum f. sp. batatas
Yuli Lin1,2,3, Weikun Zou3, Shiqiang Lin1,4, Dennis Onofua3, Zhijian Yang1,3,
a1111111111 Haizhou Chen3, Songliang Wang3, Xuanyang Chen1,2,3,5*
a1111111111
1 Key Laboratory of Crop Biotechnology (Fujian Agriculture and Forestry University), Fujian Province
a1111111111
University, Fuzhou, Fujian, China, 2 Key Lab of Genetics, Breeding and Multiple Application of Crops
a1111111111 (FAFU), Ministry of Education, Fuzhou, Fujian, China, 3 Department of Agronomy, College of Crop Science,
a1111111111 Fujian Agriculture and Forestry University, Fuzhou, Fujian, China, 4 Department of Bioinformatics, College of
Life Science, Fujian Agriculture and Forestry University, Fuzhou, Fujian, China, 5 Fujian Provincial Key
Laboratory of Crop Breeding by Design, Fuzhou, Fujian, China
* [email protected]
OPEN ACCESS
Citation: Lin Y, Zou W, Lin S, Onofua D, Yang Z,

Chen H, et al. (2017) Transcriptome profiling and Abstract
digital gene expression analysis of sweet potato for
the identification of putative genes involved in the Sweet potato production is constrained by Fusarium wilt, which is caused by Fusarium oxy-
defense response against Fusarium oxysporum f. sporum f. sp. batatas (Fob). The identification of genes related to disease resistance and
sp. batatas. PLoS ONE 12(11): e0187838. https:// the underlying mechanisms will contribute to improving disease resistance via sweet potato
doi.org/10.1371/journal.pone.0187838
breeding programs. In the present study, we performed de novo transcriptome assembly
Editor: T. R. Ganapathi, Bhabha Atomic Research and digital gene expression (DGE) profiling of sweet potato challenged with Fob using Illu-
Centre, INDIA
mina HiSeq technology. In total, 89,944,188 clean reads were generated from 12 samples
Received: July 5, 2017 and assembled into 101,988 unigenes with an average length of 666 bp; of these unigenes,
Accepted: October 26, 2017 62,605 (61.38%) were functionally annotated in the NCBI non-redundant protein database
Published: November 13, 2017 by BLASTX with a cutoff E-value of 10−5. Clusters of Orthologous Groups (COG), Gene
Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) annotations were
Copyright: © 2017 Lin et al. This is an open access
article distributed under the terms of the Creative examined to explore the unigenes’ functions. We constructed four DGE libraries for the
Commons Attribution License, which permits sweet potato cultivars JinShan57 (JS57, highly resistant) and XinZhongHua (XZH, highly
unrestricted use, distribution, and reproduction in susceptible), which were challenged with pathogenic Fob. Genes that were differentially
any medium, provided the original author and
expressed in the four libraries were identified by comparing the transcriptomes. Various
source are credited.
genes that were differentially expressed during defense, including chitin elicitor receptor
Data Availability Statement: Data are available
kinase 1 (CERK), mitogen-activated protein kinase (MAPK), WRKY, NAC, MYB, and ethyl-
from the NCBI Gene Expression Omnibus
repository under GEO Series accession number ene-responsive transcription factor (ERF), as well as resistance genes, pathogenesis-
GSE89290 (https://www.ncbi.nlm.nih.gov/geo/ related genes, and genes involved in salicylic acid (SA) and jasmonic acid (JA) signaling
query/acc.cgi?acc=GSE89290).
pathways, were identified. These data represent a sequence resource for genetic and geno-
Funding: This work was financially sponsored by mic studies of sweet potato that will enhance the understanding of the mechanism of dis-
grants from The Education Department of Fujian
ease resistance.
Province (CN) (JA14101) and the Fujian Provincial
Department of Science & Technology (CN)
(2017NZ0002-2).
PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 1 / 21

Transcriptome profiling of sweet potato and identification of defense related genes against Fob
Competing interests: The authors have declared Introduction

that no competing interests exist.
Sweet potato is the 7th most important crop globally, with an annual area harvest of 8.0 million
Abbreviations: CERK1, Chitinelicitor receptor
ha and a total global production of 104.5 million tons. Sweet potato is planted primarily in
kinase 1; MAPK, Mitogen-activated protein kinase;
PR, Pathogenesis related; SA, Salicylic acid; ET,
developing areas in Asia and Africa [1, 2]. In the past two decades, sweet potato production
Ethylene; JA, Jasmonic acid; DGE, Digital gene has decreased in Asia and greatly increased in Africa [2]. In the USA, the harvest area has
expression; ETI, Effector-triggered immunity; Fob, increased from 33.3 kha in 2002 to 54.7 kha in 2014, and this increase has resulted in a corre-
Fusarium oxysporum f. sp. batatas; GO, Gene sponding increase in sweet potato production from 580.5 kilotons to 1.34 million tons [2].
Ontology; KEGG, Encyclopedia of Genes and Fusarium oxysporum, a soil-borne pathogenic fungus, is classified into more than 120 for-
Genomes pathway database; PAMPs, Pathogen-
mae speciales and races, each of which infects one specific crop, such as sweet potato, tomato,
associated molecular patterns; PRRs, Pattern
recognition receptors; PTI, PAMP-triggered banana, watermelon or pepper. The severity of the damage caused by these infections depends
immunity; SAR, Systemic acquired resistance; F07, on the interaction between the pathogen and the host crop [3]. The production of sweet potato
Strain of Fusarium oxysporum f. sp. batatas with is constrained by Fusarium wilt, which is caused by Fusarium oxysporum f. sp. batatas (Fob)
strong pathogenicity; JS57, JinShan 57 (sweet [4]. Sweet potato growth was limited in the Southeastern United States prior to the 1950s and
potato cultivar with high resistance to Fusarium
South China prior to the 1980s, when resistant cultivars were bred and applied [5, 6]. Fusarium
wilt disease); JS57-F07, Sweet potato cultivar JS57
inoculated with F07; XZH, XinZhongHua (sweet
wilt has spread across many provinces in Central China and threatens sweet potato production
potato cultivar with high susceptibility to Fusarium [7].
wilt disease); XZH-F07, Sweet potato cultivar XZH During Fob infections, sweet potato secretes tyloses, cell wall material or brown matter into
inoculated with F07. xylem vessels as a physiological response to impede Fob infection, leading to blockade of the
vascular bundle [8, 9] and stem split and rot [5]. Colonization by Fob can induce the defense
system in sweet potato. The susceptibility or resistance of sweet potato to Fusarium wilt
depends on the interaction with Fob, consistent with the gene-for-gene hypothesis proposed
by Flor [10] and the mode of co-evolution proposed by Jones [11]. The pathogen-associated
molecular patterns (PAMPs), such as chitin, glucan, or glycoprotein, of fungal cells are recog-
nized by pattern recognition receptors (PRRs) in plants, resulting in PAMP-triggered immu-
nity (PTI) to prevent pathogen colonization. Successful pathogens release effector proteins to
suppress PTI [11]. In response, plants have evolved resistance (R) proteins to recognize these
effectors and trigger a secondary response, i.e., effector-triggered immunity (ETI), which
induces the expression of downstream defense-related genes [12]. This model was elucidated
based on the interaction between tomato and its pathogenic Fusarium oxysporum f. sp. lycoper-
sici (Fol) [13]. Many R genes with identified functions have been isolated from Arabidopsis,
rice, tomato, and other host plants [14–17].
Sweet potato is hexaploid with a complex genome that has not been sequenced [18]. High-
throughput RNA sequencing based on next-generation sequencing technology (Illumina) has
recently been applied in analyses of gene expression profiling and for the discovery of impor-
tant genes involved in disease resistance and related pathways [19, 20]. Transcriptome
sequencing offers a rapid approach to obtain expressed gene sequence information for sweet
potato [21] and has been used to mine gene-based microsatellite markers [22, 23], elucidate
the mechanism of development and metabolism in the purple tuberous roots of sweet potato
[18], reveal gene expression patterns associated with tuberous root formation and develop-
ment [24], and identify related genes involved in lignin and starch biosynthesis [21].
In the present study, transcriptome sequencing technology was used to perform RNA
sequencing (RNA-Seq) of sweet potato cultivars inoculated with pathogenic F. oxysporum. We
constructed a sufficiently large library using equally mixed total RNA. In total, 89,944,188
high-quality reads were retained and assembled into 62,605 unigenes. The unigenes were then
annotated and assigned putative functions, classifications or pathways by alignment with pub-
lic databases. The transcriptome data provide a global view of the gene expression in sweet
potato during Fob infection, generating a resource for discovering candidate defense-related
genes. Based on the transcriptome data, we constructed cDNA libraries and performed four

digital gene expression (DGE) analyses using sequencing reads from the libraries to compare
the gene expression profiles of a sweet potato cultivar challenged with pathogenic Fob and
identify a set of genes involved in the defense response to Fob. The comparisons will provide a
better understanding of the molecular mechanisms underlying the defense response of sweet
potato to Fob.
Materials and methods

Plant and pathogen materials, treatment and RNA extraction
Two sweet potato cultivars were used as the plant materials: Jinshan57 (JS57, highly resistant
to Fusarium wilt) and XinZhongHua (XZH, highly susceptible to Fusarium wilt). JS57 was
used as a highly resistant control (disease index of 14.7), whereas XZH was used as a highly
susceptible control (disease index of 100) to identify resistance to Fusarium wilt [4].
The virulent pathogen fungus Fusarium oxysporum f. sp. batatas07 (F07) was used. F07 was
isolated from sweet potato with Fusarium wilt and stored at -20˚C.
Seedlings of sweet potato were inoculated with F07 or water (as a control). Four samples
were prepared as follows: (1) JS57 inoculated with F07 (JS57-F07); (2) JS57 in water (JS57-CK);
(3) XZH inoculated with F07 (XZH-F07); and (4) XZH in water (XZH-CK).
The conidia solutions were prepared as follows: F07 was grown on potato sugar agar (PSA)
medium in a Petri dish for 8 d at 28˚C until the mycelia grew over the surface of the medium.
The PSA medium with mycelia was cut into small pieces and transferred into 250-mL conical
flasks containing 100 mL of liquid Czapek medium. Each flask containing eight pieces of PSA
medium with mycelia was incubated at 28˚C for 8 d on a rotary shaker. The liquid medium
containing the conidia and mycelia was strained through cheesecloth, and the conidia were
collected into clean empty flasks. The conidia concentration of the solution in the flask was
determined using a hemocytometer. Prior to incubation, the conidia suspensions were diluted
in sterilized distilled water to a concentration of 1 × 107 conidia/mL.
Healthy sweet potato seedlings that were field grown for at least 28 d and had no obvious
disease symptoms were freshly cut to a length of 20 cm and cultivated in glass bottles contain-
ing conidial solutions of 1 × 107 conidia/mL. Seedlings were cultivated in water as a control.
The seedlings were cultivated in growth chambers at 28˚C for 24 h, and the basic stems of
seedlings with a length of 2 cm were collected as samples. Three independent biological repli-
cates of each treatment were collected and immediately frozen in liquid nitrogen. Total RNA
was isolated from each sample using the RNAprepPure Plant Kit (Tianen Biotech, Beijing,
China), according to the manufacturer’s instructions. RNA degradation was detected by elec-
trophoresis on 1% agarose gels, and the RNA purity was measured by a NanoPhotometer spec-
trophotometer (IMPLEN, CA, USA). We used the Qubit RNA Assay Kit with a Qubit2.0
Fluorometer (Life Technologies, CA, USA) to determine the RNA concentration. The RNA
integrity was confirmed using an RNA Nano 6000 Assay Kit on the Agilent Bioanalyzer 2100
system (Agilent Technologies, CA, USA).
Library preparation and transcriptome sequencing

The sequencing library was prepared using 3 μg of RNA from each sample and the NEBNex-
tUltra™ RNA Library Prep Kit for Illumina (NEB, USA) according to the manual. Index codes
were added to sequences from each sample. In brief, poly-T oligo-attached magnetic beads
were applied to purify mRNA from total RNA. Then, fragmentation was conducted in the
presence of divalent cations and at higher temperature in NEBNext, First Strand Synthesis
Reaction Buffer (5X). We utilized random hexamer primers and M-MuLV Reverse Transcrip-
tase to perform first-strand cDNA synthesis and DNA Polymerase I and RNase H for the

second-strand cDNA synthesis. The overhangs were filled to blunt ends by exonuclease/poly-
merase activity. Then, the 3’ ends of the DNA fragments were adenylated, and NEBNext,
Adaptors with hairpin loop structures were ligated to the DNA fragments. cDNA fragments
with a size of 150–200 bp were purified with the AMPure XP system (Beckman Coulter, Bev-
erly, USA). The cDNA was then incubated with the USER Enzyme (NEB, USA) at 37˚C for 15
min and 95˚C for 5min. PCR was performed using Phusion High-Fidelity DNA polymerase
with Universal PCR primers and Index (X) Primer. The PCR products were purified with an
AMPure XP system. The library quality was evaluated with the Agilent Bioanalyzer 2100 sys-
tem. The index-coded samples were clustered using the cBot Cluster Generation System with
the TruSeq PE Cluster Kit v3-cBot-HS (Illumina) according to the manual. The library prepa-
rations were then sequenced on an Illumina HiSeq 2500 platform. The resultant datasets are
available in the NCBI Gene Expression Omnibus repository under GEO Series accession num-
ber GSE89290 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE89290).
Quality control and de novo assembly

The data produced using the Illumina HiSeq 2500 platform were transferred into raw reads
(raw data) using base calling. The raw reads were initially processed via in-house Perl scripts
[25], and the reads containing adapters or N (indefinite base) higher than 10%as well as low-
quality reads were then removed. The remaining high-quality clean reads were used to deter-
mine the error rate, Q20, Q30, GC content and sequence duplication level. The clean data
were also used to perform the following bioinformatics analyses. According to Haas et al. [25],
the clean reads were concatenated into two files. The left files (read1 files) from all libraries/
samples were pooled into a large left.fq file, and the right files (read2 files) were pooled into a
large right.fq file. The transcriptome assembly was obtained based on the left.fq and right.fq
using Trinity [26] for de novo assembly, with a minimum kmer coverage of two and default
setting for all other parameters.
Gene functional annotation

The functions of the assembled transcripts were annotated by searching their sequences
against the following databases:
NR (NCBI non-redundant protein sequences, http://www.ncbi.nlm.nih.gov) with an E-
value cutoff of 1e-5;
Nt (NCBI non-redundant nucleotide sequences, http://www.ncbi.nlm.nih.gov) with an E-
value cutoff of 1e-5;
PFAM (Protein family, http://pfam.sanger.ac.uk/) with an E-value cutoff of 1e-2;
KOG/COG (Clusters of Orthologous Groups of proteins, http://www.ncbi.nlm.nih.gov/
COG/) with an E-value cutoff of 1e-3; and
Swiss-Prot (A manually annotated and reviewed protein sequence database, http://www.
ebi.ac.uk/uniprot/) with an E-value cutoff of 1e-5.
Based on the annotations in NR and PFAM, Blast2GO (v2.5) was used to obtain the GO
annotations (http://www.geneontology.org) according to the molecular function, biological
process and cellular component ontologies [27]. The Automatic Annotation Server and the
Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database (http://www.genome.
jp/kegg) were used to generate pathway assignments with an E-value cutoff of 1e-5.
Differential expression analysis

The analysis of differential expression between the four groups was performed with the DESeq
R package (1.10.1). The resulting P-values were adjusted according to Benjamini and

Table 1. Sequences of primers used in the qRT-PCR analysis.

Sample Gene ID Primers Primer sequences
JS57 C52297 F CCCTTCATTCCCTTTCCACC
R CGAGTTCTTCGTCGCCGTTA
C51550 F TTTGTTTCTTCCACCTCTGT
R ATGCACGAATATCGCCTTAG
C47391 F TGTTGGGTCTGATAGTATTG
R CTCTTCCCTTTATTCTTCTG
XZH C55420 F CAGCCCAATAATCCAAGCAC
R GCATCACATCGGACCCTAAC
C56184 F TACCAATCAAAGGCTCACAA
R CCACCTAAAGGCACCAAGAC
Reference GAPDH F GCAGGAACCCGGAAGAGATT
R GCAGCCTTGTCCTTGTCAGTG
https://doi.org/10.1371/journal.pone.0187838.t001
Hochberg’s approach for controlling the false discovery rate. Genes with an adjusted P-value
<0.05, as determined by DESeq, were regarded as differentially expressed.
Experimental validation
Five genes were examined using real-time quantitative PCR (Q-PCR) to confirm their expres-
sion levels using FPKM, and the primers (Table 1) were designed using software Primer 5 and
synthesized by Invitrogen. The primer sequences are listed in Table 1. A total of 1 μg of total
RNA was used to synthesize the cDNA using the Prime Script RT Reagent Kit (Takara,
DaLian, China) in a 20-μL reaction mixture. qRT-PCR was performed on a StepOnePlus™
Real-Time PCR System (Thermo Fisher Scientific), and the sweet potato GAPDH gene [28]
was used as the endogenous reference control. All reference and selected genes were measured
in triplicate.
Each reaction had a total volume of 20 μL and contained 2 μL of cDNA, 0.2 μL (10 μmol L-1)
of gene-specific primers and 0.1 μL of CXR SYBR Green Master Mix. The real-time quantitative
PCR program was 95˚C for 10 min followed by 40 cycles of95˚C for 15 s, 55˚C for 20 s and
72˚C for 30 s. The data were processed with Excel 2007(Microsoft, WA, USA).
Results
RNA-Seq and de novo transcriptome assembly
To comprehensively generate the transcriptome and obtain insights into the molecular mecha-
nisms involved in the resistance of sweet potato to Fusarium wilt, the total RNA from the
stems of the highly resistant cultivar JS57 and highly susceptible cultivar XZH was isolated.
The RNAs were equally mixed to create an RNA pool for the cDNA library, and a database of
the sweet potato stem transcriptome was then generated through Illumina HiSeqTM 2500
sequencing. The deep sequencing produced 91,366,006 sequence reads with a length of 100 bp
each and an average GC content of 45.10%. After removing adaptors, primer sequences, poly-
A tails and short and low-quality sequences, 89,944,188 (98.44%, 11.24 Gbp) high-quality
reads with Q20 were retained and used for the assembly.
Due to the absence of a sequenced genome, all trimmed and cleaned reads were aligned
and assembled using Trinity [29], yielding a set of 146,859 transcript sequences that were lon-
ger than 201 bp with an N50 length of 1371 bp and 101,988 unigenes with an average length of
666 bp and an N50 length of 1079 bp. The length of the assembled unigenes varied from 201 to

Table 2. Frequency of the length distribution of the assembled transcripts and unigenes.
Transcript length interval 200–500 bp 500–1 kb 1–2 kb >2 kb Total
Number of transcripts 78031 30741 25195 12892 146859
Number of unigenes 64695 18719 12437 6137 101988
15,576 bp, and more than 36.6% of these unigenes were longer than 501 bp, consistent with
previously reported transcriptome data from sweet potato (Tables 2 and 3, Fig 1) [24, 30, 31].
The lack of a reference sweet potato genome sequence is a barrier to identifying candidate
genes involved in disease resistance. The overview of the gene expression profile of sweet
potato challenged with Fob obtained in this study offers abundant sequence data for identify-
ing candidate genes associated with defense against Fusarium wilt.
Functional annotation
To annotate the obtained unigenes, we performed a BLASTX search against the NR NCBI pro-
tein databases with a cutoff E-value of 10−5 based on sequence similarity. In total, 62,605 uni-
genes were detected (Table 4) that had good comparability with known gene sequences in at
least one database, corresponding to approximately 61.38% of the total unigenes; 8,683
(8.51%) unigenes were annotated in all databases, including NR, NCBI non-redundant nucleo-
tide sequences (NT), KO, Swiss-Prot, Protein Family (PFAM), Gene Ontology (GO) and
Eukaryotic Ortholog Groups (KOG). As shown in Fig 2, the species that provided the best
BLASTX matches (first hit) was Nicotiana tomentosiformis (19.1%), with more than 10,000
genes having high homology, followed by Solanum lycopersicum, Naegleria gruberi, Coffea
canephora and Solanum tuberosum. However, more than half of the unigenes matched other
species.
GO and KOG classifications

GO classifications offer an ontology of defined terms representing the properties of gene prod-
ucts [18]. According to the results of a BLASTX search against the NR protein database, 40,918
genes (40.1%) were assigned to at least one GO term and were categorized into 46 classes. To
better review the GO classifications involving these genes, each GO term was further clustered
into its parent term. Ultimately, the classes were clustered into 45 functional groups and three
major classifications (Fig 3), and the term “binding” (GO: 0005488) in molecular function rep-
resented the largest group (23,444 unigenes), followed by “cellular process” (GO: 0009987) in
biological process (23,339 unigenes), “metabolic process” (GO: 0008152) in biological process
(23,146 unigenes), and “catalytic” (GO: 0003824) in molecular function (19,536). The smallest
groups included the terms “hormone secretion” (GO: 0046879) in biological process (2), “sym-
plast” (GO: 0055044) in cellular component (5), “nucleoid” (GO: 0009295) in cellular compo-
nent (7) and “synapse” (GO: 0045202) in cellular component (11) (Fig 3).
A phylogenetic classification was performed using COG databases to classify the potential
functions. In total, 22,613 genes were aligned to 26 functional classes (Fig 4). The two largest
cluster groups were “general function prediction only” (3,374, 14.9%) and “posttranslational
Table 3. Length distribution of the assembled transcripts and unigenes.

Min Length Mean Length Median Length Max Length N50 N90 Total Nucleotides
Transcripts 201 812 459 15576 1371 314 119187574
Unigenes 201 666 367 15576 1079 267 67942174

Fig 1. Length distribution of the assembled transcripts and unigenes in sweet potato. The horizontal axis represents the length
intervals of the transcripts and unigenes, and the vertical axis represents the number of transcripts and unigenes.
https://doi.org/10.1371/journal.pone.0187838.g001
modification, protein turnover, chaperones” (3,299, 14.6%). Interestingly, 122 genes were
aligned to the “defense mechanisms” cluster, which is helpful for understanding the mecha-
nisms of resistance to Fusarium wilt in sweet potato.
KEGG pathway mapping

The KEGG database is widely used as a reference database of pathway networks for the inte-
gration and interpretation of large-scale datasets generated using high-throughput sequencing
technology and is helpful for obtaining a better understanding of the functions of genes that
are up- or down-regulated in response to the Fusarium wilt pathogen [18]. A BLASTX search

Table 4. Statistics of unigenesannotated in public databases.

Search item Number of unigenes Percentage
(%)
Annotated in NR 56,362 55.26
Annotated in NT 32,361 31.73
Annotated in KO 19,578 19.19
Annotated in Swiss-Prot 38,491 37.74
Annotated in PFAM 38,592 37.83
Annotated in GO 40,918 40.12
Annotated in KOG 22,613 22.17
Annotated in all databases 8,683 8.51
Annotated in at least one database 62,605 61.38
Total unigenes 101,988 100
against the KEGG protein database was performed using a cutoff E-value of e-5. In total,
19,578 distinct gene sequences were assigned to 276 KEGG pathways. The pathways most rep-
resented by unique sequences included translation (2,560 genes), signal transduction (2,089
genes) and carbohydrate metabolism (1,963 genes) (Fig 5). The KEGG annotations reveal the
specific enrichment of pathways and the mechanisms involved in the response to Fob infection
in sweet potato.
Gene expression profile of sweet potato in response to Fob

The library was prepared using 3 μg of RNA from each sample, and sequencing was performed
on an Illumina HiSeq 2500 platform. The number of unambiguous tags in each library was
normalized to the expected number of fragments per kilobase of transcript per million base
pairs sequenced (FPKM), and the differentially expressed genes were then compared between
different libraries. The DESeq R package (1.10.1) was used to analyze the differential expres-
sion between two groups using samples with three biological replicates [32]. DESeq provides a
statistical approach for determining differential expression of digital gene expression data
using a model based on the negative binomial distribution. Genes with an adjusted P-value
<0.05 were considered differentially expressed.
A comparison of the differentially expressed genes between the libraries revealed that many
genes were up- or down-regulated in both sweet potato cultivars after inoculation with Fob.
Notably, the number of up-regulated genes was higher than the number of down-regulated
genes. In the JS57 cultivar, the expression of 6,454 genes was affected by F07 inoculation
(JS57-F07 library); of these genes, 3,843 and 2,611 were up-regulated and down-regulated,
respectively, compared with the control (JS57-CK library). In the XZH cultivar, the expression
of 6,826 genes was affected by inoculation with F07 (XZH-F07 library); of these genes, 5,552
and 1,274 genes were up-regulated and down-regulated, respectively, compared with the con-
trol (XZH-CK).
Experimental validation by qRT-PCR

To confirm the reliability of the Illumina Solexa sequencing data and the differential DGE
results, five unigenes were selected for quantitative RT-PCR assays: c47391-g1, c51550-g2,
c52297-g1, c54420-g2 and c56184-g1. The results revealed the same expression tendency
observed in the DGE analysis in both cultivars (Fig 6). qRT-PCR indicated that c52297-g1,
c51550-g2, c54420-g2 and c56184-g1 were up-regulated by 4.88-, 2.30-, 3.85- and 2.12-fold

Fig 2. Species distribution of the BLASTX matches of the transcriptome unigenes. This figure shows the
species distribution of the unigene BLASTX matches against the NR protein database (cutoff E-value of E<10−5) and
the proportions of each species.
Fig 3. Histogram of GO classifications. The percentages indicate the proportion of unigenes with the GO annotations.

Fig 4. Histogram of the COG classification in sweet potato. The horizontal axis represents the names of the COGs, and the
vertical axis represents the proportion of the group of the total number. In total, 22,613 sequences had COG classifications
across 25 categories.

Fig 5. Histogram of KEGG clusters in sweet potato.

after infection with Fob, respectively, whereas these were found to be up-regulation by 1.40-,
1.62-, 1.71- and 3.1-fold according to the DGE results, respectively. The unigene c47391-g1
was down-regulated 33.19-fold according to the qRT-PCR results but by 1.93-fold according
to the DGE results.
Identification of related genes involved in the defense response

We identified a set of differentially expressed genes involved in the defense response by com-
paring the commonalities and differences in the libraries of the highly resistant and highly sus-
ceptible cultivars upon Fob infection. These genes, include chitin elicitor receptor kinase 1
(CERK), mitogen-activated protein kinase (MAPK), WRKY, NAC, MYB, and ethylene-

Fig 6. qRT-PCR validation of the Fob-induced fold-changes detected using RNA-Seq. Standard error
bars are shown for the fold-changes determined by qRT-PCR.
responsive transcription factor (ERF), as well as resistance (R) genes, pathogenesis-related

(PR) genes and genes involved in the salicylic acid (SA) and jasmonic acid (JA) signaling path-
ways, and the total number of defense-related genes and the differentially expressed genes are
shown in Table 5.
CERK 1 genes. CERk1 is a PRR in host plants that plays a crucial role in chitin perception
in the immune response against fungal pathogens [33]. We identified two differentially expressed
CERK1 genes (Table 6): c60044-g1 (putative CERK1-like) and c62516-g1 (putative CERK1).
c60044-g1 was up-regulated in both JS57-F07 and XZH-F07. Interestingly, c62516-g1 was
down-regulated in the highly resistant cultivar JS57-F07, suggesting a complicated interaction
between sweet potato and Fob.
MAPK signaling genes. MAPK signaling cascades comprise an MAP kinase kinase kinase
(MPKKK), an MAP kinase kinase (MPKK or MAP2K), and an MAP kinase(MPK) that are
Table 5. Number of defense-related and differentially expressed genes identified in the response to Fob infection.
Related genes Gene numbers involved Significant differential expression Ratio of differentially expressed genes to total (%)
CERK 1 5 2 40.0
MAPK 66 6 9.1
JA signaling 14 2 14.3
SA signaling 25 4 16.0
ERF 40 14 35.0
WRKY 123 8 6.5
NAC 20 2 10.0
MYB 22 1 4.5
R genes 94 3 3.2
PR genes 57 7 12.3

transduced from the receptor to downstream targets as a signal to sequentially activate the
expression of defense-related genes [34]. We identified 66 MAPK-related genes, of which six
were differentially expressed. MAPKs have attracted much attention because these genes are
involved in the induction and coordination of hormone-dependent and hormone-indepen-
dent plant responses against necrotrophic fungal pathogens [34].
Genes associated with the SA and JA signaling pathways. The plant hormones SA and
JA are major defensive players in the regulation of signaling networks underlying resistance to
pathogens [35]. SA plays an extensive signaling role in plants, particularly in the defense
against biotrophic/hemibiotrophic pathogens, by inducing cell death, activating the expression
of defense-related genes, and provoking systemic acquired resistance (SAR) [36, 37]. We iden-
tified 20 genes that were associated with the SA pathway (Table 5), and four of these genes
were differentially expressed. Two unigenes, c21763-g1 and c39777-g1, were up-regulated in
XZH-F07, and both were annotated as S-adenosyl-L-methioninesalicylic acid carboxyl methyl-
transferase (SAMT), which has been implicated in disease resistance responses in rice [38].
The unigene c58625-g1 was down-regulated in XZH-F07 and annotated as UDP-glycosyl-
transferase (UDPG), which might influence the accumulation of free SA, leading to changes in
the resistance of the host plant [39].
JA-dependent signaling is effective against necrotrophic pathogens [35], and we identified
two differentially expressed JA metabolism-related genes that were annotated as jasmonic acid
2 and jasmonate O-methyltransferase. These genes might play an important role in defense
against the necrotrophic phase of Fob infection.
WRKY transcription factor genes. In total, 123 WRKY genes were identified. Of these
123 WRKY genes, ten (8.1%) were significantly differentially expressed in at least one compari-
son (Tables 4 and 5). The WRKY transcription factors belong to a large family of transcrip-
tional regulators that are almost exclusively expressed in plants. These transcription factors
have diverse biological functions and play important roles in the defense response and hor-
mone-controlled processes by acting as transcriptional activators or repressors that regulate
major changes in plants during the early phases of root colonization with fungi [40–42].
Five unigenes (c54420-g2, c56135-g1, c57247-g1, c60589-g1, and c64728-g1) were exclu-
sively up-regulated in XZH-F07 and were identified as putative WRKY61, WRKY75, WRKY
22, WRKY71 and WRKY6, respectively, all of which are related to the defense response. In
Arabidopsis, the WRKY61 gene plays a role in reducing the symptom severity of turnip crinkle
virus disease and is associated with plant immunity pathways [43]. WRKY 75 plays a role in
decreasing the severity of bacterial soft rot disease and activates a subset of defense-related
genes in Chinese cabbage, similar to Arabidopsis [44]. WRKY22, WRKY71 and WRKY6 are all
involved in rice defense responses. WRKY22 also plays a role in the resistance response to
blast [45], and WRKY 71 functions as a transcriptional regulator upstream of OsNPR1 and
OsPR1b in defense signaling pathways [46]. WRKY6 positively regulates defense responses by
increasing SA concentrations through activation of the SA biosynthesis-related gene OsICS1
[47]. The unigene c46250-g1 was annotated as putative WRKY56 and was exclusively down-
regulated in XZH-F07; however, the function of the WRKY56 gene remains unclear. The uni-
gene c50623-g1 was annotated as a putative WRKY48-like gene, and its expression level was
significantly lower in JS57-CK than in XZH-CK. WRKY48 was identified as a negative regula-
tor of PR gene expression and basal resistance against the bacterial pathogen P. syringae in
Arabidopsis [48]. The unigene c33599-g2 was annotated as a putative WRKY gene because its
coding protein contains a WRKY-binding domain, and the expression level of WRKY in
JS57-F07 was 3.4-fold higher than that in ZXH-F07, indicating an important role in the
defense response.

Table 6. Differentially expressed genes involved in the defense response against Fob infection.
Gene ID Blast annotation JS57-F07 vs JS57-CK XZH-F07 vs XZH-CK
CERK c60044-g1 CERK1 [A. thaliana] 3.2 1.4
c62516-g1 CERK1-like [N. tomentosiformis] -4.1
MAPK c51382-g1 Wound-induced MAPK [N. glutinosa] 0.9
c54598-g1 MAPK 20 isoform X1 [N. tomentosiformis] 0.7
c58290-g1 MAPK [I. batatas] 1.3
c58750-g5 MAPK 9 [N. tomentosiformis] 0.8 1.1
c65078-g2 MAPK 6 isoform X1 [N. tomentosiformis] -1.2
c66053-g1 Receptor protein kinase [R. communis] -1.8
JA signaling c43470-g1 Jasmonic acid 2 [S. lycopersicum] 3.0
c52478-g1 Jasmonate O-methyltransferase [B. rapa] -0.9
SA signaling c56489-g2 Salicylic acid-binding protein 2 [N. benthamiana] -1.3
c57992-g1 Salicylic acid-binding protein 2-like [N. tomentosiformis] -3.2
c58625-g1 UDP-glycosyltransferase 74F2-like [N. tomentosiformis] -2.0
c65549-g1 UDP-glycosyltransferase 74F2-like [N. tomentosiformis] 1.3 -0.7
ERF c33996-g1 Ethylene-responsive-element-binding protein [S. lycopersicum] 2.6
c45744-g1 Ethylene response factor 3 [S. lycopersicum] 0.8
c51416-g2 Ethylene response factor 4 [S. lycopersicum] 1.2
c52634-g1 Ethylene response factor 2 [N. tomentosiformis] 1.3
c53488-g1 Ethylene response factor 13 [A. thaliana] 1.2 0.9
c55705-g1 Ethylene response 2 [A. thaliana] 2.2
c57791-g1 Ethylene-responsive factor [C. chinense] 3.6 0.6
c58358-g1 Ethylene response factor 13 [C. arabica] 1.9
c58425-g1 Ethylene receptor homolog [N. tabacum] 2.0
c60985-g1 Ethylene-responsive transcription factor ERF027 [A. thaliana] 1.6
c61066-g1 Ethylene-responsive-element-binding factor 5 [P. hybrida] -1.0
c61066-g2 Ethylene response factor 14 [A. deliciosa] 2.6
c64410-g1 Ethylene response factor 1 [I. batatas] 0.7
c65518-g1 Ethylene-insensitive protein 3 [N. tabacum] 0.7 0.5
WRKY c54420-g2 WRKY61 [N. tomentosiformis] 1.7
c56135-g1 WRKY75 [N. tomentosiformis] 1.6
c57247-g1 WRKY22 [C. roseus] 1.8 1.6
c60589-g1 WRKY71 [A. thaliana] 1.3
c64728-g1 WRKY6 [A. thaliana] 1.1
c46250-g1 WRKY56 [A. thaliana] -2.1
c50623-g1 WRKY48-like [S. tuberosum] -1.4
c33599-g2 Protein containing a WRKY-binding domain 3.4
NAC c51550-g2 NAC29 [A. thaliana] 2.1
c52292-g3 NAC7-like [M. acuminata] -3.7
MYB c5221-g1 Ipomoea batatas IbMYB1-2b 4.6
PR protein c35430-g1 PR-1 type-like [P. dactylifera] 2.1
c40413-g1 PR class 4 [Prunus dulcis] 3.5
c42566-g1 PR-4 [P. mume] 3.2
c47344-g1 PR-4A-like isoform X1 [C. arietinum] -1.5
c54564-g1 PR-1 [N. tomentosiformis] -1.5
c55964-g1 PR-10 [N. benthamiana] 5.9 2.6
c58341-g1 PR-1 type-like [P. dactylifera] 0.8
(Continued)

Table 6. (Continued)
Gene ID Blast annotation JS57-F07 vs JS57-CK XZH-F07 vs XZH-CK

R gene c56584-g1 NBS-coding resistance protein [A. thaliana] 9.8
c66373-g2 Late blight resistance protein homolog R1B-14 [N. tomentosiformis] -1.8
c56383-g1 Resistance gene analog [I. batatas] 2.4
Note: Significant differences (FDR0.001) in relative levels and |log2.Fold-change|1 are shown in boldface. FDR, false discovery rate. log2.Fold-change,
log2-fold-changes using the ratio base 2 logarithm.INF, the adjusted read count of the gene was 0 in the control sample.
NAC transcription factor genes. NAC transcription factors are a large family of tran-
scriptional regulators that play crucial roles in plant immune responses, basal defense, and
SAR [49]. We identified 20 NAC transcription factor genes, and only two (10%) of these genes
were significantly differentially expressed in at least one comparison (Table 5). The unigene
c51550-g2 was annotated AS NAC29, and its expression level increased in XZH-F07. NAC29
plays important roles in senescence processes and responses to salt and drought stresses in
wheat [50]; however, there are no studies of the function of this gene in disease resistance. The
other unigene, c52292-g3, was annotated as a NAC7-like gene, and its expression level was
3.7-fold lower in JS57-CK than in XZH-CK, indicating that this gene is also a negative regula-
tor of the defense response.
ERF genes. ERFs are responsible for generating tolerance to stress in plants. Most ERFs
are transcriptional activators, although some act as transcriptional repressors [51]. We identi-
fied 40 ERFs, of which 14 were differentially expressed. These were all up-regulated, except
forc61066-g1 (putative ERF 5), indicating that most ERFs are activated in response to Fob
invasion. The gene c61066-g1 was annotated as ERF5 and was down-regulated in XZH-F07,
indicating that this gene may be a negative regulator of disease resistance in sweet potato. This
finding is consistent with results in Arabidopsis indicating that ERF5 negatively regulates chitin
signaling and plant defense against the fungal pathogen Alternaria brassicicola [52].
MYB transcription factor genes. The transcription factor MYB family of proteins is large
and functionally diverse in all eukaryotes and plays crucial roles in the interaction of regulatory
networks that control development, metabolism and the response to biotic or abiotic stresses
[53]. The unigene c5221-g1 was annotated as IbMYB1 and was expressed at a 4.6-fold higher
level in Js57-CK than in XZH-CK, indicating its important potential function in the defense
response. In sweet potato, MYB1 (IbMYB1) stimulates the accumulation of anthocyanin pig-
mentation in the tuberous roots of sweet potato and the leaves of tobacco and arabidopsis [54–
56]. IbMYB1 also improves tolerance and enhances secondary metabolism in transgenic pota-
toes [57].
PR genes. PR proteins are induced in plants upon attack by various pathogens and
stresses and perform diverse functions, including plant defense, disease resistance, and anti-
fungal activity [58]. PR proteins play important roles in hypersensitive responses and most
likely contribute to SAR [59]. We identified 57 PR genes, of which seven were differentially
expressed in at least one comparison and were annotated as PR-1-, PR-4- and PR-10-type pro-
teins (Table 5). PR-1-type proteins appear to be hallmarks of activation of the hypersensitive
response and SA-dependent SAR pathways [60]. The PR-4 protein is one of the less well-stud-
ied of the 17 PR protein groups and is considered an endochitinase with chitinase activity [61]
and a bifunctional enzyme with both RNase and DNase activities [62]. We identified three
genes that were annotated as PR-4 type proteins, but further studies are required to better
understand their functions. The gene c55964-g1 was annotated as PR-10 and was up-regulated
5.9-foldin JS57-F07, which is markedly higher than the 2.6-fold increase in expression

observed in XZH-F07, indicating its important function in the defense against Fob in sweet
potato and consistent with its function in peanut [63].
R genes. According to the gene-for-gene hypothesis, R proteins recognize and interact
with effectors and trigger ETI [12]. We identified 94 R genes in the transcriptome, most of
which contain a highly conserved domain characterized by an NBS-LRR structure (data not
shown). However, only three of these genes were differentially expressed (Table 5). Interest-
ingly, the unigene c56584-g1 was identified as a putative NBS-coding R protein that was up-
regulated 9.8-fold in JS57-F07, indicating a crucial role in the defense response.
Discussion
Sweet potato is an important crop worldwide and represents a non-model plant with a large,
complex genome [18]. The lack of a reference genome sequence is a barrier to the identifica-
tion of candidate genes involved in disease resistance. The application of high-throughput
sequencing technology can generate a large amount of transcriptome data, which is helpful for
gaining an understanding of the mechanism of resistance and identifying related genes.
In the present study, we first characterized the transcriptome profile of sweet potato chal-
lenged with Fob. Illumina sequencing generated 89,944,188 clean, high-quality reads that were
assembled into 101,988 unigenes with an average length of 666 bp, and 61.38% of these were
functionally annotated in the NR protein database. Undoubtedly, the results of our study pro-
vide an overview of the gene expression profile of sweet potato challenged with Fob and offer
abundant sequence data for the discovery of candidate genes involved in the resistance to
Fusarium wilt. A large proportion of the unigenes (18,574 unigenes, 18.2%) are longer than 1
kb, facilitating the discovery of defense-related genes.
Many genes were up- and down-regulated in sweet potato when challenged with Fob. A
Venn diagram illustrating the overlap in the differentially expressed genes in the comparisons
of JS57-F07 with JS57-CK and XZH-F07 with XZH-CK is shown in Fig 7. There were more
up-regulated than down-regulated genes, with 5,552 up-regulated and 1,274 down-regulated
genes in XZH and 3,843 up-regulated and 2,611 down-regulated genes in JS57. In contrast, in
banana infected with Foc TR4, the numbers of up-regulated and down-regulated genes were
almost the same [64]. In the two comparisons, 2,438 overlapping differentially expressed up-
regulated genes were identified, accounting for 43.91% (2438/5552) and 63.44% (2438/3843)
Fig 7. Venn diagram showing overlapping differentially expressed genes in the comparisons of JS57-F07 with
JS57-CK and XZH-F07 with XZH-CK.

in each comparison. However, only 290 differentially expressed down-regulated genes were
detected, accounting for 11.10% (290/2611) and 22.76% (290/1274) in each comparison.
Plants thrive in certain environments and are continuously challenged by various forms of
biotic stresses; thus, plants have evolved sophisticated mechanisms to sense biotic aggressors,
activate complex phytohormones signaling networks, stimulate plant immune system
responses, and regulate the expression of defense-related genes [34]. We identified a set of
defense-related genes, including transcription factors, PR genes, R genes, and genes involved
in the SA and JA signaling pathways, in the transcriptome.
PAMPs of fungal pathogens, such as chitin, chitosan and endopolygalacturonase, are per-
ceived by PRRs in host plants and activate PTI [34]. CERK1 is an important PRR that plays a
crucial role in chitin perception in Arabidopsis thaliana in the immune response against fungal
pathogens [33]. We identified two CERK1 genes that were differentially expressed in the exam-
ined libraries. Intriguingly, c62516-g1 (putative CERK1-like) was down-regulated 4.1-fold in
JS57-F07, indicating that effectors of Fob might suppress the expression of c62516-g1 during
colonization, thereby restraining PTI in host plants. However, because JS57 is highly resistant
to Fob, this plant must have R genes that recognize the effector and trigger ETI to activate
defense responses.
The recognition of pathogens by PRRs in plants triggers MAPK cascades and activates SA,
JA or ET signaling pathways, facilitating the mounting of defense responses against invading
pathogens and inducing the expression of numerous defense-related genes [34]. SA plays a
crucial role in plant-pathogen interactions by activating defense responses and is also involved
in inducing SAR [65]. SA activates plant immune responses against biotrophic pathogens,
whereas JA activates plant immune responses against necrotrophic pathogens [35]. The JA
and SA signaling pathways might interact antagonistically [66] or positively [67]. The crosstalk
between SA and JA is controlled by a novel function of cytosolic NPR1 [68] and WRKY tran-
scription factors [69]. As a hemibiotrophic pathogen, the lifestyle of Fob includes an initial bio-
trophic phase (host cell remains alive) and a necrotrophic phase (host tissue is killed) [70]. The
crosstalk between the JA and SA signaling pathways might be more complicated in sweet
potato during Fob invasion, and further research is required to better understand the interac-
tions during signal transduction.
Effectors enable pathogens to overcome PTI in host plants, and these factors can be recog-
nized by the corresponding R genes of the host plants, leading to ETI [11]. R proteins play a
pivotal role in inducing ETI responses. Most R genes encode NB-LRR proteins [11]. We iden-
tified 94 R genes in the transcriptome, and three of these genes were differentially expressed.
Interestingly, c56584-g1 (putative NBS-coding resistance protein) was up-regulated 9.8-fold in
JS57-F07, indicating its important role in defense responses against Fob. Cloning of the R gene
from sweet potato and the effector gene from Fob and further studies of the interaction
between these genes are required to elucidate the defense mechanism of sweet potato.
Conclusions
In the present study, we de novo constructed and characterized the transcriptomes of sweet
potato challenged with Fob and identified 101,988 unigenes, generating a broad survey of
genes involved in disease resistance. We performed DGE profiling analyses of sweet potato
challenged with Fob and calculated the numbers of differentially expressed genes between
libraries, identifying several up- and down-regulated genes. A set of candidate genes in sweet
potato involved in the disease response to Fusarium wilt were identified, including WRKY and
NAC transcription factors, R genes, PR genes and SA pathway-related genes. Some of these
genes, such as c56584-g1 (putative R gene) and c55964-g1 (putative PR-10), were significantly

up-regulated and implicated in the defense response against Fob. These data provide an under-
standing of the molecular mechanisms of disease resistance. This sequence resource will be
valuable for genetic and genomic studies and will accelerate breeding programs for sweet
potato with Fusarium wilt resistance.
Author Contributions
Conceptualization: Yuli Lin, Xuanyang Chen.
Data curation: Yuli Lin, Shiqiang Lin, Haizhou Chen, Songliang Wang, Xuanyang Chen.
Formal analysis: Yuli Lin, Weikun Zou, Shiqiang Lin, Dennis Onofua, Zhijian Yang, Xua-
nyang Chen.
Investigation: Yuli Lin, Weikun Zou, Dennis Onofua, Zhijian Yang, Haizhou Chen.
Project administration: Xuanyang Chen.
Supervision: Xuanyang Chen.
Validation: Weikun Zou, Shiqiang Lin, Xuanyang Chen.
Writing – original draft: Yuli Lin.
References
1. Afuape SO, Nwankwo IIM, Omodamiro RM, Echendu TNC, Toure A. Studies on some important con-
sumer and processing traits for breeding sweet potato for varied end-uses. American Journal of Experi-
mental Agriculture. 2014; 4(1):114–24. https://doi.org/10.9734/AJEA/2014/5827
2. FAOSTAT. Food and Agricultural Organization of the United Nations Crop Production Figures for
Sweetpotato, released by FAO Statistics Division, June,18, 2016. Food and agriculture organization of
the united nations statistics division. 2014.
3. Fravel D, Olivain C, Alabouvette C. Fusarium oxysporum and its biocontrol. New Phytologist. 2003; 157
(3):10. https://doi.org/10.1046/j.1469-8137.2003.00700.x
4. Fang S, Chen Y, Guo X. Identifying and screening sweet potato varieties resistance to bacterial wilt and
fusarium wilt diseases. Journal of Plant Genetic Resources. 2001; 2(1):37–9.
5. Clark CA, Hyun JW, Hoy MW. Relationships among wilt-inducing isolates of Fusarium oxysporum from
sweetpotato and tobacco. Plant Disease. 1998; 82(5):530–6. https://doi.org/10.1094/PDIS.1998.82.5.
530
6. Fang S, Chen F, Xu M, Lin W. A preliminary study on inheritance of fusarium wilt resistance of sweet
potato cultivars. Journal of Fujian Agricultural University. 1997; 26(4):446–8.
7. Lei J, Yang XS, Guo WW, Wen-Jin SU, Wang LJ. Advances in Research on Sweet Potato Fusarium
Wilt. Hubei Agricultural Sciences. 2011; 50(23):4775–7.
8. Pei Y, Zeng F, Peng J, Long H, Guo J. Advances in Fusarium Wilt Disease and the Mechanism of Inter-
action Between Fusarium and Its Host. Journal of Tropical Biology. 2014; 5(1):92–100.
9. Yin X, Xu B, Zheng W, Zeng H, Ma W, Wang J, et al. Histological observation of banana root infected by
Fusarium oxysporum f.sp.cubense. Acta Phytopathologica Sinica. 2011; 41(6):570–5.
10. Stahl EA, Bishop JG. Plant-pathogen arms races at the molecular level. Current Opinion in Plant Biol-
ogy. 2000; 3(4):299–304. PMID: 10873849
11. Jones JD, Dangl JL. The plant immune system. Nature. 2006; 444(7117):323–9. https://doi.org/10.
1038/nature05286 PMID: 17108957
12. Thatcher LF, Gardiner DM, Kazan K, Manners JM. A highly conserved effector in Fusarium oxysporum
is required for full virulence on Arabidopsis. Molecular Plant-Microbe Interactions. 2011; 25(2):180–90.
https://doi.org/10.1094/MPMI-08-11-0212 PMID: 21942452
13. Frank T, Martijn R. The arms race between tomato and Fusarium oxysporum. Molecular Plant Pathol-
ogy. 2010; 11(2):309–14. https://doi.org/10.1111/j.1364-3703.2009.00605.x PMID: 20447279
14. Saucet SB, Ma Y, Sarris PF, Furzer OJ, Sohn KH, Jones JD. Two linked pairs of Arabidopsis TNL resis-
tance genes independently confer recognition of bacterial effector AvrRps4. Nature Communications.
2015; 6. https://doi.org/10.1038/ncomms7338 PMID: 25744164

15. Imam J, Alam S, Mandal NP, Variar M, Shukla P. Molecular screening for identification of blast resis-
tance genes in North East and Eastern Indian rice germplasm (Oryza sativa L.) with PCR based mak-
ers. Euphytica. 2014; 196(2):199–211. https://doi.org/10.1007/s10681-013-1024-x
16. Parmar P, Subramanian RB. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato cultivar
Heamsona. 2013; 16: 6076–8. https://doi.org/10.5897/AJB2013.12194
17. Tameling WI, Elzinga SD, Darmin PS, Vossen JH, Takken FL, Haring MA, et al. The tomato R gene
products I-2 and MI-1 are functional ATP binding proteins with ATPase activity. Plant Cell. 2002; 14
(11):2929–39. https://doi.org/10.1105/tpc.005793 PMID: 12417711
18. Xie F, Burklew CE, Yang Y, Liu M, Xiao P, Zhang B, et al. De novo sequencing and a comprehensive
analysis of purple sweet potato (Impomoea batatas L.) transcriptome. Planta. 2012; 236(1):101–13.
https://doi.org/10.1007/s00425-012-1591-4 PMID: 22270559
19. Xiao J, Jin X, Jia X, Wang H, Cao A, Zhao W, et al. Transcriptome-based discovery of pathways and
genes related to resistance against Fusarium head blight in wheat landrace Wangshuibai. Bmc Geno-
mics. 2013; 14(1):1–19. https://doi.org/10.1186/1471-2164-14-197 PMID: 23514540
20. Li C, Shao J, Wang Y, Li W, Guo D, Yan B, et al. Analysis of banana transcriptome and global gene
expression profiles in banana roots in response to infection by race 1 and tropical race 4 of Fusarium
oxysporum f. sp. cubense. Bmc Genomics. 2013; 14(6):1–16. https://doi.org/10.1186/1471-2164-14-
851 PMID: 24304681
21. Firon N, Labonte D, Villordon A, Kfir Y, Solis J, Lapis E, et al. Transcriptional profiling of sweetpotato
(Ipomoea batatas) roots indicates down-regulation of lignin biosynthesis and up-regulation of starch bio-
synthesis at an early stage of storage root formation. Bmc Genomics. 2013; 14(1):1–25. https://doi.org/
10.1186/1471-2164-14-460 PMID: 23834507
22. Roland S, Luz RT, Omar P, Genoveva R, Ronald FR, Rocio A, et al. A sweetpotato gene index estab-
lished by de novo assembly of pyrosequencing and Sanger sequences and mining for gene-based
microsatellite markers. BMC Genomics. 2010; 11:604. https://doi.org/10.1186/1471-2164-11-604
PMID: 20977749
23. Wang Z, Li J, Luo Z, Huang L, Chen X, Fang B, et al. Characterization and development of EST-derived
SSR markers in cultivated sweetpotato (Ipomoea batatas). Bmc Plant Biology. 2011; 11(5):1–9. https://
doi.org/10.1186/1471-2229-11-139 PMID: 22011271
24. Wang Z, Fang B, Chen X, Liao M, Chen J, Zhang X, et al. Temporal patterns of gene expression associ-
ated with tuberous root formation and development in sweetpotato (Ipomoea batatas). Bmc Plant Biol-
ogy. 2015; 15(1):1–13. https://doi.org/10.1186/s12870-015-0567-5 PMID: 26174091
25. Haas BJ, Papanicolaou A, Yassour M, Grabherr M, Blood PD, Bowden J, et al. De novo transcript
sequence reconstruction from RNA-Seq: reference generation and analysis with Trinity. Nature Proto-
cols. 2013; 8(8):1494–512. https://doi.org/10.1038/nprot.2013.084 PMID: 23845962
26. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, et al. Full-length transcriptome
assembly from RNA-Seq data without a reference genome. Nature Biotechnology. 2011; 29(7):644–52.
https://doi.org/10.1038/nbt.1883 PMID: 21572440
27. Götz S, Garcı́agómez JM, Terol J, Williams TD, Nagaraj SH, Nueda MJ, et al. High-throughput func-
tional annotation and data mining with the Blast2GO suite. Nucleic Acids Research. 2008; 36
(10):3420–35. https://doi.org/10.1093/nar/gkn176 PMID: 18445632
28. Park SC, Kim YH, Ji CY, Park S, Jeong JC, Lee HS, et al. Stable Internal Reference Genes for the Nor-
malization of Real-Time PCR in Different Sweetpotato Cultivars Subjected to Abiotic Stress Conditions.
Plos One. 2012; 7(12). https://doi.org/10.1371/journal.pone.0051502 PMID: 23251557
29. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, et al. Trinity: reconstructing a full-
length transcriptome without a genome from RNA-Seq data. Nature Biotechnology. 2013; 29(7):644–
52. https://doi.org/10.1038/nbt.1883
30. Foroud NA, Ouellet T, Laroche A, Oosterveen B, Jordan MC, Ellis BE, et al. Differential transcriptome
analyses of three wheat genotypes reveal different host response pathways associated with Fusarium
head blight and trichothecene resistance. Plant Pathology. 2012; 61(2):296–314. https://doi.org/10.
1111/j.1365-3059.2011.02512.x
31. Li R, Zhai H, Kang C, Liu D, He S, Liu Q. De Novo Transcriptome Sequencing of the Orange-Fleshed
Sweet Potato and Analysis of Differentially Expressed Genes Related to Carotenoid Biosynthesis. Inter-
national Journal of Genomics. 2015; 2015(13):1–10. https://doi.org/10.1155/2015/843802 PMID:
26649293
32. Anders S, Huber W. Differential expression analysis for sequence count data. Genome Biology. 2010;
11(10):1–12.
33. Wan J, Zhang XC, Neece D, Ramonell KM, Clough S, Kim SY, et al. A LysM Receptor-like Kinase
Plays a Critical Role in Chitin Signaling and Fungal Resistance in Arabidopsis. 2008; 20(2):471–81.
https://doi.org/10.1105/tpc.107.056754 PMID: 18263776

34. Pandey D, Gaur M, Sajeesh PK, Kumar A. Plant Defense Signaling and Responses Against Necro-
trophic Fungal Pathogens. Journal of Plant Growth Regulation. 2016:1–16. https://doi.org/10.1007/
s00344-016-9600-7
35. Yang YX, Ahammed GJ, Wu C, Fan SY, Zhou YH. Crosstalk among Jasmonate, Salicylate and Ethyl-
ene Signaling Pathways in Plant Disease and Immune Responses. Current Protein & Peptide Science.
2015; 16(5):450–61. https://doi.org/10.2174/1389203716666150330141638
36. Vlot AC, Dempsey DA, Klessig DF. Salicylic Acid, a Multifaceted Hormone to Combat Disease. Annual
Review of Phytopathology. 2009; 47:177–206. https://doi.org/10.1146/annurev.phyto.050908.135202
PMID: 19400653
37. Lemarié S, Robert-Seilaniantz A, Lariagon C, Lemoine J, Marnet N, Jubault M, et al. Both the Jasmonic
Acid and the Salicylic Acid Pathways Contribute to Resistance to the Biotrophic Clubroot Agent Plasmo-
diophora brassicae in Arabidopsis. Plant & Cell Physiology. 2015; 56(11). https://doi.org/10.1093/pcp/
pcv127 PMID: 26363358
38. Xu R, Song F, Zheng Z. OsBISAMT1, a gene encoding S-adenosyl-L-methionine:salicylic acid carboxyl
methyltransferase, is differentially expressed in rice defense responses. Molecular Biology Reports.
2006; 33(3):223–31. https://doi.org/10.1007/s11033-005-4823-x PMID: 16850192
39. Boachon B, Gamir J, Pastor V, Erb M, Dean JV, Flors V, et al. Role of two UDP-Glycosyltransferases
from the F group of Arabidopsis in resistance against Pseudomonas syringae. European Journal of
Plant Pathology. 2014; 139(4):707–20. https://doi.org/10.1007/s10658-014-0424-7
40. Bakshi M, Oelmüller R. WRKY transcription factors: Jack of many trades in plants. Plant Signaling &
Behavior. 2014; 9(1):e27700–e. https://doi.org/10.4161/psb.27700 PMID: 24492469
41. Jimmy JL, Babu S. Role of OsWRKY transcription factors in rice disease resistance. Tropical Plant
Pathology. 2015; 40(6):355–61. https://doi.org/10.1007/s40858-015-0058-0
42. Gallou A, Declerck S, Cranenbrouck S. Transcriptional regulation of defence genes and involvement of
the WRKY transcription factor in arbuscular mycorrhizal potato root colonization. Functional & Integra-
tive Genomics. 2012; 12(1):183–98. https://doi.org/10.1007/s10142-011-0241-4 PMID: 21811781
43. Gao R, Liu P, Yong Y, Sek-Man W. Genome-wide transcriptomic analysis reveals correlation between
higher WRKY61 expression and reduced symptom severity in Turnip crinkle virus infectedArabidopsis
thaliana. Scientific Reports. 2016; 6. https://doi.org/10.1038/srep24604 PMID: 27086702
44. Choi C, Park S, Ahn I, Bae S, Hwang DJ. Generation of Chinese cabbage resistant to bacterial soft rot
by heterologous expression of Arabidopsis WRKY75. Plant Biotechnology Reports. 2016; 10(5):301–7.
https://doi.org/10.1007/s11816-016-0406-7
45. Abbruscato P, Nepusz T, Mizzi L, Corvo MD, Morandini P, Fumasoni I, et al. OsWRKY22, a monocot
WRKY gene, plays a role in the resistance response to blast. Molecular Plant Pathology. 2012; 13
(8):828–41. https://doi.org/10.1111/j.1364-3703.2012.00795.x PMID: 22443363
46. Liu X, Bai X, Wang X, Chu C. OsWRKY71, a rice transcription factor, is involved in rice defense
response. Journal of Plant Physiology. 2007; 164(8):969–79. https://doi.org/10.1016/j.jplph.2006.07.
006 PMID: 16919842
47. Choi C, Hwang SH, Fang IR, † SIK, Sang RP, Ahn I, et al. Molecular characterization of Oryza sativa
WRKY6, which binds to W-box-like element 1 of the Oryza sativa pathogenesis-related (PR) 10a pro-
moter and confers reduced susceptibility to pathogens. New Phytologist. 2015; 208(3):846–59. https://
doi.org/10.1111/nph.13516 PMID: 26083148
48. Xing DH, Lai ZB, Zheng ZY, Vinod KM, Fan BF, Chen ZX. Stress- and Pathogen-Induced Arabidopsis
WRKY48 is a Transcriptional Activator that Represses Plant Basal Defense. Molecular Plant. 2008; 1
(3):459–70. https://doi.org/10.1093/mp/ssn020 PMID: 19825553
49. Nuruzzaman M, Sharoni AM, Kikuchi S. Roles of NAC transcription factors in the regulation of biotic
and abiotic stress responses in plants. Frontiers in Microbiology. 2013; 4(4):248. https://doi.org/10.
3389/fmicb.2013.00248 PMID: 24058359
50. Huang Q, Wang Y, Li B, Chang J, Chen M, Li K, et al. TaNAC29, an NAC transcription factor from
wheat, enhances salt and drought tolerance in transgenic Arabidopsis. BMC Plant Biology. 2015; 15
(1):1–15. https://doi.org/10.1186/s12870-015-0644-9 PMID: 26536863
51. Kamsvågmagnusson T, Thorsellcederberg J, Svanberg A, Von EL, Arvidson J, Mellgren K, et al. Role
of Ethylene Response Transcription Factor (ERF) and Its Regulation in Response to Stress Encoun-
tered by Plants. Plant Molecular Biology Reporter. 2014; 33(3):1–11. https://doi.org/10.1007/s11105-
014-0799-9
52. Son GH, Wan J, Kim HJ, Nguyen XC, Chung WS, Hong JC, et al. Ethylene-responsive element-binding
factor 5, ERF5, is involved in chitin-induced innate immunity response. Molecular Plant-Microbe Interac-
tions. 2012; 25(1):48–60. doi: Ethylene-responsive element-binding factor 5, ERF5, is involved in chitin-
induced innate immunity response. https://doi.org/10.1094/MPMI-06-11-0165 PMID: 21936663

53. Dubos C, Stracke R, Grotewold E, Weisshaar B, Martin C, Lepiniec L. MYB transcription factors in Ara-
bidopsis. Trends in Plant Science. 2010; 15(10):573–81. https://doi.org/10.1016/j.tplants.2010.06.005
PMID: 20674465
54. An CH, Lee KW, Lee SH, Jeong YJ, Woo SG, Chun H, et al. Heterologous expression of IbMYB1a by
different promoters exhibits different patterns of anthocyanin accumulation in tobacco. Plant Physiology
& Biochemistry. 2015; 89:1–10. https://doi.org/10.1016/j.plaphy.2015.02.002 PMID: 25681576
55. Chu H, Jeong JC, Kim WJ, Chung DM, Jeon HK, Ahn YO, et al. Expression of the sweetpotato R2R3-
type IbMYB1a gene induces anthocyanin accumulation in Arabidopsis. Physiologia Plantarum. 2013;
148(2):189–99. https://doi.org/10.1111/j.1399-3054.2012.01706.x PMID: 23039825
56. Park SC, Kim YH, Kim SH, Jeong YJ, Kim CY, Lee JS, et al. Overexpression of the IbMYB1 gene in an
orange-fleshed sweet potato cultivar produces a dual-pigmented transgenic sweet potato with improved
antioxidant activity. Physiologia Plantarum. 2015; 153(4):525–37. https://doi.org/10.1111/ppl.12281
PMID: 25220246
57. Cheng YJ, Kim MD, Deng XP, Kwak SS, Chen W. Enhanced salt stress tolerance in transgenic potato
plants expressing IbMYB1, a sweet potato transcription factor. Journal of Microbiology & Biotechnology.
2013; 23(12):1737–46. https://doi.org/10.4014/jmb.1307.07024 PMID: 24378636
58. Singh R, Tiwari JK, Sharma V, Singh BP, Rawat S, Singh R, et al. Role of Pathogen related protein fam-
ilies in defence mechanism with potential role in applied biotechnology. International Journal of
Advanced Research. 2014; 2:210–26.
59. Loon LCV, Strien EAV. The families of pathogenesis-related proteins, their activities, and comparative
analysis of PR-1 type proteins. Physiological & Molecular Plant Pathology. 2002; 55(2):85–97. https://
doi.org/10.1006/pmpp.1999.0213
60. Lu S, Faris JD, Sherwood R, Friesen TL, Edwards MC. A dimeric PR-1-type pathogenesis-related pro-
tein interacts with ToxA and potentially mediates ToxA-induced necrosis in sensitive wheat. Molecular
Plant Pathology. 2014; 15(7):650. https://doi.org/10.1111/mpp.12122 PMID: 24433289
61. Brunner FA, Fritig B, Legrand M. Substrate specificities of tobacco chitinases. Plant Journal. 2010; 14
(2):225–34. https://doi.org/10.1046/j.1365-313X.1998.00112.x
62. Guevaramorato MA, de Lacoba MG, Garcı́aluque I, Serra MT. Characterization of a pathogenesis-
related protein 4 (PR-4) induced in Capsicum chinense L3 plants with dual RNase and DNase activities.
Journal of Experimental Botany. 2010; 61(12):3259–71. https://doi.org/10.1093/jxb/erq148 PMID:
20511278
63. Chadha P, Das RH. A pathogenesis related protein, AhPR10 from peanut: an insight of its mode of anti-
fungal activity. Planta. 2006; 225(1):213–22. https://doi.org/10.1007/s00425-006-0344-7 PMID:
16832688
64. Wang Z, Zhang JB, Jia CH, Liu JH, Li YQ, Yin XM, et al. De Novo characterization of the banana root
transcriptome and analysis of gene expression under Fusarium oxysporum f. sp. Cubense tropical race
4 infection. Bmc Genomics. 2012; 13(12):1–15. https://doi.org/10.1186/1471-2164-13-650 PMID:
23170772
65. Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, Uknes S, et al. Requirement of salicylic Acid for
the induction of systemic acquired resistance. Science. 1993; 261(5122):754. https://doi.org/10.1126/
science.261.5122.754 PMID: 17757215
66. Grant M, Lamb C. Systemic immunity. Current Opinion in Plant Biology. 2006; 9(4):414–20. https://doi.
org/10.1016/j.pbi.2006.05.013 PMID: 16753329
67. Tamaoki D, Seo S, Yamada S, Kano A, Miyamoto A, Shishido H, et al. Jasmonic acid and salicylic acid
activate a common defense system in rice. Plant Signaling & Behavior. 2013; 8(6):e24260–e. https://
doi.org/10.4161/psb.24260 PMID: 23518581
68. Spoel SH, Koornneef A, Claessens SM, Korzelius JP, Van Pelt JA, Mueller MJ, et al. NPR1 modulates
cross-talk between salicylate- and jasmonate-dependent defense pathways through a novel function in
the cytosol. Plant Cell. 2003; 15(3):760–70. https://doi.org/10.1105/tpc.009159 PMID: 12615947
69. Pieterse CM, Van dDD, Zamioudis C, Leonreyes A, Van Wees SC. Hormonal modulation of plant immu-
nity. Annual Review of Cell & Developmental Biology. 2012; 28(1):489–521. https://doi.org/10.1146/
annurev-cellbio-092910-154055 PMID: 22559264
70. Münch S, Lingner U, Floss DS, Ludwig N, Sauer N, Deising HB. The hemibiotrophic lifestyle of Colleto-
trichum species. Journal of Plant Physiology. 2008; 165(1):41–51. https://doi.org/10.1016/j.jplph.2007.
06.008 PMID: 17765357

Jurnal Aurelia Azalya Sofyan-7a - Compressed

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Jurnal Aurelia Azalya Sofyan-7a - Compressed

Uploaded by

Copyright:

Available Formats

RESEARCH ARTICLE

Transcriptome profiling and digital gene

Citation: Lin Y, Zou W, Lin S, Onofua D, Yang Z,

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 1 / 21

Competing interests: The authors have declared Introduction

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 2 / 21

Materials and methods

Library preparation and transcriptome sequencing

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 3 / 21

Quality control and de novo assembly

Gene functional annotation

Differential expression analysis

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 4 / 21

Table 1. Sequences of primers used in the qRT-PCR analysis.

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 5 / 21

GO and KOG classifications

Table 3. Length distribution of the assembled transcripts and unigenes.

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 6 / 21

KEGG pathway mapping

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 7 / 21

Table 4. Statistics of unigenesannotated in public databases.

Gene expression profile of sweet potato in response to Fob

Experimental validation by qRT-PCR

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 8 / 21

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 9 / 21

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 10 / 21

Fig 5. Histogram of KEGG clusters in sweet potato.

Identification of related genes involved in the defense response

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 11 / 21

responsive transcription factor (ERF), as well as resistance (R) genes, pathogenesis-related

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 12 / 21

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 13 / 21

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 14 / 21

Gene ID Blast annotation JS57-F07 vs JS57-CK XZH-F07 vs XZH-CK

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 15 / 21

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 16 / 21

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 17 / 21

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 18 / 21

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 19 / 21

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 20 / 21

PLOS ONE | https://doi.org/10.1371/journal.pone.0187838 November 13, 2017 21 / 21

You might also like