Professional Documents
Culture Documents
ToMMVPDIS 10 16 1504 RE
ToMMVPDIS 10 16 1504 RE
net/publication/312230831
CITATIONS READS
27 1,805
10 authors, including:
Yi Zheng Rugang Li
Beijing University of Agriculture Chinese Community Church of Indianapolis
206 PUBLICATIONS 9,820 CITATIONS 109 PUBLICATIONS 1,874 CITATIONS
Some of the authors of this publication are also working on these related projects:
All content following this page was uploaded by Rugang Li on 03 May 2018.
Abstract
Tomato mottle mosaic virus (ToMMV) was first identified in 2013 as a to other tobamoviruses evaluated. In host range studies, some differen-
novel tobamovirus infecting tomatoes in Mexico. In just a few years, tial responses in host plants were also identified between ToMMV and
ToMMV has been identified in several countries around the world, in- ToMV. To alleviate cross-serological reactivity among the tomato-
cluding the United States. In the present study, we characterized the mo- infecting tobamoviruses, a new multiplex RT-PCR was developed to al-
lecular, serological, and biological properties of ToMMV and developed low for species-specific detection and identification of TMV, ToMV, and
a species-specific RT-PCR to detect three tomato-infecting tobamovi- ToMMV. In addition, we observed resistance breaking by ToMMV on
ruses: Tobacco mosaic virus (TMV), Tomato mosaic virus (ToMV), selected tomato cultivars that were resistant to ToMV. This has caused
and ToMMV. Previously, ToMMV has been reported in Florida and serious concerns to tomato growers worldwide. In conclusion, the char-
New York. In this study, we made two new reports on the occurrences acterization in molecular and biological properties of ToMMV would
of ToMMV on tomatoes in California and South Carolina. Their com- provide us with fundamental knowledge to manage this emerging virus
plete genome sequences were obtained and their genetic relationships on tomato and other solanaceous crops in the U.S. and around the world.
Tomato (Solanum lycopersicum L.) is one of the most important ToMMV-infected tomato plants are stunted and display severe
vegetable crops in the world (Foolad and Panthee 2012). The United mosaic symptoms and leaf distortion (Li et al. 2013). Comparative
States is the second largest producer of tomatoes, only after China genome sequence analysis classified ToMMV as a distinct virus spe-
(USDA-NASS 2015). Diseases caused by viruses are one of the most cies, with 80% nucleotide sequence identity to TMV and 85% to
critical factors affecting tomato production worldwide (Hanssen et al. ToMV (Li et al. 2013). However, the biological and serological prop-
2010; Hajiabadi et al. 2012; Imran et al. 2012; Lefeuvre et al. 2010; erties of this emerging virus have not been characterized.
Tentchev et al. 2011; Webster et al. 2015). Tobacco mosaic virus An effective disease management program is dependent on timely
(TMV) and Tomato mosaic virus (ToMV) are two of the most recog- and proper identification to the causal agent of a disease. This is es-
nizable and economically important viruses infecting tomato pecially important for a field-collected sample, where mixed in-
(Hanssen et al. 2010). In 2013, using deep sequencing and assembly fection of multiple viruses is quite common. For tomato-infecting
of small RNAs (Zheng et al. 2017; http://bioinfo.bti.cornell.edu/tool/ tobamoviruses, the most common method of virus detection using
VirusDetect/), Tomato mottle mosaic virus (ToMMV) was discov- a serological technology, such as ELISA or a lateral flow device,
ered in Mexico for the first time as a third tobamovirus infecting to- could not make a definite species-specific identification. In light of
mato crops (Li et al. 2013). Subsequently, this virus was identified on multiple tobamoviruses infecting tomatoes and each with some
tomato or pepper plants in Florida (Fillmer et al. 2015) and New York unique biological properties, the demand for species-specific identi-
(Padmanabhan et al. 2015) in the United States, as well as China (Li fication is especially strong. Previous studies demonstrated possibil-
et al. 2014) and Israel (Turina et al. 2016). In 2015, the fourth toba- ity in developing species-specific detection of tobamoviruses using
movirus, Tomato brown rugose fruit virus (TBRFV), was identified reverse transcription (RT)-PCR. Letschert et al. (2002) developed
in Jordan infecting tomatoes (Salem et al. 2016). Analysis of the ge- an immunocapture RT-PCR system to detect five individual tobamo-
nome sequence in TMV-Ohio V (GenBank accession no. FR878069), viruses, including TMV and ToMV. A multiplex immunocapture
originally considered as a novel genotype of TMV (Körbelin et al. RT-PCR assay was developed to allow for a simultaneous detection
2012), revealed less than 90% nucleotide sequence identities to other and differentiation of TMV and ToMV in spruce and pine extracts
known tobamoviruses. Although authors did not name TMV Ohio V (Jacobi et al. 1998). Using sequences from a different virus genome
as a novel species (Körbelin et al. 2012), such unique genome sequence region, another multiplex RT-PCR was developed for TMV and ToMV
in TMV Ohio V should be considered as a new species of tobamovirus detection in tomato and pepper seeds (Kumar et al. 2011). However, due
based on the International Committee on Taxonomy of Viruses (ICTV) to the recent discovery of ToMMV (Li et al. 2013) and other closely re-
demarcation criteria (Adams et al. 2012). lated tobamoviruses (Körbelin et al. 2012; Salem et al. 2016), the pri-
Corresponding author: Kai-Shu Ling, E-mail: [email protected]
mers used for RT-PCR in previous studies need to be examined and
redesigned in order to achieve a reliable species-specific identification.
*The e-Xtra logo stands for “electronic extra” and indicates that one sup- Tomato-infecting tobamoviruses are seed-borne (on seed coat, not
plementary table and two supplementary figures are available online. seed-transmitted) viruses that could be easily transmitted to tomato
seedlings through contacts made to contaminated seeds or during cul-
Accepted for publication 22 December 2016. tivation (Chitra et al. 2002). Diseases caused by these highly conta-
gious viruses are difficult to control. Planting a disease-resistant
cultivar is a most effective means of disease management against
This article is in the public domain and not copyrightable. It may be freely
reprinted with customary crediting of the source. The American Phytopatho- ToMV in tomato production. Tm-1, Tm-2, and Tm22 genes genetically
logical Society, 2017. confer ToMV resistance (Lanfermeijer et al. 2003; Ohmori et al.
704 Plant Disease / Vol. 101 No. 5
1996; Pelham 1966; Young et al. 1988). The TM-1 gene, derived from plant using TRIzol reagent according to the manufacturer’s instruc-
the wild tomato species S. habrochaites, confers resistance to ToMV tions (Thermal Fisher Scientific, U.S.A.). After isolation of small
strains 0 and 2. Tm-2 and Tm22 genes were introgressed from S. peru- RNA (sRNA) from an acrylamide gel, an sRNA library was prepared
vianum and are considered allelic. Tm-2 confers resistance to ToMV as described by Chen et al. (2012) and sequenced using Illumina
strains 0 and 1, whereas Tm22 confers resistance to strains 0, 1, and HiSeq 2000. Small RNA sequence reads were assembled and viruses
2 (Shi et al. 2011). Among these resistance genes, Tm-2 and Tm-22 in- identified using the VirusDetect bioinformatics pipeline (Zheng et al.
duce a plant defense reaction in tomato plants by recognizing the 2017; http://bioinfo.bti.cornell.edu/tool/VirusDetect/). The full ge-
movement proteins of TMV and ToMV (Liu et al. 1999; Weber nome sequence of the ToMMV-California isolate (CA16-01) was as-
et al. 2004). Both resistance genes and their molecular markers useful sembled using Sanger sequencing to a series of overlapping RT-PCR
for marker-assisted selection have been developed and used for tomato amplicons, generated using 10 sets of custom-designed primers (Supple-
breeding for ToMV resistance (Shi et al. 2011). However, in some mentary Table S1). RT-PCR reactions were conducted following
cases, even a small number of amino acid substitutions in the virus ge- the instructions of Takara One Step Ex Taq qRT-PCR Kit (Clontech,
nome can overcome this resistance mechanism (Hamamoto et al. 1997; U.S.A.). Once confirmed through electrophoresis on a 1.5% agarose
Strasser and Pfitzner 2007; Weber et al. 1993). Thus, it is necessary to gel, RT-PCR products were shipped to a sequencing service provider
test whether ToMMV has the ability to break resistance on existing (Functional Biosciences, Madison, WI) for Sanger sequencing. The re-
commercial tomato cultivars. sultant genome sequence was assembled in both orientations using the
In the present study, we determined the complete genome sequences SeqMan program in DNASTAR Lasergene 13 (Madison, WI). Finally,
of two new ToMMV isolates collected from two separate regions in using the MegAlign program in DNASTAR Lasergene 13 with default
the United States, California and South Carolina. By comparing their ge- parameters, pairwise analyses in the genetic relationship of the
nome sequences with other tomato-infecting tobamoviruses, we selected ToMMV isolate SC13-05 with seven other ToMMV isolates and four
the conserved but species-unique primer sequences to develop a multiplex other tomato-infecting tobamoviruses (TMV, ToMV, ToMOHV, and
RT-PCR detection to allow for a species-specific and sensitive detec- TBRFV) were conducted using either their complete genome se-
tion and identification of ToMMV, TMV, and ToMV in a single reaction. quences, or their respective nucleotide and deduced amino acid se-
We also compared the experimental host ranges for ToMMV and ToMV quences for each open reading frame. A phylogenetic relationship
to identify any plant species that are unique for ToMMV. Finally, through among the five tomato-infecting tobamoviruses was depicted using
mechanical inoculation, we observed a partial resistance breaking by the MegAlign program in the DNASTAR Lasergene 13. A multiple
ToMMV on a tomato cultivar ‘B’, which is resistant to ToMV. sequence alignment was generated using the Clustal W method with
complete genome nucleotide sequences of 13 representative virus iso-
Materials and Methods lates. A phylogenetic tree was created using the neighbor-joining
Virus isolates and mechanical inoculation. The ToMMV isolate methodology with 1,000 bootstraps.
MX5 was originally collected in tomato plants from a greenhouse in Serological tests. Both commercial ELISA and ImmunoStrip kits
Mexico (Li et al. 2013). A second ToMMV isolate (CA16-01) was for TMV and ToMV (Agdia, Elkhart, IN) were used to test for their
collected from a greenhouse in California in 2016, and a third serological cross-reactivity against ToMMV isolates following the
ToMMV isolate (SC13-05) was collected from a greenhouse in manufacturer’s instructions. Currently, a ToMMV-specific antibody
South Carolina in 2013. The individual virus isolates were main- is still not available. Thus, an ELISA kit for ToMV was initially used
tained on ‘Moneymaker’ tomato plants within an insect-proof bug to determine positive virus infections on the inoculated plants in host
dome kept in a greenhouse at 25 to 30°C. A ToMV isolate (V13- range studies for both ToMV and ToMMV. A confirmation for spe-
07) was collected on tomato from California and a TMV isolate cific virus infection was determined based on a species-specific mul-
was provided by Agdia (Elkhart, IN), which were confirmed to be tiplex RT-PCR described in the following.
the respective ToMV or TMV using the species-specific RT-PCR Developing a multiplex RT-PCR for species-specific detection
developed in the present study and by sequencing. For virus inoc- of TMV, ToMV, and ToMMV. To achieve species-specific detec-
ulation, healthy plants at the 2- to 3-leaf stage were lightly dusted tion, conserved sequence regions were identified from a multiple-
with Carborundum (320-grit) and gently inoculated with a cotton sequence alignment within each virus species, which would also be
swab soaked in an inoculum prepared (1:5 w/v) in a 1× phosphate- divergent significantly from other tomato-infecting tobamoviruses.
buffered saline solution, pH 7.0 (140 mM NaCl, 8 mM Na2HPO4, Sets of species-specific primers designed for each TMV, ToMV,
1.5 mM KH2PO4, 2.7 mM KCl, and 0.8 mM Na2SO3). After rinsing, and ToMMV, respectively (Table 1) were also confirmed through
inoculated plants were placed in the shade for a few hours before in silico assessment by BLASTn analysis in the NCBI database.
transferring to a greenhouse for symptom observation. In addition, To allow for an easy identification, sizes of amplicons for each of
Cucumber green mottle mosaic virus (CGMMV) and Pepper mild three tobamoviruses were different for more than 250 bp, with pre-
mottle virus (PMMoV), as well as several tomato-infecting viruses, dicted 866, 595, and 289 bp for TMV, ToMV, and ToMMV, respec-
including TBRFV, Pepino mosaic virus (PepMV), Tomato spot- tively (Table 1). After testing in a simplex RT-PCR that each primer
ted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), To- set was capable of amplifying its respective viral sequence, a multi-
mato yellow leaf curl virus (TYLCV), and Potato spindle tuber plex RT-PCR was set up. Using a purified plant RNA preparation or
viroid (PSTVd), were used to evaluate the specificity of multiplex a simple dilution of crude tissue extract in 0.1 M Tris-HCl, pH 8.0 (Li
RT-PCR. and Ling 2014), multiplex RT-PCR was performed using a Takara
Host range. To compare the experimental host range between One Step Ex Taq qRT-PCR Kit (Clontech, U.S.A.). In each 20 ml
ToMMV and ToMV, 27 plant species from seven families (i.e., RT-PCR reaction, it consisted of 10 ml of 2× master mix, 0.5 ml
Amaranthaceae, Apocynaceae, Asteraceae, Brassicaceae, Cucurbita- Ex Taq HS mix (5 U/ml), 0.5 ml RTase mix (5 U/ml), 0.5 ml of primer
ceae, Solanaceae, and Verbenaceae) were germinated and main- P1 (10 mM), 0.5 ml of P2 (10 mM), 0.3 ml of P3 (10 mM), 0.3 ml of P4
tained in a greenhouse. For each plant species, two to seven plants (10 mM), 0.5 ml of P5 (10 mM), 0.5 ml of P6 (10 mM), and 1 ml of
at the 2- to 3-leaf stage were mechanically inoculated with the respec- each RNA template. Thermal cycling reaction was carried out on a
tive isolate of ToMMV or ToMV as described earlier. To determine Mastercycler Nexus (Eppendorf, U.S.A.), with reverse transcription
virus infection, symptom development on the local inoculated leaves at 50°C for 30 min in 1 cycle, followed by denaturation at 95°C for
and the upper systemic leaves was observed weekly for 4 to 6 weeks 2 min, and 35 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for
post inoculation. The presence of ToMV on the systemic leaves at 1 min, with a final extension at 72°C for 10 min. RT-PCR products
the conclusion of an experiment was also determined using a commer- were analyzed through electrophoresis on a 1.5% agarose gel containing
cial ELISA kit and species-specific RT-PCR tests as described in the 1:10,000 SYBR Safe DNA Gel Stain (Thermo Fisher Scientific).
following. Comparative evaluation of disease resistance properties in se-
Sequencing of two new ToMMV isolates. For the ToMMV iso- lected tomato cultivars with resistance to ToMV and ToMMV.
late SC13-05, total plant RNA was extracted from an infected tomato To understand whether tomato cultivars with ToMV resistance could
Plant Disease / May 2017 705
also be resistant to ToMMV, we evaluated three commercial tomato plants was observed for six additional weeks post second inoculation.
cultivars (designated as ‘B’, ‘E’, and ‘I’ respectively, a gift from an In addition to symptom observation, positive virus infection was de-
anonymous seed company) with various levels of resistance to termined through lab tests using ToMV ELISA and the multiplex
ToMV. Cultivar B is a cocktail tomato, cultivar E is a cluster tomato, RT-PCR.
and cultivar I is a mini San Marzano tomato. These tomato cultivars
were screened for resistance along with a control cultivar Money- Results
maker in a greenhouse. Symptom appearance on the test plants Complete genome sequences of two new isolates of ToMMV in
was observed weekly post inoculation with a final reading at 6 weeks the U.S. and phylogenetic analysis. Complete genome sequences
post inoculation (WPI). Besides such side-by-side comparative anal- from two new isolates of ToMMV in the United States (one from
ysis for their resistance properties between the two viruses, additional California and another from South Carolina) were obtained. The
experiments were conducted to demonstrate a resistance breaking oc- complete genome sequence of ToMMV isolate SC13-05 (GenBank
curred on the same test plants in cv. B. Test plants in cv. B were first accession no. KX898033) was achieved through deep sequencing
inoculated with ToMV and demonstrated to be completely resistant. and assembly of sRNAs using the VirusDetect program (Zheng
After 6 WPI, these same test plants were superinfected (a second me- et al. 2017; http://bioinfo.bti.cornell.edu/tool/VirusDetect/), resulted
chanical inoculation) with ToMMV. Symptom expression on the test in a single contig. In addition to ToMMV, a near complete genome
Table 1. Primers designed for species-specific detection of tomato-infecting tobamoviruses (TMV, ToMV, and ToMMV) in multiplex RT-PCR
Primer Sequence 59-39 Reference genome Location Product size (nt)
P1, TMV-F TAGCCGGTTTGGTCGTCACG NC_001367 5108-5127 866
P2, TMV-R ATGCACCTAACAGTGCTGTG 5973-5954
P3, ToMV-F AAGATGTCAAACCAACTTTA NC_002692 3640-3659 595
P4, ToMV-R GAAACATCCAACTCAAGTACG 4234-4214
P5, ToMMV-F CGACCCTGTAGAATTAATAAATATT NC_022230 5775-5799 289
P6, ToMMV-R CACTCTGCGAGTGGCATCCAAT 6063-6042
Table 2. Percentage nucleotide and amino acid sequence identity of tomato-infecting tobamoviruses in comparison with that of ToMMV SC13-05 (KX898033)
Virus isolate ORF1aa ORF1b(RdRP)a ORF2(MP)a ORF3(CP)a Genomeb Accession no.
ToMMV CA16-01 99.4/99.7 99.4/99.8 98.9/99.3 99.8/100.0 99.4 KX898034
ToMMV MX5 99.6/99.2 99.6/99.4 99.5/99.3 99.8/100.0 99.6 KF477193
ToMMV NY13 99.5/99.3 99.5/99.5 99.8/99.6 99.6/99.4 99.5 KT810183
ToMMV 10-100 99.6/99.6 99.6/99.7 99.4/99.3 99.6/100.0 99.5 KM000122
ToMMV Israel-6742 - - - 99.8/99.4 - KP861748
ToMMV Israel-3801 - - - 99.4/98.8 - KP861747
ToMMV Capao Bonito - - - 99.6/100.0 - KT222999
TMV Variant1 78.9/90.3 80.1/91.6 70.4/72.5 76.5/83.1 78.7 V01408
ToMV Queensland 84.7/94.2 85.1/94.7 78.5/81.5 85.2/91.2 84.3 AF332868
TBRFV Tom1-Jo 80.4/91.4 81.8/92.1 73.9/73.0 80.2/86.2 80.7 KT383474
TMV Ohio V 78.8/90.2 80.5/91.2 71.2/71.3 78.1/82.5 79.2 FR878069
a % nucleotide sequence identity / % amino acid sequence identity.
b% nucleotide sequence identity.
Fig. 1. Phylogenetic relationship of the five tomato-infecting tobamoviruses using complete genome nucleotide sequences of selected virus isolates. Virus isolates included in the
alignment are as follow: ToMMV SC13-05 (KX898033); ToMMV CA16-01(KX898034); ToMMV MX5 (KF477193); ToMMV NY13 (KT810183); ToMMV 10-100 (KM000122); ToMV
Queensland (AF332868); TMV Variant1 (V01408); TMV Tor2-L2 (KF972435); TMV Ancestor (KF972427); TMV Fujian (AF395127); TMV Ohio V (FR878069); TMV pet-TW
(EF392659); TBRFV Tom1-Jo (KT383474).
Fig. 2. Development of a multiplex RT-PCR for species-specific detection of TMV, ToMV, and ToMMV. PCR products were analyzed through electrophoresis on a 1.5% agarose gel.
A, Development of the detection method. M: PCR marker; lane 1: nontemplate control; lane 2: healthy control; lane 3: TMV; lane 4: ToMV; lane 5: ToMMV; lane 6: TMV, ToMV, and
ToMMV in mixed infection. B, Specificity of the multiplex RT-PCR. M: PCR marker; lane 1: nontemplate control; lane 2: healthy control; lane 3: TMV, ToMV and ToMMV mixed
infection as positive control; lane 4: PepMV; lane 5: TSWV; lane 6: TCSV; lane 7: TYLCV; lane 8: CGMMV; lane 9: PMMoV; lane 10: PSTVd; lane 11: TBRFV. C, Sensitivity of the
multiplex RT-PCR. M: PCR marker; lane 1: nontemplate control; crude tissue extract was diluted in tenfold increments from 1:1 (lane 2) to 1:105 (lane 7).
Table 4. Comparative evaluation of experimental host range between ToMMV and ToMV
ToMMV ToMV
Family, species, cultivar Common name Symptomsa RT-PCRb Symptomsa RT-PCRb
Amaranthaceae
Chenopodium album Lamb’s quarters CLL/- - CLL/M,D +
Chenopodium berlandieri Lamb’s quarters CLL/- - CLL/M +
Chenopodium giganteum Three spinach CLL/- - CLL/C +
Chenopodium quinoa Quinoa CLL/CL + NLL/M,PD +
Gomphrena globosa Globe amaranth NRS/M + -/M +
Apocynaceae
Catharanthus roseus Rosy periwinkle −/− - NA NA
Asteraceae
Emilia sonchifolia Lilac tasselflower −/− - −/− -
Glebionis coronaria Crown daisy −/− + NA NA
Lactuca sativa Lettuce −/− - −/− -
Brassicaceae
Brassica rapa Field mustard −/− - −/− -
Cucurbitaceae
Citrullus lanatus ‘Charleston Gray’ Watermelon −/− - NA NA
Cucumis melon Cantaloupe −/− - −/− -
Cucumis metulifer Horned melon −/− - −/− -
Cucurbita moschata Butternut squash −/− - NA NA
Solanaceae
Nicotiana benthamiana -/M,D,PD + NA NA
Datura stramonium Jimsonweed -/N, PD + −/− -
Nicotiana debneyi Debney’s tobacco NLL/- - CLL/- -
Nicotiana rustica Aztec tobacco -/M, PD + -/M,PD +
Nicotiana tabacum ‘Samsun’ Tobacco -/M + -/M +
Nicotiana tabacum ‘Xanthi nc’ Tobacco NLL/M + NLL/- -
Petunia x hybrida Garden petunia NLL/- + NA NA
Physalis angulata Cutleaf groundcherry NLL/M + NLL/PD,M +
Physalis pubescens Husk tomato CLL/M + CLL/M +
Solanum lycopersicum ‘Moneymaker’ Tomato -/M,D + -/M +
Solanum melongena Eggplant NLL/- - NLL/- -
Solanum nigrum Black nightshade CLL/YM + -/M +
Verbenaceae
Verbena officinalis var. halei Common verbena −/− + −/− +
a Symptoms observed on inoculated and noninoculated leaves are indicated to the left and right of the slash, respectively. -= no symptoms, CLL = chlorotic local
lesion, CL = chlorotic lesion, C = chlorosis, NLL = necrotic local lesion, NL = necrotic lesion, N = necrosis, M = mosaic, D = distortion, PD = plant death, NRS =
necrotic ringspot, YM = yellow mosaic, NA = not available.
b Indicate the presence of virus in upper, noninoculated leaves. All systemic infections were confirmed by species-specific RT-PCR for ToMV and ToMMV. - =
Table 5. Comparative evaluation of tomato cultivars for resistance to ToMMV and ToMV and identification of resistance breaking on cv. B by ToMMV
ToMMV ToMV Buffer
Cultivar Firsta Seconda Thirda Mean infectionb Firsta Seconda Thirda Mean infectionb Firsta Seconda Thirda Mean infectionb
E 0/12 0/6 0/5 0% 0/12 0/4 0/9 0% 0/12 0/3 0/1 0%
B 3/12 3/6 15/148 12.65% 0/12 0/6 0/12 0% 0/12 0/5 0/6 0%
I 10/12 5/6 5/5 86.96% 11/12 6/6 12/12 96.67% 0/12 0/5 0/3 0%
Mmc 12/12 6/6 6/6 100% 12/12 5/5 8/8 100% 0/12 0/5 0/1 0%
a Number of plants infected/total number of plants inoculated.
b Percentageof plants infected in total number of plants inoculated.
c Mm = Moneymaker.
Fig. 4. Typical symptoms on susceptible cv. B tomato plants infected by ToMMV. A, necrotic lesions and chlorosis on leaves; B, leaf deformation; C, necrotic lesions on fruits; D, fruit
necrosis.