Transgenic Res (2018) 27:451–460

https://doi.org/10.1007/s11248-018-0083-0 (0123456789().,-volV)
(0123456789().,-volV)

BRIEF COMMUNICATION

Gene editing the phytoene desaturase alleles of Cavendish

banana using CRISPR/Cas9
Fatima Naim . Benjamin Dugdale . Jennifer Kleidon . Anthony Brinin .
Kylie Shand . Peter Waterhouse . James Dale

Received: 9 February 2018 / Accepted: 6 June 2018 / Published online: 9 July 2018
Ó The Author(s) 2018

Abstract Bananas are a staple food source and a abundance. This is the first report of a highly effective
major export commodity worldwide. The Cavendish CRISPR/Cas9 modification system using a poly-
dessert banana is a triploid AAA genome type and cistronic gRNA in Cavendish banana. Such an editing
accounts for around 47% of global production. Being platform will be of considerable utility for the
essentially sterile, genetic modification is perhaps the development of disease resistance and novel agro-
only pathway available to improve this cultivar. In this traits in this commercially important cultivar into the
study, we used the CRISPR/Cas9 gene editing system future.
to deliver a self-cleaving polycistronic guide RNA
(gRNA) designed to target exon 1 of the Phytoene Keywords Genome editing  PDS  Cavendish
desaturase (PDS) gene in the Cavendish cultivar banana  CRISPR/Cas9
‘‘Williams’’. Genotyping of 19 independent events
showed a 100% PDS modification rate primarily in the
form of insertions (1–105 nt) or deletions (1–55 nt)
(indels) at the predicted cleavage site. Tri-allelic Introduction
disruptive modifications were observed in 63% of
plants and resulted in both albinism and dwarfing. Pale Bananas are a perennial, herbaceous monocotyle-
green (16%) and wildtype green (21%) phenotypes donous plant grown commercially and by subsistence
generally correlated with in-frame indels in at least farmers in the wet tropics and sub-tropics as both a
one of the three PDS alleles. Editing efficiency was food and fibre crop. Their fruit can be eaten raw or
dependent on both target site selection and Cas9 cooked and serve as a staple starch and food source for
millions throughout the world. Nearly half of the
bananas grown commercially belong to the Cavendish
Fatima Naim and Benjamin Dugdale have contributed equally
to this work.
group, a triploid ‘‘AAA’’ genome type. In 2016, global
banana exports were valued at USD 8 billion and it is
F. Naim (&)  B. Dugdale (&)  J. Kleidon  ranked the most popular fruit in industrialised coun-
A. Brinin  K. Shand  P. Waterhouse  J. Dale tries (FAO 2017 (http://www.fao.org/economic/est/
Centre for Tropical Crops and Biocommodities,
estcommodities/bananas/bananafacts/en/#.Wz18QRS
Queensland University of Technology, Brisbane,
QLD 4000, Australia bFjY); Lescot 2011). Cavendish bananas are
e-mail: [email protected] parthenocarpic, resulting in a seedless fruit, and are
B. Dugdale clonally propagated from suckers or in tissue culture.
e-mail: [email protected] The Cavendish grown today is practically a genetic

123
452 Transgenic Res (2018) 27:451–460

replica of its progenitor discovered and first propa- et al. 2016; Pan et al. 2016). Here, we investigated a
gated over 180 years ago and the varieties cultivated CRISPR/Cas9 multiplex gene editing strategy to
en masse, such as ‘‘Grand Nain’’, are likely natural modify the PDS gene of Cavendish banana. We
clonal variants selected for their desirable agronomic employed the glycine tRNA processing system in
traits (D’Hont et al. 2012a). Being essentially sterile, order to deliver a polycistronic gRNA (Xie et al. 2015)
breeding for the introduction of new and useful traits comprising tandem PDS target sequences into banana
into Cavendish remains virtually impossible. cells. This approach resulted in a 100% chromosomal
Genetic modification is perhaps the only avenue PDS modification rate and sequencing confirmed
available to improve the Cavendish banana, and triallelic deletions or insertions, which generally
considerable progress has been made in the develop- correlated with the strength of the albino phenotype.
ment of effective Agrobacterium-mediated transfor-
mation and plant regeneration systems for this cultivar
(Khanna et al. 2004). Recent advances have seen the Materials and methods
introduction of novel agro-traits into banana including
elevated micronutrient content (Paul et al. 2017), Isolation of the Cavendish PDS genomic DNA
delayed fruit ripening (Elitzur et al. 2016) and sequence
engineered resistance to pathogens including viruses
(Shekhawat et al. 2012), fungi (Dale et al. 2017), and Total genomic DNA was isolated from banana
bacteria (Tripathi et al. 2014). In addition, extensive (Cavendish cv. Williams) leaf material using the
banana bioinformatics resources are now available in CTAB method (Stewart and Via 1993). Primers were
the form of the Banana Genome Hub (http://banana- designed based on the Musa acuminata AAA Group
genome-hub.southgreen.fr/), which provides a valu- cultivar Cavendish phytoene desaturase (PDS) mRNA
able bridge for comparative genome analysis, meta- sequence (GenBank Accession JQ762260). Genomic
bolic pathway profiling and the identification of DNA (1 lg) was used as a template for PCR with the
potentially valuable genes and their expression pat- GoTaqÒ Green PCR Master Mix system (Promega)
terns (D’Hont et al. 2012b). and the primers PDS-F2 (50 -TTTAATTATCGATTG
Genome editing technologies are valuable for explor- TAGATAGACC-30 ) and PDS-R2 (50 -GAGGGCTG
ing the underlying mechanisms of gene function and GCACCATGTCTTGGCT-30 ). PCR cycle conditions
regulation and can serve as a platform for the genetic were as follows: an initial denaturation step at 95 °C
improvement of crops by removing undesirable chro- for 5 min, followed by 25 cycles of 95 °C for 30 s,
mosomal DNA, up- or down-regulating endogenous 50 °C for 30 s, and 72 °C for 30 s, followed by a final
genes and introducing novel coding sequences. CRISPR/ extension at 72 °C for 7 min. PCR products were
Cas9 genome editing has proven to be precise, highly ligated into pGEMÒ-T Easy (Promega) as per the
effective and versatile in a number of dicotyledonous and manufacturer’s specifications. Clones were sequenced
monocotyledonous species (reviewed in Bortesi and using the BigDye Terminator v3.1 sequencing system
Fischer 2015). Of the three CRISPR/Cas9 systems (I, II, (Thermo Fisher) at the Queensland University of
and III), the type II system from Streptococcus pyogenes Technology, Central Analytical Research Facility
has been most utilised and comprises two main compo- (QUT CARF). Sequence was analysed using Vector
nents, the Cas9 endonuclease and a single guide RNA NTI Advance 11 software (Thermo Fisher Scientific).
(gRNA), which includes a 20 nucleotide spacer sequence
targeting the gene of interest and a non-variable Cas9 Construction of CRISPR/Cas9 vectors
binding site (Mali et al. 2013).
Phytoene desaturase (PDS) is a key enzyme in the Two CRISPR/Cas9 vectors were assembled targeting
carotenogenic pathway and its disruption causes the Cavendish PDS gene. The first, construct con-
albinism and dwarfing by impairing chlorophyll, tained the maize polyubiquitin 1 (Ubi1) promoter
carotenoid, and gibberellin biosynthesis. As such, directing expression of the human codon optimised
the PDS gene has been used as a convenient indicator SpCas9 gene and nopaline synthase (nos) termination
for CRISPR/Cas9-mediated gene knockouts in a sequence. The second construct, contained the CaMV
variety of plant species (Fan et al. 2015; Nishitani 35S promoter directing expression of the SpCas9 gene

123
Transgenic Res (2018) 27:451–460 453

and nos terminator. Both cassettes were assembled in Robust HotStart ReadyMix (KAPA) and primers PDS-
pCAMBIA1300 using a Gibson cloning strategy (New F2 and PDS-R2. The PCR cycle conditions were as
England Biolabs, NEB) according to the manufac- follows: an initial denaturation step at 95 °C for
turer’s specifications. The rice U3 small nucleolar 3 min, 35 cycles of 95 °C for 15 s, 56 °C for 15 s, and
RNA promoter was selected to direct expression of the 72 °C for 15 s, followed by a final extension at 72 °C
gRNAs. Two gRNAs targeting Cavendish PDS were for 3 min. The resulting PCR products were gel
inserted downstream of the U3 promoter using the excised and cloned into pGEMÒ-T Easy (Promega)
tRNA-gRNA system and BsaI cloning strategy according to the manufacturer’s specifications.
described by Xie et al. (2015). For gRNA1, primers Twelve representative white colonies were selected
S1 (50 -TAGGTCTCCCATGAAGTTAAGGTTTTA for each transgenic line. Colonies were inoculated into
GAGCTAGAAATAG-30 ) and AS1 (50 -TAGGTCT a PCR containing OneTaqÒ 29 Master Mix (NEB)
CACATGGGAGAGACTGCACCAGCCGGGAAT and primers M13-F (50 -CCCAGTCACGACGTTG
C-30 ) were used and for gRNA2, primers S2 (50 - TAAAACG-30 ) and M13-R (50 -AGCGGATA
TAGGTCTCCGAAGCCAAGACAGTTTTAGAG ACAATTTCACACAGG-30 ). PCRs were cycled as
CTAGAAATAG-3 0 ) and AS2 (5 0 - ATGGTCT described above. A sample (6 lL) of the PCR product
CACTTCTTGTCCTTTGCACCAGCCGGGAA was electrophoresed through a 1% TAE agarose gel to
TC-3 0 ) were used. The resulting constructs were confirm the size of the amplicon. PCR products were
named pUbi-Cas9-PDS and p35S-Cas9-PDS, respec- prepared for sequencing as per NEB protocol with the
tively. Vectors were mobilised into Agrobacterium following modifications. PCR product (2 lL), 1 lL of 5X
tumefaciens strain AGL1 by electroporation for BrightDyeÒ Sequencing buffer (Molecular Cloning Lab-
banana transformation. oratories), 0.125 lL of Exonuclease I (NEB), 0.25 lL of
Shrimp Alkaline Phosphatase (NEB) and 3.625 lL of
Banana transformation and plant regeneration ddH2O were incubated at 37 °C for 45 min followed by
inactivation at 80 °C for 15 min. Sequencing reactions
Musa acuminata Cavendish cv. Williams (AAA were prepared containing 6 lL of enzyme treated PCR
subgroup) embryogenic cell suspensions were pre- product, 1 lL of 5X BrightDyeÒ Sequencing buffer, 0.6
pared from immature male flowers and Agrobac- lL of BrightDyeÒ Terminator, 3.2 pmol of M13-F primer
terium-mediated transformation performed as and ddH2O to a final volume of 20 lL. Thermal cycling
described by Khanna et al. (2004) with minor mod- was carried out as per BrightDyeTMTerminator Cycle
ifications; no centrifugation step was used during Sequencing protocol. Products were Sanger sequenced at
Agrobacteria co-cultivation, banana cells were main- QUT CARF and analysed using Geneious R11 (http://
tained on BSM media for only 1 month (instead of www.geneious.com, Kearse et al. 2012).
three) post-transformation, and hygromycin (Sigma-
Aldrich) antibiotic (5–10 mg/L) was used to select
transformed cells. Proliferating embryos were sepa- Results
rated in order to ensure each regenerated plantlet
represented an independent transgenic event. Estab- Identification of target sequences in the Cavendish
lished plants were maintained in M5 media (Khanna PDS gene
et al. 2004) containing hygromycin (10 mg/L) and
photographed using a Nikon D3 camera fitted with a Using the Cavendish PDS cDNA sequence (GenBank
Nikon AF-S 24–70 mm f2.8 lens. Accession JQ762260), primers were designed to
amplify a short 50 segment of the PDS gene from cv.
Sequence analysis of CRISPR/Cas9 modified Williams leaf gDNA. The resulting product was
plants 444 bp in size and comprised a 47 bp 50 UTR,
222 bp PDS exon 1, 85 bp predicted intron and
Total DNA was extracted from approximately 20 mg 90 bp of PDS exon 2 (Fig. 1; sequence provided in
of freshly ground leaf material using the CTAB Appendix 1). Sequencing of 40 pGEMÒ-T Easy clones
method (Stewart and Via 1993). Approximately 20 ng of the PCR product, showed the 50 UTR and exons
of DNA was used as a template for a PCR with 29 2G were nearly 100% identical to the GenBank accession

123
454 Transgenic Res (2018) 27:451–460

Fig. 1 Schematic of the PDS gene targeted for editing using and Target 2 gRNA binding sites, respectively; A/T represents
CRISPR/Cas9. PDS-F2 and PDS-R2 arrows represent primer the single nucleotide polymorphism at position ? 394 in the
binding sites for PCR; gRNA 1 and gRNA 2 represent Target 1 PDS alleles; red triangles represent predicted cleavage sites

with only a single nucleotide (A/T) polymorphism at albino plants developed more slowly than pale or dark
position ?394. In total, 60% of clones contained an green plants, and these events were stunted.
adenine (A) at this position whereas 40% contained a
thymine (T). PDS is likely a single copy gene Analysis of CRISPR/Cas9-mediated editing
represented by three single alleles in the Cavendish of the PDS gene
triploid AAA genome. Therefore, based on sequence
percentage we assumed two alleles contained an A and The region spanning the Cas9 target sites was PCR
one allele contained a T and are hereafter referred to as amplified from gDNA isolated from each transgenic
29 A and 19 T, respectively. plant. The amplicons were cloned into pGEMÒ-T
We used the WU-CRISPR target prediction server Easy after their apparent sizes had been examined by
(http://crispr.wustl.edu; Wong et al. 2015) to identify gel electrophoresis. Simultaneous cleavage of both
potential target sites in the PDS gDNA for CRISPR/ target sites should produce a 165 bp deletion but none
Cas9 modification. The two selected target sites dif- of the amplicons showed the predicted size shift.
fered in their knockout potency scores, Target 1 (a Nevertheless, sequencing the amplicons revealed the
score of 57) and Target 2 (a score of 71), suggesting presence of insertions or deletions (indels) ranging
that the latter would likely be a more effective guide. from ? 105 bp to - 55 bp with 65% of indels
Simultaneous cleavage of the two target sites by Cas9 observed 0–3 bp upstream of PAM sequence
was predicted to create a deletion of 165 bp in PDS (Table 1). The majority of plants (15/19) were mod-
exon 1 (Fig. 1). ified only at the Target 2 site and four (ALB-03, ALB-
11, GR-02, and PG-03) were modified at both sites,
Transformation and regeneration of banana plants suggesting that CRISPR/Cas9-mediated editing in
with a modified PDS gene banana is relatively efficient. Many of the individual
plants (6/19) contained more than three distinct PDS
Agrobacterium-mediated transformation of cv. Wil- modifications. This may reflect ongoing CRISPR/
liams banana embryogenic cells resulted in the Cas9 modifications in somatic cells, a feature observed
production of 19 transgenic plants, 7 using pUbi- in CRISPR/Cas9 modified T0 generation rice plants
Cas9-PDS and 12 using p35S-Cas9-PDS. The plants (Zhang et al. 2014), and/or the plants are chimeras of
were maintained in tissue culture on media supple- tissues with different indel modifications.
mented with hygromycin (10 mg/L) and each dis- In general, plants displaying a true albino pheno-
played one of three phenotypes: albino (12/19), dark type contained indels in the 29 A and 19 T alleles of
green (4/19) or pale green (3/19) leaves and pseu- the PDS gene that each resulted in frameshifting and
dostem (Fig. 2, Table 1, Appendix 3), suggesting premature termination. For example, plant ALB-01
three different levels of PDS modification. Generally, contained two distinct modifications of ? 1 (29 A

123
Transgenic Res (2018) 27:451–460 455

Fig. 2 Phenotypes associated with CRISPR/Cas9 editing of the the Target 2 gRNA; PAM is underlined; sequence in black bold
PDS gene and representative examples of plant genotype. ALB represent insertions, red dashes represent deletions; black arrow
albino, GR wild-type green, PG pale green; sequence in red indicates head represents predicted Cas9 cleavage site

Table 1 Summary of PDS Phenotype Line # Plasmid Genotype ‘‘A’’ alleles Genotype ‘‘T’’ allele
modifications at the Target
2 site in banana plants Albino Plants ALB-01 pUbi-Cas9-PDS ?1 -2
generated using plasmids
ALB-02 pUbi-Cas9-PDS - 46 - 13
pUbi-Cas9-PDS or p35S-
Cas9-PDS ALB-03 pUbi-Cas9-PDS ?1 - 13
ALB-04 p35S-Cas9-PDS ?1 -5
ALB-05 p35S-Cas9-PDS ?1 ?1
ALB-06 p35S-Cas9-PDS - 13 - 2, - 4
ALB-07 p35S-Cas9-PDS ? 62 ? 1, ? 62
ALB-08 p35S-Cas9-PDS - 13, ? 1 - 2, ? 1
ALB-09 p35S-Cas9-PDS - 13, ? 1 - 13, ? 1
ALB-10 p35S-Cas9-PDS - 13, - 6, ? 1 ?1
ALB-11 pUbi-Cas9-PDS - 3, ? 1, ? 6 ?1
ALB-12 p35S-Cas9-PDS - 2, ? 1 ? 1, - 13, - 2
Green Plants GR-01 pUbi-Cas9-PDS -6 ?1
GR-02 pUbi-Cas9-PDS ?6 - 55
GR-03 p35S-Cas9-PDS -6 - 13, - 8
Numbers represent total
GR-04 p35S-Cas9-PDS -3 - 13, - 1
nucleotide insertions (?) or
deletions (-) for Pale Green Plants PG-01 p35S-Cas9-PDS ?1 ? 99
independent modifications PG-02 p35S-Cas9-PDS ? 1, ? 1 ? 1, ? 1
of either 29 A or 19 T PDS PG-03 pUbi-Cas9-PDS ?1 - 1, ? 1
alleles at the Target 2 site

123
456 Transgenic Res (2018) 27:451–460

alleles) and - 2 bp (19 T allele) at the Target 2 site detected in multiple allelic copies of the PDS gene,
(Fig. 2; Table 1). While it was not possible to and were likely the consequence of the error prone
differentiate between the 29 A alleles, it seems likely non-homologous end joining repair pathway follow-
both contained the same ? 1 insertion as no other ing CRISPR/Cas9-mediated double stranded DNA
modifications were detected in the 12 colonies breaks; a characteristic observed in a number of other
sequenced. The full green plants generally contained CRISPR/Cas9 modified crops (Fan et al. 2015;
an in-frame modification in the 29 A alleles and a Nishitani et al. 2016). No precise dropout deletions
disruptive indel in the 19 T allele. For example, plant were obtained and the frequency of indels differed
GR-01 contained an in-frame 6 bp deletion in the 29 between target sites and the construct used. The fact
A alleles and a 1 bp insertion in the third 19 T allele that the Target 2 sequence had the highest potency
that caused premature termination of the gene (Fig. 2; score by WU-CRISPR (http://crispr.wustl.edu) and
Table 1). In contrast, genotyping of plants displaying was edited in every plant suggests that the algorithm is
a pale green phenotype was more difficult to interpret. very useful for selecting target sequences in banana.
In the case of PG-01, this plant appeared uniformly Coupled with improved genomic information, selec-
pale green and contained a disruptive modification tion of two targets each with WU-CRISPR scores over
(? 1 insertion) in the 29 A alleles causing premature 70 may be more effective at generating defined dele-
termination and an in-frame 99 bp insertion (105 bp tions. Editing at both target sites only occurred in
insertion and a 6 bp deletion) in 19 T allele (Fig. 2; plants transformed with the pUbi-Cas9-PDS construct.
Table 1). This could result in uniform but weak PDS Considering the maize Ubi1 promoter directs expres-
activity as the modified site is located in the unstruc- sion levels up to 4-fold higher than the CaMV 35S
tured amino-terminus of the PDS protein, a region promoter in banana cells (Dugdale et al. 1998), this
likely to accommodate a 33 amino acid insertion would suggest that the efficacy of CRISPR/Cas9
without greatly affecting enzyme function (http:// editing is proportional to Cas9 abundance. Integration
www.rcsb.org/). Plants PG-02 and PG-03 were chi- of the CRISPR/Cas9 cassette was confirmed by PCR
meric in both phenotype and genotype, with pale green only; our previous studies have shown a low frequency
leaves and pseudostem containing patches of albino of transgene integrations (between 1–4 copies) in
cells (Appendix 2) and three or more independent Cavendish cv. Williams following Agrobacterium-
modifications that resulted in disruptive frameshifts to mediated (strain AGL1) transformation (results not
all three alleles (Table 1 and Appendix 3). The pre- shown). In a recent transgenic banana field trial by
dominant modification in these plants was ? Paul et al. (2017), transgene stability was maintained
frameshifting in all three alleles, which is difficult to throughout the life cycle of the plants and over sub-
correlate with the leaf colour (as it would be expected sequent generations. Likewise, we anticipate CRISPR/
to produce albinism). Perhaps these plants are initially Cas9 modifications will be stably inherited in sucker
defective in the 29 A alleles, providing uniform pale plants propagated vegetatively. Indeed, daughter
green cells, and subsequently lose 19 T allele activity plants derived from PDS modified lines generated in
by continued Cas9 editing in random patches of this study displayed the same degree of photo-
somatic cells. bleaching as their parent, following in vitro multipli-
cation (Appendix 4).
Notably, 63% of the transgenic plants displayed full
Discussion albinism from triallelic PDS knockouts and 100%
showed some form of Cas9-mediated editing. In a
In order to assess the effectiveness of gene editing in similar study by Kaur et al. (2017), CRISPR/Cas9-
Cavendish banana, we used the CRISPR/Cas9 system mediated editing of PDS in the banana cultivar
to target the endogenous phytoene desaturase (PDS) ‘‘Rasthali’’ (Silk AAB group) was significantly less
gene with a polycistronic gRNA comprising two target efficient (59% total editing). In this case, a single
sequences in exon 1. This approach generated a 100% gRNA targeting PDS exon 5 was used and plants
PDS modification success rate, primarily in the form displayed predominantly variegated leaves with few
of small nucleotide indels upstream of the PAM true albino plants surviving tissue culture. Considering
consensus sequence. Indel modifications were the complex polyploid nature of the Cavendish

123
Transgenic Res (2018) 27:451–460 457

genome and the lengthy time required to generate Acknowledgements The authors thank Joshua Philips for
transgenic banana plants for field analysis, a highly critical reading of manuscript and staff at QUT CARF for their
assistance with Sanger sequencing.
efficient editing platform for creating triallelic
homozygous modifications is essential for the future Compliance with ethical standards
improvement of this cultivar.
The uniform monoculture of Cavendish makes it Conflict of interest The authors declare that there is no con-
flict of interest.
particularly susceptible to diseases for which it has no
natural resistance. Bananas are prone to a number of Open Access This article is distributed under the terms of the
important disease threats already that can significantly Creative Commons Attribution 4.0 International License (http://
reduce fruit yields and decimate crops, including creativecommons.org/licenses/by/4.0/), which permits unre-
stricted use, distribution, and reproduction in any medium,
bunchy top disease caused by banana bunchy top provided you give appropriate credit to the original
virus, Black and Yellow Sigatoka caused by My- author(s) and the source, provide a link to the Creative Com-
cosphaerella spp., Bacterial wilt caused by Xantha- mons license, and indicate if changes were made.
monas campestris pv. musacearum and the
devastating Panama disease or Tropical Race 4 caused
by Fusarium oxysporum f. sp. cubense. With ongoing Appendix 1
gene discovery in a range of related sub-species there
is potential to engineer Cavendish resistant to multiple See Fig. 3.
diseases. The establishment of an efficient gene
editing platform that can manipulate endogenous
disease resistance genes and up- or down- regulate Appendix 2
their expression patterns, by either knock-out or
knock-in modifications, is a significant step towards See Fig. 4.
achieving these goals.

Fig. 3 Sequence of the Cavendish cv. ‘‘Williams’’ PDS gene fragment targeted for editing

123
458 Transgenic Res (2018) 27:451–460

Fig. 4 Leaf colour phenotypes associated with CRISPR/Cas9 modification of the PDS gene. ALB albino, GR wild-type green, PG pale
green. Black arrow designates albino patch of cells on pale green leaf background
Appendix 3

See Fig. 5.

Fig. 5 Sanger sequence trace of representative CRISPR/Cas9 edited albino, pale green and wild-type green plants

123
Transgenic Res (2018) 27:451–460 459

Appendix 4

See Fig. 6.

Fig. 6 Stable inheritance of PDS modifications causing albino, pale green and wild-type green phenotypes in daughter plants following
in vitro multiplication

References Khanna H, Becker D, Kleidon J, Dale JL (2004) Centrifugation

assisted Agrobacterium tumefaciens-mediated transfor-
Bortesi L, Fischer R (2015) The CRISPR/Cas9 system for plant mation (CAAT) of embryogenic cell suspensions of banana
genome editing and beyond. Biotechnol Adv 33:41–52 (Musaspp. Cavendish AAA and Lady finger AAB). Mol
D’Hont A et al (2012a) The banana (Musa acuminata) genome Breed 14:239–252
and the evolution of monocotyledonous plants. Nature Lescot T (2011) The genetic diversity of banana in figures.
488:213–219 FruiTrop 189:58–62
D’Hont A, Denoeud F, Aury J-M, Baurens F-C, Carreel F, Mali P et al (2013) RNA-guided human genome engineering via
Garsmeur O, Noel B, Bocs S, Droc G, Rouard M (2012b) Cas9. Science 339:823–826. https://doi.org/10.1126/
The banana (Musa acuminata) genome and the evolution science.1232033
of monocotyledonous plants. Nature 488:213–217 Nishitani C, Hirai N, Komori S, Wada M, Okada K, Osakabe K,
Dale J et al (2017) Transgenic Cavendish bananas with resis- Yamamoto T, Osakabe Y (2016) Efficient genome editing
tance to Fusarium wilt tropical race 4. Nat Commun in apple using a CRISPR/Cas9 system. Nat Sci Rep
8:1496. https://doi.org/10.1038/s41467-017-01670-6 6:31481. https://doi.org/10.1038/srep31481
Dugdale B, Beetham PR, Becker DK, Harding RM, Dale JL Pan C, Ye L, Qin L, Liu X, He Y, Wang J, Chen L, Lu G (2016)
(1998) Promoter activity associated with the intergenic CRISPR/Cas9-mediated efficient and heritable targeted
regions of banana bunchy top virus DNA-1 to -6 in trans- mutagenesis in tomato plants in the first and later genera-
genic tobacco and banana cells. J Gen Virol 79:2301–2311 tions. Nat Sci Rep 6:24765. https://doi.org/10.1038/
Elitzur T, Yakir E, Quansah L, Zhangjun F, Vrebalov J, Khayat srep247651
E, Giovannoni J, Friedman H (2016) Banana MaMADS Paul J-Y et al (2017) Golden bananas in the field: elevated fruit
transcription factors are necessary for fruit ripening and pro-vitamin A from the expression of a single banana
molecular tools to promote shelf-life and food security. transgene. Plant Biotechnol J 15:520–532. https://doi.org/
Plant Phys 171:380–391 10.1111/pbi.12650
Fan D, Liu T, Li C, Jiao B, Li S, Hou Y, Luo K (2015) Efficient Shekhawat UKS, Ganapathi TR, Hadapad AB (2012) Trans-
CRISPR/Cas9-mediated targeted mutagenesis in Populus genic banana plants expressing small interfering RNAs
in the first generation. Nat Sci Rep 5:2217. https://doi.org/ targeted against viral replication initiation gene display
10.1038/srep12217 high-level resistance to banana bunchy top virus infection.
Kaur N, Alok A, Shivani, Kaur N, Pandey P, Awasthi P, Tiwari J Gen Virol 93:1804–1813
S (2017) CRISPR/Cas9-mediated efficient editing in phy- Stewart CN, Via LE (1993) A rapid CTAB DNA isolation
toene desaturase (PDS) demonstrates precise manipulation technique useful for RAPD fingerprinting and other PCR
in banana cv. Rasthali genome. Funct Integr Genomics. applications. Biotechniques 14:748–750
https://doi.org/10.1007/s10142-017-0577-5 Tripathi L, Tripathi JN, Kiggundu A, Korie S, Shotkoski F,
Kearse M et al (2012) Geneious Basic: an integrated and Tushemereirwe WK (2014) Field trial of Xanthomonas wilt
extendable desktop software platform for the organization disease-resistant bananas in East Africa. Nat Biotechnol
and analysis of sequence data. Bioinformatics 32:868–870
28:1647–1649

123
460 Transgenic Res (2018) 27:451–460

Wong N, Liu W, Wang X (2015) WU-CRISPR: characteristics Zhang H et al (2014) The CRISPR/Cas9 system produces
of functional guide RNAs for the CRISPR/Cas9 system. specific and homozygous targeted gene editing in rice in
Genome Biol 16:218 one generation. Plant Biotechnol J 12:797–807
Xie, K, Minkenberg, B, Yang Y (2015) Boosting CRISPR/Cas9
multiplex editing capability with the endogenous tRNA-
processing system. PNAS 112(11):3570–3575

123